ID: 904134025

View in Genome Browser
Species Human (GRCh38)
Location 1:28297135-28297157
Sequence CTCCCACGTAGGAGAGGAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904134025_904134030 -6 Left 904134025 1:28297135-28297157 CCTCTTCCTCTCCTACGTGGGAG No data
Right 904134030 1:28297152-28297174 TGGGAGGCCCTTTGGAATAGAGG No data
904134025_904134034 2 Left 904134025 1:28297135-28297157 CCTCTTCCTCTCCTACGTGGGAG No data
Right 904134034 1:28297160-28297182 CCTTTGGAATAGAGGTTAGGAGG No data
904134025_904134035 20 Left 904134025 1:28297135-28297157 CCTCTTCCTCTCCTACGTGGGAG No data
Right 904134035 1:28297178-28297200 GGAGGACAGTCTCTATGTAGAGG No data
904134025_904134031 -1 Left 904134025 1:28297135-28297157 CCTCTTCCTCTCCTACGTGGGAG No data
Right 904134031 1:28297157-28297179 GGCCCTTTGGAATAGAGGTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904134025 Original CRISPR CTCCCACGTAGGAGAGGAAG AGG (reversed) Intergenic
No off target data available for this crispr