ID: 904172576

View in Genome Browser
Species Human (GRCh38)
Location 1:28601827-28601849
Sequence AACACCAAGGGGCCTCCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 155}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904172576_904172582 19 Left 904172576 1:28601827-28601849 CCAGCTGGAGGCCCCTTGGTGTT 0: 1
1: 0
2: 1
3: 9
4: 155
Right 904172582 1:28601869-28601891 TCCTTTATGAGTGTCACCACTGG 0: 1
1: 0
2: 2
3: 6
4: 83
904172576_904172584 26 Left 904172576 1:28601827-28601849 CCAGCTGGAGGCCCCTTGGTGTT 0: 1
1: 0
2: 1
3: 9
4: 155
Right 904172584 1:28601876-28601898 TGAGTGTCACCACTGGCATCAGG 0: 1
1: 0
2: 0
3: 10
4: 174
904172576_904172585 29 Left 904172576 1:28601827-28601849 CCAGCTGGAGGCCCCTTGGTGTT 0: 1
1: 0
2: 1
3: 9
4: 155
Right 904172585 1:28601879-28601901 GTGTCACCACTGGCATCAGGAGG 0: 1
1: 0
2: 0
3: 8
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904172576 Original CRISPR AACACCAAGGGGCCTCCAGC TGG (reversed) Intronic
900130623 1:1085647-1085669 AGCACCAAGGGGCCTTCCTCGGG - Intronic
900459637 1:2796667-2796689 CACAGCAAGGGGGCTCCAGGAGG - Intronic
900956220 1:5887883-5887905 AACCCCAATGGGACTCCAGGAGG + Intronic
901411158 1:9085031-9085053 AACACCAAGGAGAGTCCTGCGGG - Intronic
901878165 1:12178929-12178951 AAGACCAAGGAGCCTGCAGCTGG + Intronic
904172576 1:28601827-28601849 AACACCAAGGGGCCTCCAGCTGG - Intronic
904860272 1:33532703-33532725 AACCCCAAGGGACCTACAGGCGG + Intronic
905395696 1:37665076-37665098 AGAAAGAAGGGGCCTCCAGCAGG - Intergenic
906581069 1:46935485-46935507 AAGAACAAGGGCCCTGCAGCTGG + Intronic
906602655 1:47143409-47143431 AAGAACAAGGGCCCTGCAGCTGG - Intronic
915013466 1:152711785-152711807 AACAGCAAAGGGCCTGCAGTGGG + Intergenic
915255140 1:154622626-154622648 AGGCCCAAGGAGCCTCCAGCTGG - Intronic
915594824 1:156890661-156890683 AAGACCAAGGGCCCATCAGCTGG + Intergenic
918374722 1:183897667-183897689 AAAATGAAGAGGCCTCCAGCAGG - Intronic
920760043 1:208774800-208774822 ACAGCCAAGGGGACTCCAGCAGG + Intergenic
923055593 1:230424535-230424557 AGGCCCAAGGGACCTCCAGCTGG - Intronic
923628886 1:235636585-235636607 ATCTCCATGGGTCCTCCAGCAGG + Intronic
1062879950 10:969986-970008 AGCACCCAGGGACCTCCTGCAGG - Intergenic
1064630803 10:17308841-17308863 AACACCAAGGGAGCTGCAGAGGG + Intergenic
1067568925 10:47357507-47357529 CACACCAAGGGCACTCCTGCAGG + Exonic
1069412090 10:68164202-68164224 AAGATCAAGGGGCCTGCATCTGG + Intronic
1076462072 10:130654598-130654620 AAGACGGAGGCGCCTCCAGCTGG - Intergenic
1076639604 10:131905239-131905261 AAAACCAGGGGGCTTCCAGCAGG + Intronic
1078709932 11:13781356-13781378 ACCACAGAGTGGCCTCCAGCTGG + Intergenic
1081312604 11:41592217-41592239 AACACCAAGAGGAGTTCAGCTGG - Intergenic
1083256021 11:61495997-61496019 AACACAGAGGGGCCTCCCTCTGG + Intergenic
1089732939 11:120530735-120530757 AAAACCAAGGGGCCTGCTACAGG + Intronic
1090991497 11:131821003-131821025 AACACCAAGATGCCTCCAAAGGG + Intronic
1091330791 11:134729538-134729560 AACACACAGGGACCTCCTGCCGG + Intergenic
1091364002 11:135001774-135001796 AAGGGCAAGGGGCCTCCAGAAGG + Intergenic
1091394268 12:143956-143978 AAGAGCAAGGGGCCTCCAGCCGG + Intronic
1094515095 12:31121135-31121157 AATACCCAGGGTCCTCCAGGTGG - Intergenic
1100329243 12:93570029-93570051 AAGGCCAGGGGGCCTCCAACGGG + Intronic
1100386994 12:94112861-94112883 AACGCCAAGAGGAGTCCAGCTGG + Intergenic
1102182308 12:110921806-110921828 GAGACAAAGGGGCCTCCAGAGGG - Intergenic
1102454811 12:113064970-113064992 AACAGCAGGGGTCCTTCAGCAGG + Intronic
1104068448 12:125324969-125324991 TACACCAAGGGGCCCAGAGCAGG - Intronic
1104542731 12:129682451-129682473 AACCCCATGTGGTCTCCAGCAGG + Intronic
1104845728 12:131845877-131845899 AACATCAAAGGGGCTGCAGCTGG + Intronic
1119533484 14:75380241-75380263 AAGATCAAGGGGCCTACATCTGG - Intergenic
1120685348 14:87531025-87531047 AACACCAAGAGGAGTTCAGCTGG + Intergenic
1120713299 14:87815449-87815471 AACACCAAGAGGAGTTCAGCTGG + Intergenic
1124684925 15:31774333-31774355 TGCACCTAGGGGCCTCCTGCCGG + Intronic
1127870614 15:63069764-63069786 AACACAAAGAGACCTCAAGCAGG - Intronic
1128674200 15:69596708-69596730 AACAGCAGGGGGGCTCCAGCTGG - Intergenic
1130171924 15:81523575-81523597 ATCACCAAGGGGAGTTCAGCTGG - Intergenic
1131890849 15:96970010-96970032 AAGAGCAAGGGCCCTGCAGCAGG + Intergenic
1132154329 15:99485180-99485202 AACACAAAAAAGCCTCCAGCAGG + Intergenic
1132565713 16:621674-621696 CACACCAAGGGACCTGCACCTGG - Intronic
1132677409 16:1126485-1126507 AACAGCAAAGGGACTCCAGGTGG - Intergenic
1132731086 16:1362372-1362394 AGCACTACAGGGCCTCCAGCAGG - Intronic
1132973175 16:2698772-2698794 GGCACCAAGGGAGCTCCAGCAGG - Intronic
1133028445 16:2998582-2998604 AAGACGGAGGGGCCTCCATCAGG + Intergenic
1133275857 16:4638087-4638109 AACACAAAGGAGCCTCCGGCAGG - Intronic
1136983686 16:35081549-35081571 AACACCCAGGGACATTCAGCTGG + Intergenic
1140098342 16:71894240-71894262 AAGAAAAAGGGGCCTCCAGAAGG - Intronic
1142600655 17:1052124-1052146 TACCCCAAGAAGCCTCCAGCTGG + Intronic
1144792450 17:17868152-17868174 AAGACAAAGGGGCCTCGGGCTGG + Intronic
1145721234 17:27075031-27075053 AAGACAATGGGGGCTCCAGCAGG + Intergenic
1145815778 17:27793885-27793907 AGCACCCAGGGGCCCGCAGCCGG + Intronic
1147308245 17:39578405-39578427 ACCAAGAGGGGGCCTCCAGCTGG - Intergenic
1147437705 17:40427760-40427782 AAGATCAAGGGGCCTGCATCTGG - Intergenic
1149986568 17:61352220-61352242 AGCACCAAGGGGCTCCCAGGAGG - Intronic
1152660585 17:81540139-81540161 AACAACTAGGTGCCTCCAGCCGG - Exonic
1156578813 18:38351421-38351443 GGCAACAAGGGGCCTCCTGCGGG - Intergenic
1157721957 18:49932042-49932064 AAGAAGAAGGGACCTCCAGCTGG - Intronic
1157731529 18:50008437-50008459 AACTCGAAGGGGGCTCCAGATGG - Intronic
1159010235 18:63052144-63052166 AGCACCAACAGGACTCCAGCAGG - Intergenic
1160492978 18:79353417-79353439 AACACCAACGGCCATCCACCAGG + Intronic
1160873480 19:1287080-1287102 AAAACAAGGGGGCCTGCAGCAGG - Intronic
1160948842 19:1656090-1656112 AACCCCCAGCGCCCTCCAGCAGG + Intergenic
1161005343 19:1932942-1932964 ATCACCCAGGGGCTTCCAGGTGG + Intergenic
1161112920 19:2479624-2479646 AAACCCAAGGGGGCTCCAGGTGG + Intergenic
1166664674 19:44671893-44671915 AATGCCAAGGGGCCACGAGCTGG - Exonic
1167306528 19:48713266-48713288 ATCACCATGGATCCTCCAGCAGG + Exonic
1167366252 19:49056367-49056389 CACCCCAAGTCGCCTCCAGCGGG + Exonic
928101006 2:28437392-28437414 AGCAGCAAGGGGCCCCCAGAGGG - Intergenic
928203588 2:29267898-29267920 AACACAAAGGCCCCTCCATCAGG - Intronic
933199178 2:79429022-79429044 AACAATGAGGTGCCTCCAGCTGG - Intronic
937040517 2:118817139-118817161 AAAAGAGAGGGGCCTCCAGCAGG + Intergenic
939622811 2:144441002-144441024 AACAACAAGTGTCCTCAAGCAGG + Intronic
942255502 2:174093056-174093078 CAGACTAAGTGGCCTCCAGCAGG + Intronic
942420676 2:175804262-175804284 AGCACCACTGAGCCTCCAGCTGG + Intergenic
945251247 2:207768171-207768193 CACACGAACGGGCCCCCAGCGGG + Exonic
946451619 2:219784843-219784865 AACACCAAGAGGAGTTCAGCTGG - Intergenic
1174391125 20:50218975-50218997 AAAACCAAGGTGGCTCTAGCAGG - Intergenic
1174482494 20:50841548-50841570 AAAAGCAAGAGGCCACCAGCGGG + Intronic
1175521109 20:59603589-59603611 CTCACCAAGGGTCCTCCTGCTGG - Intronic
1175545575 20:59775758-59775780 AACACCTGTGAGCCTCCAGCAGG + Intronic
1179437665 21:41373498-41373520 AACTCCAAAGGGCCTCGGGCTGG - Intronic
1179783203 21:43715751-43715773 AACACCAAGAGGAGTTCAGCTGG + Intergenic
1180118308 21:45726391-45726413 AACACCCAGGGGCCTGTGGCTGG + Intronic
1180205388 21:46256297-46256319 CACACCAAGGGGCCTCAAGAGGG + Intronic
1180220381 21:46354755-46354777 GACACCCTGTGGCCTCCAGCAGG - Intronic
1180589426 22:16923795-16923817 AACACTAAGGGGCCTTCATTAGG + Intergenic
1180964043 22:19776455-19776477 AACACCCAGGGGCCTGCACGGGG + Intronic
1181084823 22:20435002-20435024 AACACCTTGGACCCTCCAGCAGG + Intronic
1183458635 22:37936340-37936362 AACCCCAGGGCTCCTCCAGCAGG - Intronic
1184096953 22:42321299-42321321 AACACAAGGGTGGCTCCAGCAGG + Intronic
1184855557 22:47144617-47144639 AACACCGACGCGCCTCCAGGTGG - Intronic
1185331088 22:50252316-50252338 AACACCGAGTGGCCTGCAGAGGG + Intronic
950793569 3:15493039-15493061 AACAACAGGTGGCCACCAGCTGG + Intronic
953665363 3:44922310-44922332 AGAACCAAGGGACCTCCAGATGG - Intronic
956377577 3:68632053-68632075 CACTCCATGGGGCCACCAGCAGG + Intergenic
957025102 3:75172858-75172880 AACACCCAAGGGTCTGCAGCTGG - Intergenic
960142751 3:114166560-114166582 AAGATCAAGAGGCCTCCATCTGG - Intronic
962045593 3:131756632-131756654 AACACCTAAGGGGCTCCAGTTGG + Intronic
964136590 3:153351618-153351640 AACATCAAGAGGAGTCCAGCTGG - Intergenic
964247193 3:154667118-154667140 AACACCAAGAGGAGTTCAGCTGG - Intergenic
966860342 3:184228231-184228253 AACACACAGGGAGCTCCAGCTGG - Intronic
966891470 3:184410333-184410355 AACACCAAGGGGCCTTCCCATGG + Intronic
967761224 3:193228323-193228345 GACACCAAGGGGAGTTCAGCTGG + Intergenic
967972912 3:195012397-195012419 AACACTATGAGGCCTCCATCTGG + Intergenic
968357952 3:198122902-198122924 AACAACCAGGGGCCTCCAGGTGG - Intergenic
969505548 4:7584937-7584959 AACACAAAGGGGGTTGCAGCGGG + Intronic
971420549 4:26470361-26470383 AATACCGAGGGGCCTGCATCTGG + Intergenic
972960458 4:44447474-44447496 ACCCCCGCGGGGCCTCCAGCGGG + Intronic
978795645 4:112705592-112705614 AACAGCCAGGGGCCTCCCGAGGG + Intergenic
980133720 4:128840846-128840868 AATGCCATGGGGCCACCAGCAGG + Intronic
983062305 4:163173779-163173801 AAAACCAAGGCTCCTTCAGCTGG - Intergenic
984964258 4:185127407-185127429 TACACCCAGGCGCCTCCAACTGG - Intergenic
985759960 5:1743647-1743669 ATCACCAAGGGGCCTGCATCAGG + Intergenic
985762892 5:1760761-1760783 AGGACTCAGGGGCCTCCAGCGGG - Intergenic
986413099 5:7501780-7501802 AAGTCCAAGGGGCGTCCACCAGG + Intronic
987271941 5:16318909-16318931 AAGGTCAAGGGGCCTCCATCTGG - Intergenic
988922860 5:35960885-35960907 AACACCAAGAGGAGTTCAGCTGG - Intronic
991128229 5:63091179-63091201 AACACCAACAGACCTGCAGCTGG + Intergenic
992113657 5:73519280-73519302 AATACCAAGGGGCCAGCATCTGG + Intergenic
992180843 5:74196987-74197009 ATACCCAAGGGGGCTCCAGCAGG - Intergenic
995485254 5:112633655-112633677 ACCAGCCAGGGGTCTCCAGCTGG + Intergenic
999390728 5:151187508-151187530 GCCACCAAGGGGCCTGCAGAAGG - Intronic
1000867937 5:166538342-166538364 AACACCGAGGGGAGTTCAGCAGG + Intergenic
1003425736 6:5997186-5997208 GAGACCAAGGGGGCTGCAGCAGG - Intergenic
1004984913 6:21070557-21070579 AACACCAAGAATCCTCAAGCAGG - Intronic
1009268077 6:61580882-61580904 AAGACCAAGAAGCCACCAGCAGG + Intergenic
1010376883 6:75181136-75181158 AAAACCAACTGGTCTCCAGCTGG - Exonic
1012550534 6:100461146-100461168 GCCACCAAGAGGACTCCAGCGGG + Intronic
1013455171 6:110323680-110323702 AACACCAAGAGACCTCCAGGAGG + Intronic
1016873192 6:148838891-148838913 AAAATAAAGGGGCCCCCAGCAGG + Intronic
1019308695 7:348387-348409 AGCAACAAGGGACCCCCAGCAGG - Intergenic
1019710026 7:2513944-2513966 AACAGCAAGGGGCCTCAGCCTGG - Intronic
1020906988 7:14075624-14075646 ACCACAGAGGGGCCTCCACCTGG + Intergenic
1022534264 7:31086035-31086057 TATACCAAGGAGCCTCCTGCAGG + Intronic
1023909715 7:44544955-44544977 AAGACAAAGGGGCCACCGGCAGG - Intergenic
1034968321 7:155404732-155404754 CACACCACGGGCCCCCCAGCGGG + Intergenic
1036286705 8:7449132-7449154 AGGACCAAGGGGTCTCCACCAGG - Intronic
1036334773 8:7862391-7862413 AGGACCAAGGGGTCTCCACCAGG + Intronic
1038009953 8:23467538-23467560 AAGACCAAGGGGCTGGCAGCAGG + Intergenic
1038918589 8:32055796-32055818 ACCACCAAGGGGGCTCTATCTGG - Intronic
1039445714 8:37630340-37630362 AGCTCCAAGCTGCCTCCAGCCGG - Intergenic
1044794906 8:95886740-95886762 CACACTAAGGGGCTTCCAGATGG - Intergenic
1049560289 8:143306917-143306939 AGCACCAAGGGCCCCACAGCAGG + Intronic
1057025344 9:91730961-91730983 AGCACCAGGGGCCCTCCATCTGG + Exonic
1060135601 9:121150379-121150401 TACACCATGGGGGCCCCAGCAGG - Exonic
1061385767 9:130288531-130288553 CTAGCCAAGGGGCCTCCAGCTGG + Intronic
1061432463 9:130539941-130539963 CACACCATGGTGCCGCCAGCTGG + Intergenic
1062156511 9:135051836-135051858 ACAACCAAGGGGACTCCAGGAGG + Intergenic
1062580444 9:137227075-137227097 AACACCAGGGCGCCCCAAGCTGG - Intergenic
1187784135 X:22865650-22865672 AAGATCAAGGGGCCTGCATCTGG - Intergenic
1188772544 X:34171369-34171391 AAGCCCAAGGTGACTCCAGCAGG - Intergenic
1191034420 X:56009059-56009081 AGCACCAAGGGGCAACCAGAGGG + Intergenic
1191943267 X:66502691-66502713 AACACCAAAGGGCCACCTCCTGG - Intergenic
1196271397 X:113716255-113716277 GACACCAAGGGGAATTCAGCCGG + Intergenic
1198913976 X:141646164-141646186 AAGTACAAGGAGCCTCCAGCTGG - Intronic
1200046825 X:153407666-153407688 AACAAAAAGGGGCTTCTAGCCGG - Intergenic
1201955128 Y:19614796-19614818 AACAAAAAGGGGCCTGCAACTGG - Intergenic