ID: 904134021

View in Genome Browser
Species Human (GRCh38)
Location 1:28297122-28297144
Sequence GAGGAAGAGGCTGGCACAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904134021_904134028 -1 Left 904134021 1:28297122-28297144 CCTACTGTGCCAGCCTCTTCCTC No data
Right 904134028 1:28297144-28297166 CTCCTACGTGGGAGGCCCTTTGG No data
904134021_904134026 -9 Left 904134021 1:28297122-28297144 CCTACTGTGCCAGCCTCTTCCTC No data
Right 904134026 1:28297136-28297158 CTCTTCCTCTCCTACGTGGGAGG No data
904134021_904134034 15 Left 904134021 1:28297122-28297144 CCTACTGTGCCAGCCTCTTCCTC No data
Right 904134034 1:28297160-28297182 CCTTTGGAATAGAGGTTAGGAGG No data
904134021_904134030 7 Left 904134021 1:28297122-28297144 CCTACTGTGCCAGCCTCTTCCTC No data
Right 904134030 1:28297152-28297174 TGGGAGGCCCTTTGGAATAGAGG No data
904134021_904134031 12 Left 904134021 1:28297122-28297144 CCTACTGTGCCAGCCTCTTCCTC No data
Right 904134031 1:28297157-28297179 GGCCCTTTGGAATAGAGGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904134021 Original CRISPR GAGGAAGAGGCTGGCACAGT AGG (reversed) Intergenic
No off target data available for this crispr