ID: 904152617

View in Genome Browser
Species Human (GRCh38)
Location 1:28454908-28454930
Sequence CTGAGCTGGTCTCAAACTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 35527
Summary {0: 1, 1: 17, 2: 488, 3: 4762, 4: 30259}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904152617 Original CRISPR CTGAGCTGGTCTCAAACTGC TGG (reversed) Intronic
Too many off-targets to display for this crispr