ID: 904163055

View in Genome Browser
Species Human (GRCh38)
Location 1:28535398-28535420
Sequence CTCCAGCAGGGCAAATTGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 117}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904163043_904163055 21 Left 904163043 1:28535354-28535376 CCAACCGTGGTGGCCGGCAAGGC 0: 1
1: 0
2: 0
3: 11
4: 71
Right 904163055 1:28535398-28535420 CTCCAGCAGGGCAAATTGGCAGG 0: 1
1: 0
2: 1
3: 5
4: 117
904163047_904163055 8 Left 904163047 1:28535367-28535389 CCGGCAAGGCCTCGGTAAGTGGC 0: 1
1: 0
2: 0
3: 3
4: 68
Right 904163055 1:28535398-28535420 CTCCAGCAGGGCAAATTGGCAGG 0: 1
1: 0
2: 1
3: 5
4: 117
904163044_904163055 17 Left 904163044 1:28535358-28535380 CCGTGGTGGCCGGCAAGGCCTCG 0: 1
1: 0
2: 0
3: 20
4: 684
Right 904163055 1:28535398-28535420 CTCCAGCAGGGCAAATTGGCAGG 0: 1
1: 0
2: 1
3: 5
4: 117
904163049_904163055 -1 Left 904163049 1:28535376-28535398 CCTCGGTAAGTGGCCTTGGTACC 0: 1
1: 0
2: 0
3: 9
4: 59
Right 904163055 1:28535398-28535420 CTCCAGCAGGGCAAATTGGCAGG 0: 1
1: 0
2: 1
3: 5
4: 117

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904163055 Original CRISPR CTCCAGCAGGGCAAATTGGC AGG Intronic
900077983 1:833581-833603 ACCCAGTGGGGCAAATTGGCCGG + Intergenic
900474964 1:2871849-2871871 CACCAGCCGGGCAGCTTGGCTGG + Intergenic
903185706 1:21627749-21627771 CTCCAGCAGGAGAAATGGCCCGG + Intronic
904163055 1:28535398-28535420 CTCCAGCAGGGCAAATTGGCAGG + Intronic
904211017 1:28887117-28887139 CCCCGGCGGGGCAAAGTGGCAGG + Exonic
907764959 1:57400154-57400176 CTCCAGCAGTTCATATTGGAAGG - Intronic
909293701 1:73916325-73916347 CTCCAGCAGAACAAAATGGTGGG + Intergenic
914448651 1:147771850-147771872 CTGCCGCCGGGCAACTTGGCAGG + Intronic
915618970 1:157067249-157067271 GTCCAGGAGGGCAAGGTGGCTGG - Intergenic
919730443 1:200910493-200910515 CTCCATCAGCTTAAATTGGCTGG + Intronic
920381052 1:205534742-205534764 CTCCACCATGGCCACTTGGCAGG + Intergenic
920390668 1:205598552-205598574 CTCCAGCAGGGCAAAAGAGGAGG - Intronic
921315066 1:213882621-213882643 CTCCAGAAGTGCAAACTGCCAGG - Intergenic
1064780760 10:18835773-18835795 CTCCAGCAGGCCACAGTGTCTGG - Intergenic
1064861292 10:19828894-19828916 TTCCAGCAGGGCAACTTTGGAGG - Intronic
1069302447 10:66925618-66925640 CTCCAAGAGGTCAAATGGGCAGG + Intronic
1071495138 10:86162885-86162907 CTCCAGGAGGGCAGCCTGGCAGG + Intronic
1076608277 10:131703549-131703571 CTCCAGCAAAGCAACTGGGCTGG - Intergenic
1076695135 10:132243759-132243781 CTGCACCAGGGCCATTTGGCAGG + Intronic
1081596698 11:44464191-44464213 ATCCAGCTGAGAAAATTGGCTGG + Intergenic
1085808299 11:79657224-79657246 ATCCATCTGGGCAAATTGGAAGG + Intergenic
1087107347 11:94423619-94423641 TTCCTGCAGGGCAGCTTGGCAGG - Intronic
1087396834 11:97610448-97610470 ACCCTGCAGGGCCAATTGGCTGG - Intergenic
1094548169 12:31424568-31424590 CTCCAGCAGGTCACAAAGGCTGG + Exonic
1097008786 12:55938002-55938024 CTCCAGAAGGGAAAAGTAGCAGG - Exonic
1099175374 12:79415374-79415396 CTCCACCAGGGCAATCTGGTTGG + Intronic
1102576676 12:113860207-113860229 CTCCAGCAGGGAAACCTGACCGG - Intronic
1106449990 13:29872331-29872353 CTGCAGGGGGGCAATTTGGCTGG - Intergenic
1106813872 13:33386462-33386484 CTCCAGGAGGGCACATTGCTGGG + Intergenic
1108357977 13:49644082-49644104 CTCCAGGAGTGCTGATTGGCTGG + Intergenic
1108827020 13:54424591-54424613 CTCCAGCATGGCAAAGTAACAGG + Intergenic
1109809042 13:67485018-67485040 ATCCAGCAGAGCAAATTCCCAGG - Intergenic
1111351573 13:87037425-87037447 CTCCAGCAGAGGAGATTAGCAGG - Intergenic
1114263502 14:21056903-21056925 CTCCAGCAGGGCAAAATGTCAGG + Intronic
1114665000 14:24372476-24372498 CTCCAGCTGCTCATATTGGCTGG - Exonic
1114666369 14:24379530-24379552 TTCCTCCAGGACAAATTGGCTGG - Exonic
1118766946 14:68916309-68916331 CTCCAAGAGGGCAAATCTGCAGG - Intronic
1119909121 14:78333856-78333878 CTGCAGCAGGGCCATTTGGGAGG + Intronic
1121336860 14:93082876-93082898 CTCCAGGAGGGCAAATTCCCCGG + Intronic
1122441832 14:101737297-101737319 CTCCAGCAGAGCCACTTAGCTGG + Intergenic
1122891502 14:104734212-104734234 CTCCTGCAGGGCAGGTGGGCTGG - Intronic
1123002969 14:105306231-105306253 CTCCAGGAGGGGAAGTTTGCAGG - Exonic
1124646187 15:31439103-31439125 CTACAGCTGGGCAAATTGTCTGG - Intergenic
1132587133 16:710488-710510 CTCCCTCAGGGCAGATGGGCTGG + Intronic
1132815196 16:1822493-1822515 CTGGAGCAGGGCAAGCTGGCAGG - Intronic
1134562318 16:15221165-15221187 CTCATGCAGGGCAGATTGGAGGG - Intergenic
1134922859 16:18132792-18132814 CTCATGCAGGGCAGATTGGAGGG - Intergenic
1138419188 16:56888128-56888150 GTCCTGCTGGGCAAAGTGGCTGG + Intronic
1139446663 16:67002501-67002523 ATCCAGGAGGCCAAATGGGCAGG + Intronic
1139911197 16:70398648-70398670 CTGCAGCAGGGGACAGTGGCAGG + Exonic
1140519938 16:75572302-75572324 CTCCAGCAGGGCAGGATGGGTGG - Intronic
1142292483 16:89199439-89199461 CTCCACGGGGGCACATTGGCAGG - Exonic
1143999910 17:11043945-11043967 TTCTAGCAGGGCAATTAGGCAGG + Intergenic
1148889903 17:50799979-50800001 CTCCACCAGGGCCCAGTGGCTGG - Intergenic
1149329856 17:55569631-55569653 CTCCAGCAGGGTAGAGTGCCTGG - Intergenic
1150503228 17:65671267-65671289 CTCCCGAAGGGGAAATTGGGAGG + Intronic
1153608965 18:6862378-6862400 TTCCAGTAGGGCAAGTTGTCGGG - Intronic
1154268015 18:12895800-12895822 CTCCAGGAGGCCAAGTTGGGAGG - Intronic
1155369590 18:25083542-25083564 CTCCAGCTGGGAGAATTGGGTGG - Intronic
1155550233 18:26957043-26957065 GCCCAGCGGGGGAAATTGGCTGG + Intronic
1156858122 18:41806474-41806496 CACCAGCCGGGCAAGATGGCAGG + Intergenic
1157542879 18:48524703-48524725 CTGCACCAGGGCAAACTTGCAGG + Intergenic
1162536304 19:11264570-11264592 CTCCACCTGGCCAAAGTGGCTGG - Intergenic
1168436462 19:56321671-56321693 CTCCAGAAGGACAAACTGGTAGG - Intronic
925479122 2:4250837-4250859 CTCCACCAGAGCAGATGGGCAGG + Intergenic
926228663 2:10986294-10986316 CTCCAGCAGGGCCAGCTGGAAGG + Intergenic
928209589 2:29313599-29313621 CTCCAGCAGGGCAGTGTGACAGG + Intronic
928317686 2:30258642-30258664 CTGCAGCTGGGCAGACTGGCGGG - Exonic
932409893 2:71539476-71539498 CTCCTGCAGAGAATATTGGCTGG + Intronic
934048262 2:88189733-88189755 CTATTGCAGGGCATATTGGCTGG - Intergenic
939852665 2:147319448-147319470 ATCCAGCAGGCCAAAATGGCGGG + Intergenic
940658117 2:156513454-156513476 CTCCAGAAGGACAAACTGGTAGG + Exonic
941721825 2:168820556-168820578 CTTCAGCAGGGCAGATTTGTGGG - Intronic
946917360 2:224538539-224538561 CACCAGCAAGGCAAATGGGAGGG + Intronic
948103853 2:235397104-235397126 CCACAGCAGGGAATATTGGCTGG + Intergenic
948149304 2:235732610-235732632 CCCCAGCAGGGAAAATGGGAAGG - Intronic
949078463 2:242076661-242076683 CTCCAGCACGGCAGATGTGCTGG - Intergenic
1175987104 20:62769657-62769679 CTGCAGCTGGGCAAAAGGGCAGG + Intergenic
1177507042 21:22032874-22032896 CTCCATAAGGCCAAACTGGCTGG + Intergenic
1180354702 22:11829254-11829276 CTGCAGCAGGGCAGAATGCCTGG - Intergenic
1180383550 22:12163078-12163100 CTGCAGCAGGGCAGAATGCCTGG + Intergenic
1184642218 22:45878703-45878725 GCCCAGCAGGGCAGATTGCCTGG + Intergenic
950515286 3:13460924-13460946 CTCCAGCAGGGCACAGTTTCTGG + Intergenic
952820946 3:37485139-37485161 CTCCAGCAGTACACACTGGCAGG - Intronic
960371648 3:116847937-116847959 ATCCAGGTGGCCAAATTGGCAGG + Intronic
962276054 3:134014329-134014351 CTTCAGCAGGGCAAAGAGGCTGG + Intronic
962352612 3:134666686-134666708 CTCCAACAGTGCAGAGTGGCTGG - Intronic
969693971 4:8724610-8724632 CACCAGCAGGGCTAATGGGGAGG + Intergenic
976650901 4:87433566-87433588 CTTAAGAAGGGCAAATTGACTGG + Intronic
982353801 4:154444863-154444885 CTCCAGGAGGGCACTGTGGCTGG - Intronic
983762425 4:171427893-171427915 CTCCACCAGGGTAAAATAGCAGG + Intergenic
985347657 4:189023591-189023613 CTCCAGCAGGCCAAGGTGGGCGG + Intergenic
995860730 5:116637616-116637638 CAGCAGCAAGGCAAAGTGGCTGG + Intergenic
997183487 5:131857886-131857908 CTCATGCAGGCCACATTGGCAGG - Intronic
997964741 5:138348073-138348095 CTCAAGCAGGTCAAAAAGGCTGG - Exonic
999938556 5:156515815-156515837 CACCAGCAGGGGAAAACGGCTGG - Intronic
1002891365 6:1335609-1335631 CTCCAGCAGGGCTGAGCGGCTGG - Intergenic
1003942854 6:11045114-11045136 CTCAAGCATGGGAAGTTGGCGGG + Intergenic
1004110947 6:12718268-12718290 CTGGAGCAGGGAAAATTGCCTGG - Intronic
1005359240 6:25015253-25015275 ATCCAGGAGGGAAAATTGTCTGG + Intronic
1006092208 6:31634818-31634840 CTCCATCAGGGGAACTTCGCTGG - Exonic
1006125798 6:31837167-31837189 CTCCAGAAGGGCCAATGGGAGGG + Intronic
1006391207 6:33759941-33759963 CTTCAGCAGGGCAAGGTGGGGGG - Intergenic
1006929775 6:37680749-37680771 CCCCAGCTGGGCCAAGTGGCAGG - Intronic
1011392462 6:86868631-86868653 CTCAATCAGGCCAAACTGGCTGG + Intergenic
1011794731 6:90939904-90939926 CTCCAGCTAAGCAAGTTGGCAGG + Intergenic
1021642185 7:22748993-22749015 CAACAGCAGGGGAAATTGCCTGG + Intergenic
1025708933 7:63890501-63890523 CTCCAGCATGGCCAATTTGGAGG - Intergenic
1029424065 7:100485785-100485807 CCCCAGCAGGGAAAACTGGGAGG - Intronic
1034532510 7:151705390-151705412 ATCCAGCCGGGAAAGTTGGCTGG + Intronic
1035536725 8:396685-396707 CTCCAGCACGGCACATGTGCTGG - Intergenic
1035785084 8:2253619-2253641 CTCCAGCAGGGGCATTGGGCTGG + Intergenic
1035807727 8:2468097-2468119 CTCCAGCAGGGGCATTGGGCTGG - Intergenic
1047135773 8:122076470-122076492 CTCAAGCAGGACAACTTGGAAGG + Intergenic
1048773535 8:137920591-137920613 CTCCAGGAGGGGAAGTTGTCAGG + Intergenic
1049691605 8:143963413-143963435 ATCCAGCAGGGCAAATTCCGTGG - Intronic
1059874625 9:118620590-118620612 CTCCTGCAGGGCAAAATCACTGG - Intergenic
1061299412 9:129696276-129696298 CTAAAGCAGGGCACCTTGGCTGG + Intronic
1062175057 9:135157118-135157140 CTCCAACAGGGCCATTTGGGAGG - Intergenic
1191055600 X:56236755-56236777 CTCCAGCGAGGCAAAATGGGTGG - Intronic
1193907444 X:87260566-87260588 CACCATCAGGGCAAATAGTCAGG - Intergenic
1195753178 X:108177228-108177250 TTCCAGCATGGCACATTAGCTGG + Intronic
1199979145 X:152911535-152911557 CTAGACCAGGGCAAATTGGAGGG + Intergenic
1200248466 X:154539388-154539410 CTGGAGCAGGGCAGATTGGCTGG + Intronic