ID: 904146136

View in Genome Browser
Species Human (GRCh38)
Location 1:28393322-28393344
Sequence CTATGGCAACACTAATTTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 138}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904146136 Original CRISPR CTATGGCAACACTAATTTAT TGG Intronic
904146136 1:28393322-28393344 CTATGGCAACACTAATTTATTGG + Intronic
907270277 1:53287157-53287179 CTATGGCAACACCAATTAAATGG + Intronic
912146825 1:106804347-106804369 CTTTGTCAAAATTAATTTATAGG - Intergenic
917769792 1:178265158-178265180 ATATGAAAACACTAATTTAGTGG - Intronic
918349733 1:183642303-183642325 AAATGGGAACACTAATTTCTAGG - Intronic
918429696 1:184446435-184446457 TTTTGGCAAGAATAATTTATAGG - Intronic
918981651 1:191568351-191568373 CTATGAAAACAGTAATTTTTAGG + Intergenic
919162416 1:193847950-193847972 CTGTGCCAACACTAATGCATCGG - Intergenic
919269987 1:195328425-195328447 CTATAGCAACACTTGTTAATTGG - Intergenic
920645354 1:207799293-207799315 CCAAGGGAACACTAATTTAAAGG + Intergenic
1063473599 10:6308876-6308898 TTTTGGCAAGACTACTTTATGGG - Intergenic
1065162386 10:22936491-22936513 CTATGGCCACTCTAATTGACTGG + Intronic
1080854733 11:36102466-36102488 CTTTAGCAACACCAGTTTATGGG + Intronic
1084522315 11:69671434-69671456 CAATGTCAACATTATTTTATTGG + Intronic
1085630182 11:78108587-78108609 ATATGGTAAATCTAATTTATTGG - Intronic
1094044993 12:26157778-26157800 CTATGGCAACCCTAAACTATGGG + Intronic
1095262234 12:40109843-40109865 TTATGGCAACTCAAATATATTGG - Intergenic
1097195828 12:57242064-57242086 CTAAGGCAAAACCAATTTACTGG - Intergenic
1101147409 12:101854273-101854295 CTATGGAGAGACTCATTTATGGG - Intergenic
1105639295 13:22245974-22245996 CTTTGGCAAGACCTATTTATTGG + Intergenic
1107334290 13:39337165-39337187 CTATGACATCACTAAGTGATAGG - Intergenic
1107626283 13:42288911-42288933 TTATGGCAAGAATACTTTATAGG + Intronic
1112277005 13:98030373-98030395 CACTGGCCATACTAATTTATAGG - Intergenic
1112566279 13:100553439-100553461 CTATGGCAACAAGAATGAATAGG + Intronic
1116709286 14:48344899-48344921 GTTTGGCAAAACTACTTTATAGG - Intergenic
1117831343 14:59754322-59754344 CTCTGGCAACACTAAGGGATAGG + Intronic
1118524964 14:66629730-66629752 CTATGACATCACTATTTGATAGG + Intronic
1121531953 14:94660930-94660952 CTATGGAAACACTGGTTCATTGG + Intergenic
1130234158 15:82118577-82118599 CTATGGCATCACTAGATGATAGG - Intergenic
1131332440 15:91514390-91514412 CTATGTCAGCCCTAATTGATTGG - Intergenic
1131643756 15:94319917-94319939 CTATTGCAACAATAAGCTATTGG - Intronic
1135526015 16:23214316-23214338 CAATGGCAACAAGCATTTATGGG - Intronic
1136078151 16:27831043-27831065 CTCTGGCAACAGTAATTGGTTGG + Intronic
1137960626 16:52878430-52878452 CTATGGAAACAGAAATATATTGG - Intergenic
1138101593 16:54256351-54256373 CTGGGACAACACTAAATTATAGG + Intronic
1138796464 16:59975590-59975612 CTATGTCAACACCAAATTACTGG + Intergenic
1140016417 16:71191192-71191214 CAATAGCAACACTAATTTTTTGG - Intronic
1140841964 16:78848196-78848218 GTATGTCAACTCTAATTCATTGG - Intronic
1144870620 17:18368011-18368033 CTATGCCAACACTAATCAAAAGG - Intergenic
1147061460 17:37882614-37882636 CTATGCCAAAACTACTTTAGAGG + Intergenic
1148999507 17:51742495-51742517 CTAAAGCAACACAAATTTGTAGG - Intronic
1150023767 17:61649864-61649886 CTTTGGCAAGACTACTTCATAGG - Intergenic
1153307111 18:3641641-3641663 CTATGGCAACAATAGTAGATTGG + Intronic
1155497930 18:26460901-26460923 CTATGGCCACAATCATTTCTGGG + Intronic
1156072516 18:33229840-33229862 CTATGGCATCACTAGCTAATTGG - Intronic
1161845853 19:6711581-6711603 CTAAAGCAACACACATTTATGGG - Intronic
1167986570 19:53323672-53323694 CTAAGGCAACATAAAATTATAGG - Intergenic
928806451 2:35162424-35162446 CTAAGCCAACACTAATTAATAGG + Intergenic
929227344 2:39524479-39524501 CCATGCCAAAACAAATTTATAGG + Intergenic
932669827 2:73727889-73727911 CTTTGGCCACACCCATTTATTGG - Intergenic
932909002 2:75785755-75785777 CCATGGAAACACCAATTTGTGGG + Intergenic
932957991 2:76378004-76378026 TTATGGCATCATTAATCTATTGG + Intergenic
933133059 2:78697672-78697694 CTATGGCAATTATAATTTTTTGG - Intergenic
933323489 2:80806650-80806672 CACTGGCAACAATAATTCATTGG + Intergenic
940521460 2:154755512-154755534 CTATGGCTACATTTATTTACAGG - Intronic
942533248 2:176935213-176935235 CTCTGGCCCCACTCATTTATTGG - Intergenic
946649889 2:221880822-221880844 CTATGGCAACACTATTAGACAGG - Intergenic
947905663 2:233759991-233760013 CTGTGGAAATACTAATTTAATGG + Intronic
1170064292 20:12293867-12293889 CTCTGGCAGCAGTAGTTTATAGG - Intergenic
1175445034 20:59014135-59014157 CTGTGGCAACTCTGATTTACAGG - Intergenic
1182715813 22:32355471-32355493 TTATGGAAACACTTCTTTATTGG - Intronic
1182787538 22:32920171-32920193 ATTAGGCAACACTAAATTATAGG - Intronic
951169537 3:19524140-19524162 TAATGGCAACACTAATTCAGAGG - Intronic
953006425 3:38983398-38983420 CTATTGAAACTCTATTTTATAGG - Intergenic
953349890 3:42207487-42207509 CTATGCCACCACTAATTAAGTGG + Intronic
954280223 3:49571884-49571906 CTCTGGAAAAGCTAATTTATTGG - Intronic
955576424 3:60369394-60369416 CTATGGTAACTCTAATATCTTGG + Intronic
956084422 3:65595248-65595270 CTATGGCACCATTAATTCATGGG + Intronic
957753502 3:84456008-84456030 CTATGGCCACATTATTTTGTAGG + Intergenic
957890529 3:86351649-86351671 CTTTGTCATCACTTATTTATTGG + Intergenic
958079780 3:88732049-88732071 CTACAGCATCACTAATTGATAGG - Intergenic
959344859 3:105180890-105180912 CTTTGGCAACTCTGATTTAGTGG + Intergenic
959408517 3:105991505-105991527 CTATCAAAACACCAATTTATTGG + Intergenic
959687050 3:109158898-109158920 CCATGGCAACATAAATGTATGGG + Intergenic
960346268 3:116536968-116536990 CTATGGCATTATTAATTTGTAGG - Intronic
960824937 3:121772637-121772659 CGACTGCAACACTACTTTATGGG - Exonic
961240787 3:125409359-125409381 TTTTGGCAAGACTACTTTATAGG + Intergenic
962154187 3:132927176-132927198 AAATAACAACACTAATTTATGGG + Intergenic
962487898 3:135862789-135862811 CTAGGGCACGAATAATTTATGGG - Intergenic
962942117 3:140134523-140134545 CTATGGAAACATTATTTTATGGG - Intronic
964796142 3:160498982-160499004 TTATTGTAACAGTAATTTATGGG - Exonic
965434666 3:168634570-168634592 CTATGGCAAAATTACTTTAATGG - Intergenic
965508117 3:169538354-169538376 CTATGACAACACTAATTCATTGG + Intronic
965736247 3:171824033-171824055 TTATGGAAACATTATTTTATGGG - Intergenic
966035264 3:175404836-175404858 CTTTGGCAACACACATTTCTGGG + Intronic
966097513 3:176221450-176221472 CTATAGAAATACTAGTTTATAGG - Intergenic
966262672 3:177999075-177999097 ATATGCCAACAATAATTCATAGG - Intergenic
970022521 4:11584934-11584956 CTTTGGTCACACTAATTTTTAGG + Intergenic
971945498 4:33270967-33270989 CTTTGTCAACACAAAATTATAGG - Intergenic
975433700 4:74325051-74325073 ATATGGTAAAACTGATTTATGGG - Intergenic
977071615 4:92396838-92396860 CTAGGTCAACACTACTATATTGG - Intronic
977724047 4:100273695-100273717 ATATGGAAACATTAATTCATAGG + Intergenic
978775539 4:112502856-112502878 CTAAGGGAACACTAGTTCATAGG + Intergenic
979399256 4:120227920-120227942 GTATGGCAACATTAAATGATTGG + Intergenic
979889963 4:126079380-126079402 ATTTGGCAATAATAATTTATAGG - Intergenic
980541104 4:134197202-134197224 ATATGCCAACTCTAATTCATTGG + Exonic
982975113 4:162046888-162046910 CTATGACAACTCTTACTTATGGG - Intronic
984329099 4:178292329-178292351 TCATGGCAACACTCATTTCTTGG + Intergenic
984398404 4:179229415-179229437 CTATGGAAACACTAAGATACAGG - Intergenic
987447024 5:18032786-18032808 CTATGGCACCAAAAATTTATAGG + Intergenic
987745920 5:21971703-21971725 CTAGAGCAACAATAAATTATAGG - Intronic
987763507 5:22195057-22195079 CTATGGCAACCCATATTTCTAGG - Intronic
988116211 5:26894764-26894786 CTATAACAACAATATTTTATTGG + Intronic
991898230 5:71428148-71428170 CTATGGCAACCCATATTTCTAGG - Intergenic
992886404 5:81164676-81164698 CGATGGCAACACAGATTTAGGGG + Intronic
994909453 5:105883859-105883881 CTATGACATCACTAAGTGATAGG - Intergenic
995964632 5:117889665-117889687 CTCTGTCAATACAAATTTATTGG + Intergenic
997738020 5:136228708-136228730 CCATGAGGACACTAATTTATTGG - Intronic
997792869 5:136777955-136777977 TTATGGAAACACAAATCTATTGG + Intergenic
999181501 5:149672978-149673000 CCTTGACAACACTATTTTATGGG - Intergenic
1000897274 5:166870757-166870779 AAAAGGCAACTCTAATTTATGGG - Intergenic
1004201219 6:13549726-13549748 CTTTGGCAACACCAAGGTATTGG - Intergenic
1005662383 6:28012015-28012037 CGACTGCAACACTACTTTATGGG + Intergenic
1005746286 6:28841192-28841214 CTATGAAAAGACTAATTTCTCGG - Intergenic
1006140277 6:31924767-31924789 CTATGGCAACAAATATTTCTAGG - Intronic
1008682693 6:53890804-53890826 TTATGGCAACATTATTTGATTGG - Intronic
1011118833 6:83927468-83927490 CTGTGATAACACTGATTTATAGG - Intronic
1011198449 6:84807291-84807313 CTATGGTTATACTCATTTATAGG - Intergenic
1012661869 6:101908547-101908569 TTATGGTAACATTAACTTATAGG - Intronic
1014775671 6:125506927-125506949 TTATGGCAACACTCACTTCTTGG - Intergenic
1015844210 6:137502162-137502184 CTTTGGCAACACTTTTCTATTGG - Intergenic
1016072497 6:139756635-139756657 CTAAAGCAACACTGATTTAAAGG + Intergenic
1023110571 7:36806870-36806892 CTAAGGCAACATAAAATTATGGG - Intergenic
1027619550 7:80466587-80466609 ATATGGGAACTCTAATTTGTGGG + Intronic
1027960275 7:84937529-84937551 CAATAGCAACAATAATTTAAAGG + Intergenic
1030027486 7:105338747-105338769 ATATTTCAACAATAATTTATTGG - Intronic
1030576836 7:111298374-111298396 TTTTAGCAACATTAATTTATCGG - Intronic
1030928841 7:115496782-115496804 TTATGGCAAAACTAAATAATGGG - Intergenic
1031157779 7:118130439-118130461 ATATGGCAACCCTAATTTTATGG - Intergenic
1035832012 8:2705875-2705897 CTATGGTAATAATAAATTATTGG - Intergenic
1035975992 8:4312241-4312263 ATATTGCAATCCTAATTTATTGG + Intronic
1038281773 8:26171959-26171981 CTTTGGCAAGACAACTTTATAGG - Intergenic
1045357861 8:101405262-101405284 CTTTGGAAACATTTATTTATGGG + Intergenic
1045541555 8:103091221-103091243 CTTTGGCAAAGTTAATTTATAGG + Intergenic
1045752729 8:105504867-105504889 CTATTCCCACAATAATTTATGGG - Intronic
1047290176 8:123522955-123522977 CTATGGCAACACTAGGTGCTTGG + Intronic
1048510611 8:135058730-135058752 CACTGACAACACTAAGTTATGGG + Intergenic
1050087637 9:1982860-1982882 CTATGGCAACTGGTATTTATTGG - Intergenic
1050552982 9:6763621-6763643 CAATGGTAACACTGATTCATAGG - Intronic
1050772841 9:9225034-9225056 CTATGGCAACTCAAATCCATAGG + Intronic
1051214406 9:14780664-14780686 CTATGGCAGCATTAATTAAATGG - Intronic
1055382073 9:75718471-75718493 ATGTGGCAAACCTAATTTATAGG - Intergenic
1058060566 9:100491488-100491510 CTTAGGGAACATTAATTTATAGG + Intronic
1187209882 X:17218859-17218881 CTATGACATCACTAAGTGATAGG - Intergenic
1191640486 X:63426559-63426581 CAATGGCAACACAGATTTATTGG + Intergenic
1195630070 X:107046317-107046339 CTATGACATCACTAGATTATGGG + Intergenic
1199165942 X:144675371-144675393 CCATGACAAAACTACTTTATAGG - Intergenic
1202025076 Y:20512842-20512864 CTATGGCATCACTAAACAATAGG - Intergenic