ID: 904134029

View in Genome Browser
Species Human (GRCh38)
Location 1:28297146-28297168
Sequence TTCCAAAGGGCCTCCCACGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904134029_904134034 -9 Left 904134029 1:28297146-28297168 CCTACGTGGGAGGCCCTTTGGAA No data
Right 904134034 1:28297160-28297182 CCTTTGGAATAGAGGTTAGGAGG No data
904134029_904134035 9 Left 904134029 1:28297146-28297168 CCTACGTGGGAGGCCCTTTGGAA No data
Right 904134035 1:28297178-28297200 GGAGGACAGTCTCTATGTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904134029 Original CRISPR TTCCAAAGGGCCTCCCACGT AGG (reversed) Intergenic
No off target data available for this crispr