ID: 904177976

View in Genome Browser
Species Human (GRCh38)
Location 1:28644767-28644789
Sequence TCCAAACTCATTGTCTTTCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 261}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904177976_904177981 -9 Left 904177976 1:28644767-28644789 CCGGGAAAGACAATGAGTTTGGA 0: 1
1: 0
2: 0
3: 19
4: 261
Right 904177981 1:28644781-28644803 GAGTTTGGAGAGGTAGGCAGGGG 0: 1
1: 3
2: 24
3: 193
4: 752
904177976_904177982 6 Left 904177976 1:28644767-28644789 CCGGGAAAGACAATGAGTTTGGA 0: 1
1: 0
2: 0
3: 19
4: 261
Right 904177982 1:28644796-28644818 GGCAGGGGTTTGTTATAGTCTGG 0: 1
1: 0
2: 0
3: 12
4: 98
904177976_904177984 30 Left 904177976 1:28644767-28644789 CCGGGAAAGACAATGAGTTTGGA 0: 1
1: 0
2: 0
3: 19
4: 261
Right 904177984 1:28644820-28644842 CCTTTTAGCCTAGACTATGATGG 0: 1
1: 0
2: 0
3: 2
4: 71
904177976_904177980 -10 Left 904177976 1:28644767-28644789 CCGGGAAAGACAATGAGTTTGGA 0: 1
1: 0
2: 0
3: 19
4: 261
Right 904177980 1:28644780-28644802 TGAGTTTGGAGAGGTAGGCAGGG 0: 1
1: 6
2: 34
3: 176
4: 812

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904177976 Original CRISPR TCCAAACTCATTGTCTTTCC CGG (reversed) Intergenic
901447748 1:9318507-9318529 TCCAAACTCAGGGTCTTCCTTGG - Intronic
902316390 1:15622763-15622785 TGCAAAATAATTGTCTTTCTTGG + Intronic
904177976 1:28644767-28644789 TCCAAACTCATTGTCTTTCCCGG - Intergenic
905307226 1:37028156-37028178 TCCAACCACCTTCTCTTTCCAGG + Intronic
908941217 1:69436806-69436828 AAAAAACTCATTGTCATTCCAGG + Intergenic
910059931 1:83078322-83078344 TCTGAGCTCATTGTATTTCCAGG - Intergenic
911121713 1:94302952-94302974 GCCAAATTCATTGTCATACCCGG - Intergenic
913152659 1:116060657-116060679 TCCCAACTCATTCTGTTTCCTGG + Intronic
913677510 1:121155349-121155371 TCCAAAGTTATTGTTTTTCATGG - Intergenic
914029343 1:143942978-143943000 TCCAAAGTTATTGTTTTTCATGG - Intergenic
914160106 1:145124972-145124994 TCCAAAGTTATTGTTTTTCATGG + Intergenic
916372418 1:164114039-164114061 CCCAAACTCTGTGTCTTTCCAGG + Intergenic
916488638 1:165281465-165281487 TCCATGCTCAATGTGTTTCCTGG - Intronic
916571105 1:166028519-166028541 CCCCAGCTCATTTTCTTTCCTGG - Intergenic
918499844 1:185182000-185182022 TCCATACTCATTAACTCTCCAGG - Exonic
918509598 1:185296549-185296571 ACCAAACTGATTTGCTTTCCTGG + Exonic
918604549 1:186406595-186406617 TCAAAACTCATTATCTTACTTGG + Intronic
918643356 1:186871700-186871722 TCCTAAGTCTTTGTCTTACCAGG - Intronic
920273920 1:204789843-204789865 TCCCTACTCTTTGTCTTTACAGG - Intergenic
920464815 1:206173863-206173885 TCCAAAGTTATTGTTTTTCATGG - Intergenic
921960252 1:221026634-221026656 TCAAAGCTCATTGTCTTCTCAGG + Intergenic
922903795 1:229158591-229158613 TGCCAACTCCTTGTTTTTCCAGG - Intergenic
924030884 1:239884426-239884448 TCCAAAATCAAGGTGTTTCCAGG - Intronic
924851970 1:247839766-247839788 TTCTATGTCATTGTCTTTCCGGG + Intergenic
1064277425 10:13919096-13919118 TCTAAACTCATTGTAATTACTGG + Intronic
1066103122 10:32135430-32135452 GCCAAACTCATTGCCTTAACTGG - Intergenic
1066540057 10:36436752-36436774 TCCAACCTCTTTGTCATTTCTGG + Intergenic
1068338328 10:55667392-55667414 GCCAAATTCATTGTCATACCAGG + Intergenic
1070093292 10:73310855-73310877 TGCAAACTCCTTGCCTCTCCAGG + Intronic
1072046968 10:91666831-91666853 GCCAAATTCATTGTCATACCAGG + Intergenic
1073770443 10:106729623-106729645 TCCAATCAAAGTGTCTTTCCAGG - Intronic
1073936733 10:108641241-108641263 ACCTACATCATTGTCTTTCCTGG - Intergenic
1075494805 10:122910910-122910932 TCCAAACAAATTGGGTTTCCTGG + Intronic
1075670812 10:124263008-124263030 ATCAAAGTCCTTGTCTTTCCTGG - Intergenic
1076044827 10:127283314-127283336 TCCAACCTCACTGGCTTGCCTGG - Intronic
1081152140 11:39645898-39645920 TGCAAATTAACTGTCTTTCCTGG + Intergenic
1081408372 11:42725166-42725188 TCCAAACCTCTTGTATTTCCTGG + Intergenic
1081690460 11:45074436-45074458 TCCAAACCCATGTTCTTTTCAGG + Intergenic
1083028169 11:59568259-59568281 TCCAAACTCATTCTTGTTCTTGG - Intergenic
1083400249 11:62418552-62418574 TCCAAACCATGTGTCTTTCCTGG + Intronic
1085007637 11:73108308-73108330 TGCAAACTCTTTATCTTACCAGG - Intronic
1087084494 11:94202858-94202880 TCCTAACTGCTTGTCTTTCTTGG - Intergenic
1087385055 11:97460841-97460863 TTAAATCTCATTATCTTTCCTGG + Intergenic
1088024460 11:105161060-105161082 TCCTCACTCATTTTCTCTCCCGG - Intergenic
1088144045 11:106652856-106652878 TCAAAACTCATTGTCTTTGTTGG - Intergenic
1089973215 11:122711013-122711035 TCCTAACCCATTGACTTTGCTGG - Intronic
1090564990 11:127980348-127980370 TCCAAACTCCTTGTCATATCTGG + Intergenic
1093121344 12:15275267-15275289 ACCAAACCCATTGTTTTTACAGG + Intronic
1093271201 12:17064380-17064402 TCCAAACTCAAAGTCTTGCAAGG + Intergenic
1095393062 12:41731696-41731718 TCTAAATTCTTTGACTTTCCAGG - Intergenic
1096426868 12:51511364-51511386 TCCACACTCATTTTGATTCCAGG - Exonic
1097217989 12:57429433-57429455 TTTAAACTTTTTGTCTTTCCCGG + Intronic
1097693535 12:62756160-62756182 GCCAAATTCATTGTCATACCAGG - Intronic
1097898873 12:64853750-64853772 TCCCAACCCCTTGTGTTTCCTGG + Intronic
1098706614 12:73699116-73699138 TCAAAACACATTATCTTTCGTGG - Intergenic
1099090914 12:78306842-78306864 TCCAAACTCATTATAGTTGCAGG - Intergenic
1099700871 12:86079878-86079900 TCTTAACTCACTGTCATTCCAGG + Intronic
1100061817 12:90588359-90588381 TCCAAAATCTTTGTCTTTTTAGG + Intergenic
1101245123 12:102877739-102877761 CCCAAATACATTCTCTTTCCTGG + Intronic
1101421619 12:104555732-104555754 TTAAAATTCATTGTCTTCCCTGG + Intronic
1104522254 12:129486597-129486619 TCCCCACTCATTGTGTGTCCAGG + Intronic
1105299807 13:19122670-19122692 GCCTAACACATAGTCTTTCCTGG + Intergenic
1105418768 13:20234719-20234741 TTCAAACTCATTGTTTTTTCAGG + Intergenic
1106171277 13:27290751-27290773 TCCCAAATCATTGTCTCCCCGGG + Intergenic
1106186054 13:27410957-27410979 TCCCAAGTCTTTGTTTTTCCTGG - Intergenic
1106388099 13:29307712-29307734 GCCAAATTCATTGTCATACCAGG - Intronic
1107194647 13:37635151-37635173 ACCAAACTCATTCTCTCTCAAGG + Intergenic
1107913130 13:45124063-45124085 GCCAAATTCATTGTCTTACCAGG + Intronic
1108176818 13:47800863-47800885 GCCAAACTCATGGTGTTTTCGGG - Intergenic
1108975295 13:56435251-56435273 TCCAATCTCTTTGTCTTTACTGG + Intergenic
1110508121 13:76314196-76314218 TCCAAATACATTTTCATTCCAGG + Intergenic
1111105964 13:83645214-83645236 TCCTAACACATGATCTTTCCTGG + Intergenic
1114789526 14:25641063-25641085 TCCAAACTCACTGTCTGTAGGGG + Intergenic
1115409934 14:33062414-33062436 TGCAAACTCATTGCTTTTCCTGG + Intronic
1118355762 14:65012295-65012317 TATAAACTGTTTGTCTTTCCAGG + Exonic
1118704690 14:68470028-68470050 TACCAATTCATTGTATTTCCAGG - Intronic
1118843220 14:69527921-69527943 GCCACACTCACTGTCATTCCAGG - Exonic
1119142349 14:72278856-72278878 TCCAAAATCAGTGTCTTGCAGGG + Intronic
1120934317 14:89878791-89878813 TCTAAATTCATTTTCTTTCTTGG + Intronic
1124660267 15:31543185-31543207 TCCAAAGTCCCTGTCTTGCCTGG + Intronic
1125802431 15:42462067-42462089 CCCAAACTCATTTTCTTTAGAGG - Intronic
1126275631 15:46876192-46876214 TCAAAATTCAATGTTTTTCCAGG + Intergenic
1127556547 15:60093457-60093479 TGCAGACTCATCATCTTTCCTGG - Intergenic
1128006063 15:64242718-64242740 TCCAAACTCATTCTGAGTCCAGG + Intronic
1128036182 15:64528718-64528740 GCCAAATTCATTGTCATACCAGG + Intronic
1134883302 16:17767105-17767127 TCAAAACTCATTCTTTTCCCTGG - Intergenic
1139119497 16:63998377-63998399 TCCAAACCCACTGTCTTCCTAGG + Intergenic
1141848288 16:86626305-86626327 TCCAAAGTCAGTGACCTTCCTGG + Intergenic
1146641721 17:34546924-34546946 TCCCAAGTCTCTGTCTTTCCAGG + Intergenic
1146839371 17:36139618-36139640 TCCCACCCCATTATCTTTCCAGG - Intergenic
1147471532 17:40666603-40666625 GCCAAACTGATTCTCTTTCTTGG + Intergenic
1149241217 17:54652051-54652073 TCCAAAATCAATGTGTTACCAGG + Intergenic
1149809707 17:59656549-59656571 ACCAAACTGATTAGCTTTCCAGG - Intronic
1150104057 17:62448752-62448774 TGCAAGCCCATTGTGTTTCCGGG + Exonic
1150448940 17:65249531-65249553 TCCATAGTCATTGGCTTACCTGG + Intergenic
1151997630 17:77620242-77620264 TCAAAAACCATTCTCTTTCCTGG + Intergenic
1203172648 17_GL000205v2_random:163306-163328 TCCAAACTTTCTGTCTTCCCAGG + Intergenic
1153960427 18:10135611-10135633 TCCACTCTCCCTGTCTTTCCGGG + Intergenic
1155510833 18:26575193-26575215 TCCAGACACATTGACTTTCACGG + Intronic
1155645384 18:28071182-28071204 GTCAAACTCATTTTCTTTCACGG + Intronic
1157689729 18:49671450-49671472 TGCAAAGTCATTTTTTTTCCTGG + Intergenic
1157784210 18:50467543-50467565 TCCAAACTCATTGGGATTCTTGG + Intergenic
1158421665 18:57300106-57300128 TGCAAACTCCTTGGCATTCCTGG - Intergenic
1159315799 18:66771822-66771844 TCCCACATCCTTGTCTTTCCAGG - Intergenic
1159403224 18:67964266-67964288 GCCCAACCCATTGACTTTCCTGG - Intergenic
1160117401 18:76093581-76093603 TCCCATTTCATTCTCTTTCCTGG - Intergenic
1163868220 19:19793412-19793434 TCCAAATTCATTATATTTGCAGG + Intronic
1163911587 19:20199401-20199423 TCCAAACTCATTACATTTGCAGG - Exonic
1165013987 19:32867567-32867589 TTCAAACTAATGGCCTTTCCAGG - Intronic
1165581680 19:36870685-36870707 TCCAAAGCCATTTTCATTCCTGG + Intronic
1166648717 19:44553542-44553564 TCCAAACCTAACGTCTTTCCTGG - Intergenic
1168542670 19:57226080-57226102 TCCTAAGTCCTTGTCTTTTCTGG + Intergenic
925418144 2:3688036-3688058 GCCAAATTCATTGTCATACCAGG + Intronic
926248731 2:11140869-11140891 CCCAATCTCATTGTCCTTCTCGG - Intronic
927966735 2:27275195-27275217 AGCAAACCCATTGTGTTTCCTGG + Intronic
927972043 2:27311998-27312020 CCCAGACTCACTGTCTTGCCTGG + Intronic
928935640 2:36674644-36674666 TCCAGACTTTTTTTCTTTCCTGG + Intergenic
930487829 2:52030368-52030390 TCCAGACTCTCTTTCTTTCCGGG - Intergenic
931381810 2:61760930-61760952 TCCAATCAGATTCTCTTTCCTGG - Intergenic
932051604 2:68403811-68403833 TCCCAACTCCTTGCATTTCCTGG + Intergenic
932117102 2:69061643-69061665 TCCTCACTCCTTGTCTTTTCTGG - Intronic
932129018 2:69170493-69170515 CCAAAACTCATTGTCTTTTCTGG - Intronic
933523038 2:83398441-83398463 TTCAAACACATTTTATTTCCTGG - Intergenic
933637513 2:84723916-84723938 TGCAAACTCTCTGTCTTCCCTGG - Intronic
934487296 2:94727170-94727192 TCCAATCTCATTCTCCTTCTAGG - Intergenic
936617606 2:114063988-114064010 TCCATACTCAATGTCTTTTGAGG - Intergenic
936751880 2:115652621-115652643 ACTTAAATCATTGTCTTTCCTGG - Intronic
939688262 2:145226319-145226341 TGCAAACTCATGGTCTCTCCAGG + Intergenic
939938495 2:148321216-148321238 TCCAATCTCTTTGGCTTCCCTGG + Intronic
939957669 2:148540208-148540230 TCCCAAGTCAGTGTCTCTCCTGG - Intergenic
942590771 2:177544360-177544382 TGCATATTCATTGCCTTTCCAGG + Intergenic
943229491 2:185229900-185229922 TCCTTACACATTGTCTTTTCAGG - Intergenic
945428793 2:209739930-209739952 TCCAAGCTCCTTTTTTTTCCTGG - Intergenic
945506128 2:210642462-210642484 GCCAATCTCATTGTCTCTGCAGG + Exonic
945851730 2:215016239-215016261 TCCAAACCACTTGTCTTTCTTGG - Intronic
946690773 2:222306804-222306826 TGCAAACTCAGGGTATTTCCGGG + Intergenic
1170747434 20:19113091-19113113 TCCAAACTGATTGGATTTCTTGG - Intergenic
1170754156 20:19183690-19183712 TCCAAATTCATTCTTTTTTCAGG + Intergenic
1170950750 20:20933749-20933771 TCCAAGCTCATCGCCTGTCCAGG - Intergenic
1171513531 20:25707638-25707660 GCCTAACACATGGTCTTTCCTGG + Intergenic
1172650450 20:36498438-36498460 TCCTAACTCTTAGGCTTTCCGGG - Intronic
1173953687 20:47013683-47013705 TCCGACCTCACTGCCTTTCCTGG - Intronic
1176129166 20:63488944-63488966 TCCACACACATGGGCTTTCCCGG + Exonic
1177430619 21:20988232-20988254 CCAAACCTCATTGTCTTTCTTGG - Intergenic
1177519559 21:22201037-22201059 TCCAAACTCTTTCCCTCTCCAGG + Intergenic
1178038117 21:28608195-28608217 TACAAACTGATTGTCTTTCAGGG + Intergenic
1179102441 21:38365986-38366008 TCCAAACTCCTAGTCTTTCTAGG - Intergenic
1179567037 21:42255695-42255717 CCCAAACTCATTGTTTCTCCTGG + Intronic
1183624679 22:38994375-38994397 TCCAACCTCAGTGCGTTTCCGGG - Intergenic
1184834548 22:47013620-47013642 TGGAAACGCATTGCCTTTCCGGG + Intronic
952623926 3:35381097-35381119 TCCCATCTCATTGTCTTAACTGG - Intergenic
952944173 3:38465822-38465844 TTCAAATTTATTGTCTTACCTGG - Intronic
953076125 3:39572101-39572123 TGCACACTCACTGTCTATCCTGG + Intergenic
954525085 3:51262551-51262573 ATCAAACTCATTCTCTGTCCAGG - Intronic
955756856 3:62233533-62233555 TCCGCTCTCATTTTCTTTCCTGG + Intronic
960149302 3:114233793-114233815 ATCAAACTCATTTTCTTTACTGG + Intergenic
960491499 3:118321620-118321642 ATCAAACTCATTCTCTGTCCAGG + Intergenic
961286349 3:125808208-125808230 TCCTAACATATGGTCTTTCCTGG + Intergenic
962787117 3:138778746-138778768 GCCAAATTCATTGTCATACCAGG - Intronic
963318739 3:143789478-143789500 TTCTAAATCATTCTCTTTCCAGG + Intronic
963325784 3:143861450-143861472 TCCTAACTCTATGTGTTTCCTGG + Intergenic
964018577 3:151978534-151978556 TACCAAGTCATTTTCTTTCCTGG + Intergenic
964369912 3:155989402-155989424 TCCAATCCCAATCTCTTTCCAGG - Intergenic
965956328 3:174374877-174374899 TCCAAAATTATTGCTTTTCCAGG - Intergenic
966464332 3:180213040-180213062 GCCAAATTCATTGTCATACCAGG - Intergenic
969434779 4:7182252-7182274 TTAAAACTCACTGTTTTTCCTGG - Intergenic
970379494 4:15492774-15492796 GCCAAATTCATTGTCATACCAGG + Intronic
970764762 4:19534312-19534334 TCAAAACTCAATGCATTTCCAGG + Intergenic
970766665 4:19557645-19557667 TCCAAACTCATTGTGGTTGTTGG + Intergenic
971040594 4:22747708-22747730 TCCCAACTCAGTGTCTGACCAGG + Intergenic
972620340 4:40742086-40742108 TCCCAACACATGGTCTATCCTGG - Intergenic
973735816 4:53870633-53870655 TCCAATCAGATTATCTTTCCTGG + Intronic
976065682 4:81184623-81184645 ATCAAACTCATTTTCTGTCCAGG - Intronic
976085914 4:81406990-81407012 TCCAAACTGATTGTCTCTAGTGG + Intergenic
976587370 4:86813711-86813733 TTCAAAATAATTGTCTTGCCAGG - Intronic
977663000 4:99612537-99612559 TACAGACTCTTAGTCTTTCCAGG - Intronic
978391332 4:108228826-108228848 TCCAATCTAATTATCTTTCTTGG - Intergenic
978847384 4:113289919-113289941 TCCAACCAAAATGTCTTTCCTGG - Intronic
978963404 4:114711857-114711879 TCCACACTCCCTTTCTTTCCTGG + Intergenic
980311449 4:131135764-131135786 TCTCAACTCATTGTCATTCTGGG + Intergenic
980492774 4:133550924-133550946 TCCAATCCCATTGGCTTTGCTGG + Intergenic
980639946 4:135564964-135564986 CCCAAACTAAGTCTCTTTCCAGG + Intergenic
981963271 4:150568246-150568268 TCTGAAGTCTTTGTCTTTCCAGG - Intronic
982125437 4:152180118-152180140 TCCACTCTCATTCTCTTACCGGG - Intergenic
982576286 4:157114303-157114325 TCCTGACTCAGTGTCTTTCCTGG + Intronic
982756154 4:159220977-159220999 TCCAACCTCATTCTTTTCCCTGG - Intronic
987431142 5:17834913-17834935 TCCAAACATATACTCTTTCCTGG - Intergenic
988308496 5:29526708-29526730 TCCAAAATCTTTGTCTTCCATGG - Intergenic
991037479 5:62142551-62142573 TCAAAACCCATTGTCTTTGTGGG - Intergenic
991428558 5:66518344-66518366 TCCAGACAGATTGTCCTTCCTGG + Intergenic
991639973 5:68742485-68742507 TCAAAACTCATTCTCTCTCCTGG - Intergenic
993119268 5:83754599-83754621 ATCAAACTCATTCTCTGTCCAGG - Intergenic
993124653 5:83818794-83818816 ATCAAACTCATTGTCTTTATAGG + Intergenic
993295843 5:86138687-86138709 ACCATATTCAATGTCTTTCCAGG - Intergenic
993309925 5:86316229-86316251 TACAAATTCATTGTATTTCAGGG + Intergenic
994970058 5:106725450-106725472 TCAAAACATATTGTCTTTTCTGG + Intergenic
995079777 5:108036050-108036072 TACAAACTCATTCTTTCTCCTGG - Intronic
996041751 5:118822008-118822030 TCCTAACTCCTGGTCTTGCCAGG + Intergenic
996588304 5:125116354-125116376 TCCAAACTTTTTCTTTTTCCTGG + Intergenic
998279512 5:140792085-140792107 TCCAAAATCAGCGTGTTTCCTGG + Intronic
998346517 5:141468978-141469000 TCCAAAATTATTGTTTTTGCTGG + Intronic
998568826 5:143239201-143239223 TCCACACTCCTTCTCTCTCCTGG - Intergenic
999856692 5:155602515-155602537 TTCAACATTATTGTCTTTCCAGG + Intergenic
999915034 5:156248964-156248986 TCCAAACCCAGTCTCCTTCCAGG - Intronic
1001797462 5:174514234-174514256 GCCAAATTCATTGTCATACCAGG - Intergenic
1002665346 5:180819650-180819672 TCCAGACTCATTTTATTTTCTGG + Intergenic
1002668511 5:180845957-180845979 TCCATACTCACTGTTTTTTCAGG + Intergenic
1005372927 6:25153928-25153950 CTCATACTCATTGTATTTCCAGG - Intergenic
1007060018 6:38930196-38930218 TCTAAACTCATTGACTTTGTTGG + Intronic
1008031061 6:46694584-46694606 TCCAATCTGATTCACTTTCCAGG - Intronic
1010774609 6:79870627-79870649 TCCACACTCATTGGCTTTAGTGG + Intergenic
1010781801 6:79953056-79953078 GCCAAATTCATTGTCATACCAGG + Intergenic
1011071835 6:83393335-83393357 GCCAAATTCATTGTCATACCAGG - Intronic
1012907046 6:105079485-105079507 TACACATTCATTGTCTTTTCTGG - Exonic
1015665046 6:135619216-135619238 GCCAAATTCATTGTCATACCAGG + Intergenic
1017313459 6:153001907-153001929 TCCAAATTCTTTGTCTTGCAAGG + Intronic
1017608625 6:156160231-156160253 TCCAAACTCAGAGTCTGTCTGGG - Intergenic
1019397728 7:831244-831266 TCAAAACTCTTGTTCTTTCCAGG - Intronic
1019830510 7:3323475-3323497 TCCAAACTCATTCACATTGCTGG + Intronic
1020413739 7:7922271-7922293 TACAAAGTGTTTGTCTTTCCAGG + Intronic
1020444317 7:8253520-8253542 TCCAAACCCATTTTCTTTAAGGG - Intronic
1020512267 7:9072556-9072578 TTCAAACTCATACTCTTTGCTGG - Intergenic
1022415443 7:30173058-30173080 TTCAAATTCATTTTCTTGCCAGG + Intergenic
1022560162 7:31339135-31339157 TCCAAACAGATTGTCCTTCGAGG - Exonic
1023638042 7:42232489-42232511 CCCAAATTCATTGTCTGCCCGGG - Intronic
1027540469 7:79457929-79457951 TCCAAACTCCTTATCTTGCTTGG + Intergenic
1028179903 7:87706999-87707021 TCCAAAGATATTGTCTTTCAGGG - Intronic
1029324206 7:99792078-99792100 GCCAAACCCAGTGACTTTCCAGG + Intergenic
1030148054 7:106376365-106376387 ACTAAACCCATTGGCTTTCCTGG - Intergenic
1030609301 7:111671286-111671308 GGCAATCTCATCGTCTTTCCTGG - Intergenic
1031038304 7:116812412-116812434 TCCAAAATATTTGTCTTTTCTGG + Intronic
1032480147 7:132239542-132239564 TCTAAACTCATTGCCTTACTTGG - Intronic
1032635293 7:133700671-133700693 TCCAAATTCATTTACTTTACTGG + Intronic
1035750362 8:1991886-1991908 TCCAAACACCTTGACCTTCCTGG + Intronic
1035869311 8:3119857-3119879 TTGAAACTCATTGTGTTGCCTGG - Intronic
1038383753 8:27121388-27121410 TCCCAACTCTTTGTTTTTTCAGG + Intergenic
1038498174 8:28021886-28021908 CCCAAACCCATTTTGTTTCCAGG + Intergenic
1040454332 8:47581022-47581044 TCCAAAATCATTGATTTTCCAGG + Intronic
1041855676 8:62451533-62451555 TCCAAACTCATGCTCTTTGCTGG + Intronic
1043599165 8:81917760-81917782 GCCAAACTCATTGCCTTAACTGG + Intergenic
1044811544 8:96068780-96068802 GCCAAATTCATTGTCATACCAGG + Intergenic
1045117572 8:99000467-99000489 TCCAAAAGCCATGTCTTTCCAGG - Intergenic
1045363132 8:101451081-101451103 TCCAAACACATTTGCTCTCCTGG - Intergenic
1045735216 8:105288131-105288153 TCCAACCTCATTGTTTGGCCTGG + Intronic
1046000355 8:108413554-108413576 CCCAAACTAATTGTCTGTGCTGG - Intronic
1046472781 8:114700354-114700376 TCTAAATTCATTGACTTTGCTGG + Intergenic
1046648769 8:116814094-116814116 TCCAATCTCTATGTCTTTACCGG - Intronic
1048411249 8:134175836-134175858 TCCACACTCACTGTCTGTTCTGG + Intergenic
1048556981 8:135488431-135488453 TGCAAACTTTTTGTCTCTCCAGG - Intronic
1050408304 9:5333487-5333509 TCAGAACTCATTGTCTATTCAGG - Intergenic
1050414734 9:5404093-5404115 TCAGAACTCATTGTCTATTCAGG - Intronic
1050616784 9:7409466-7409488 TCCAAACTCATATTCTTACAAGG - Intergenic
1050837943 9:10107803-10107825 ATTAAACTCATTGTCCTTCCTGG + Intronic
1052031860 9:23637984-23638006 TCCAGTCTCCTTATCTTTCCAGG + Intergenic
1052317649 9:27132499-27132521 TCCAGAGACAGTGTCTTTCCTGG + Intronic
1052804182 9:32998103-32998125 ACTGAACTCAGTGTCTTTCCTGG - Intronic
1053425365 9:38006638-38006660 CCCTAACTCCTTGTCTTTCCTGG - Intronic
1053670512 9:40357260-40357282 TCCAATCTCATTCTCCTTCTAGG + Intergenic
1053920297 9:42983525-42983547 TCCAATCTCATTCTCCTTCTAGG + Intergenic
1054381628 9:64497244-64497266 TCCAATCTCATTCTCCTTCTAGG + Intergenic
1054514101 9:66019040-66019062 TCCAATCTCATTCTCCTTCTAGG - Intergenic
1055771456 9:79721223-79721245 TTCACACTGAGTGTCTTTCCAGG + Intronic
1057612693 9:96560535-96560557 TCCATACTCTTTTTCTTTCTTGG + Intronic
1059323534 9:113487682-113487704 TGCAAACTCATTGACGTTGCTGG + Intronic
1203433467 Un_GL000195v1:115374-115396 TCCAAACTTTCTGTCTTCCCAGG - Intergenic
1187556691 X:20358601-20358623 TCAAACCTCACTGACTTTCCTGG - Intergenic
1189099197 X:38171699-38171721 TCTAACCTCAGTGTCTATCCTGG - Intronic
1189276089 X:39787183-39787205 GCCAAATTCATTGTCATACCAGG + Intergenic
1189428094 X:40920494-40920516 TCCATACTCATTGTAATTTCAGG + Intergenic
1189811230 X:44782338-44782360 TTTAAAATCATTGTATTTCCTGG - Intergenic
1189973364 X:46439757-46439779 GCCAAATTCATTGTCATACCAGG + Intergenic
1191868834 X:65728246-65728268 TCCAAACTCAATGGCTTTAGGGG + Intronic
1192368680 X:70496069-70496091 TCCAACCTCATTTTCCTTTCTGG + Intronic
1192425693 X:71074015-71074037 TTCAACATTATTGTCTTTCCAGG - Intergenic
1192601336 X:72467593-72467615 TCCAAACTCATTAGCCTGCCGGG - Intronic
1192706434 X:73531777-73531799 GCCAAACTCATTGCCTTAACTGG + Intergenic
1194122941 X:89981747-89981769 TCCAATCCCATTGTCTTTTCAGG + Intergenic
1196529102 X:116762242-116762264 TCCACTCTCATTCTCTCTCCAGG - Intergenic
1197114311 X:122814636-122814658 TGCAATCTCATTGTTTTTCTTGG - Intergenic
1198802351 X:140460630-140460652 TCCAACCTCATTGCCATTACTGG + Intergenic
1200475801 Y:3639185-3639207 TCCAATCCCATTGTCTTTTCAGG + Intergenic