ID: 904134034

View in Genome Browser
Species Human (GRCh38)
Location 1:28297160-28297182
Sequence CCTTTGGAATAGAGGTTAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904134021_904134034 15 Left 904134021 1:28297122-28297144 CCTACTGTGCCAGCCTCTTCCTC No data
Right 904134034 1:28297160-28297182 CCTTTGGAATAGAGGTTAGGAGG No data
904134025_904134034 2 Left 904134025 1:28297135-28297157 CCTCTTCCTCTCCTACGTGGGAG No data
Right 904134034 1:28297160-28297182 CCTTTGGAATAGAGGTTAGGAGG No data
904134029_904134034 -9 Left 904134029 1:28297146-28297168 CCTACGTGGGAGGCCCTTTGGAA No data
Right 904134034 1:28297160-28297182 CCTTTGGAATAGAGGTTAGGAGG No data
904134022_904134034 6 Left 904134022 1:28297131-28297153 CCAGCCTCTTCCTCTCCTACGTG No data
Right 904134034 1:28297160-28297182 CCTTTGGAATAGAGGTTAGGAGG No data
904134027_904134034 -4 Left 904134027 1:28297141-28297163 CCTCTCCTACGTGGGAGGCCCTT No data
Right 904134034 1:28297160-28297182 CCTTTGGAATAGAGGTTAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904134034 Original CRISPR CCTTTGGAATAGAGGTTAGG AGG Intergenic
No off target data available for this crispr