ID: 904134022

View in Genome Browser
Species Human (GRCh38)
Location 1:28297131-28297153
Sequence CACGTAGGAGAGGAAGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904134022_904134031 3 Left 904134022 1:28297131-28297153 CCAGCCTCTTCCTCTCCTACGTG No data
Right 904134031 1:28297157-28297179 GGCCCTTTGGAATAGAGGTTAGG No data
904134022_904134034 6 Left 904134022 1:28297131-28297153 CCAGCCTCTTCCTCTCCTACGTG No data
Right 904134034 1:28297160-28297182 CCTTTGGAATAGAGGTTAGGAGG No data
904134022_904134028 -10 Left 904134022 1:28297131-28297153 CCAGCCTCTTCCTCTCCTACGTG No data
Right 904134028 1:28297144-28297166 CTCCTACGTGGGAGGCCCTTTGG No data
904134022_904134030 -2 Left 904134022 1:28297131-28297153 CCAGCCTCTTCCTCTCCTACGTG No data
Right 904134030 1:28297152-28297174 TGGGAGGCCCTTTGGAATAGAGG No data
904134022_904134035 24 Left 904134022 1:28297131-28297153 CCAGCCTCTTCCTCTCCTACGTG No data
Right 904134035 1:28297178-28297200 GGAGGACAGTCTCTATGTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904134022 Original CRISPR CACGTAGGAGAGGAAGAGGC TGG (reversed) Intergenic
No off target data available for this crispr