ID: 904181297

View in Genome Browser
Species Human (GRCh38)
Location 1:28668699-28668721
Sequence GGCCGCCGCCGCCGGAGAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 379
Summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 342}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904181297_904181305 9 Left 904181297 1:28668699-28668721 CCAGCTCTCCGGCGGCGGCGGCC 0: 1
1: 0
2: 2
3: 34
4: 342
Right 904181305 1:28668731-28668753 GAAGCCCGGCCTGGCGGCGGCGG 0: 1
1: 0
2: 2
3: 27
4: 318
904181297_904181302 0 Left 904181297 1:28668699-28668721 CCAGCTCTCCGGCGGCGGCGGCC 0: 1
1: 0
2: 2
3: 34
4: 342
Right 904181302 1:28668722-28668744 GGAAGTGTTGAAGCCCGGCCTGG 0: 1
1: 0
2: 0
3: 13
4: 164
904181297_904181300 -5 Left 904181297 1:28668699-28668721 CCAGCTCTCCGGCGGCGGCGGCC 0: 1
1: 0
2: 2
3: 34
4: 342
Right 904181300 1:28668717-28668739 CGGCCGGAAGTGTTGAAGCCCGG 0: 1
1: 0
2: 0
3: 1
4: 66
904181297_904181304 6 Left 904181297 1:28668699-28668721 CCAGCTCTCCGGCGGCGGCGGCC 0: 1
1: 0
2: 2
3: 34
4: 342
Right 904181304 1:28668728-28668750 GTTGAAGCCCGGCCTGGCGGCGG 0: 1
1: 0
2: 0
3: 8
4: 135
904181297_904181306 12 Left 904181297 1:28668699-28668721 CCAGCTCTCCGGCGGCGGCGGCC 0: 1
1: 0
2: 2
3: 34
4: 342
Right 904181306 1:28668734-28668756 GCCCGGCCTGGCGGCGGCGGTGG 0: 1
1: 5
2: 36
3: 156
4: 966
904181297_904181312 30 Left 904181297 1:28668699-28668721 CCAGCTCTCCGGCGGCGGCGGCC 0: 1
1: 0
2: 2
3: 34
4: 342
Right 904181312 1:28668752-28668774 GGTGGCGGTAGCTGCCGTGGCGG 0: 1
1: 0
2: 2
3: 32
4: 391
904181297_904181311 27 Left 904181297 1:28668699-28668721 CCAGCTCTCCGGCGGCGGCGGCC 0: 1
1: 0
2: 2
3: 34
4: 342
Right 904181311 1:28668749-28668771 GGCGGTGGCGGTAGCTGCCGTGG 0: 1
1: 0
2: 7
3: 86
4: 664
904181297_904181309 15 Left 904181297 1:28668699-28668721 CCAGCTCTCCGGCGGCGGCGGCC 0: 1
1: 0
2: 2
3: 34
4: 342
Right 904181309 1:28668737-28668759 CGGCCTGGCGGCGGCGGTGGCGG 0: 1
1: 2
2: 19
3: 171
4: 1026
904181297_904181303 3 Left 904181297 1:28668699-28668721 CCAGCTCTCCGGCGGCGGCGGCC 0: 1
1: 0
2: 2
3: 34
4: 342
Right 904181303 1:28668725-28668747 AGTGTTGAAGCCCGGCCTGGCGG 0: 1
1: 0
2: 2
3: 39
4: 328

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904181297 Original CRISPR GGCCGCCGCCGCCGGAGAGC TGG (reversed) Intergenic
900091919 1:924387-924409 TGCTGCCGCCGGCGGAGAGCGGG + Intergenic
900412614 1:2519767-2519789 GGCCTCTGCCGCCAGAGAGCAGG - Intronic
901086689 1:6615069-6615091 GGCGGCTGCCGCGGGAGGGCGGG + Intronic
901110020 1:6786088-6786110 GGCCCTGCCCGCCGGAGAGCAGG - Intronic
901489453 1:9589174-9589196 CGCCGCCGCCCCCCGAGACCGGG + Intronic
901922902 1:12548887-12548909 AGCCGCCGCCACCTGAGAGTGGG + Intergenic
903078135 1:20787396-20787418 GGCGGACGCCGGCGGAGCGCGGG + Intergenic
903829123 1:26164416-26164438 CGCCGCCGCCGCCTGCGAGGGGG + Intergenic
903923394 1:26817331-26817353 AGCCGCCGCCGCCCGACCGCCGG + Intergenic
904004911 1:27358558-27358580 GGCCTCGGCCGACAGAGAGCTGG + Exonic
904181297 1:28668699-28668721 GGCCGCCGCCGCCGGAGAGCTGG - Intergenic
904642013 1:31938139-31938161 CGCCGCCGCCGCCGCCGGGCCGG - Exonic
904794794 1:33051201-33051223 AGCCGCCGCCGCCCGACCGCCGG + Intronic
905284187 1:36868514-36868536 AGCCGCCTCCCCCAGAGAGCTGG - Intronic
905867135 1:41382459-41382481 TGCCGCCGCCGCCGGGCCGCTGG + Exonic
906295293 1:44645734-44645756 GGCCGCCGCAGCAGGCGGGCAGG - Intronic
906411697 1:45584170-45584192 TGCCGCCGTCGCCGCGGAGCTGG + Exonic
906436898 1:45803927-45803949 AGCCGCCGCCGCCCGACCGCCGG + Exonic
906486624 1:46240362-46240384 AGCCGCCGCCGCCCGACCGCCGG + Intergenic
906637015 1:47416490-47416512 GGCCGCCGCCGCCGCCGCCCCGG - Exonic
906650360 1:47508456-47508478 GGCCGCCGCGGCCGCAGGCCCGG + Intergenic
907053509 1:51345080-51345102 GGCCGCCGCCGCCGCCGCGAGGG - Exonic
909392916 1:75136389-75136411 GGCGGCCGCCACCCGAGCGCTGG - Intronic
910448995 1:87328536-87328558 CGCCGCCGCCGCCTCCGAGCCGG + Exonic
910787997 1:91021660-91021682 GGCGGCCGCCGCCGCGGGGCGGG - Intronic
912381453 1:109250034-109250056 AGCCGCCGCCGCCGTTGACCCGG + Exonic
912386325 1:109272945-109272967 GGCCGCCTTCCCTGGAGAGCAGG + Exonic
912391736 1:109307502-109307524 GCCCGCTGCCCCCGGGGAGCGGG - Intergenic
914125463 1:144813786-144813808 GGCGGCCGGCGGCGGAGAGGCGG - Intergenic
914192791 1:145425660-145425682 GGCCGCCTCTGCCGCACAGCGGG + Intergenic
914197352 1:145454453-145454475 GGGCCCCGGCGGCGGAGAGCGGG - Intergenic
914311721 1:146472509-146472531 GGCCGCCTCTGCCGCACAGCGGG - Intergenic
920333307 1:205227909-205227931 GGCTGCCTCCGCCCGGGAGCGGG - Intergenic
921472669 1:215567561-215567583 GGCGGCGGCGGCCGGAGGGCGGG - Exonic
922748268 1:228059330-228059352 GGCCGCGGCCGCAGCACAGCAGG - Exonic
923141387 1:231163373-231163395 AGCCGCCGCAGCCGAGGAGCCGG - Exonic
924561076 1:245156548-245156570 CGCCGCCGCTGCCGGAGCCCGGG - Exonic
1063664716 10:8054460-8054482 GGCGGCCGCCGGCGGAGGGGCGG - Intronic
1064048750 10:12042618-12042640 GCTCGCCGACCCCGGAGAGCTGG + Intronic
1064140650 10:12787515-12787537 GGCCACAGCCACCGCAGAGCAGG - Intronic
1064208971 10:13347776-13347798 CGCCGCCGCCGCCGCCGCGCGGG - Intronic
1066464807 10:35641993-35642015 CGCCGCCGCCGCCGGAGTTGGGG + Exonic
1069818276 10:71212417-71212439 GGGCGCGGCCGCGGCAGAGCTGG - Intergenic
1070179437 10:73999262-73999284 TGCCGCCCCTGCCGGAGAGAAGG + Intronic
1070800780 10:79243342-79243364 CGCCGCCGCCGCCGCCGAGGAGG - Intronic
1070918677 10:80170771-80170793 GGCTGCCTCAGCAGGAGAGCTGG + Intronic
1071545019 10:86522173-86522195 GGAGGCCGCCGCCCGGGAGCTGG + Intergenic
1071784087 10:88880162-88880184 CGCCGCCGCCGCCACAGAGGAGG + Exonic
1071835736 10:89415236-89415258 GGCCGCCGCCTCCGGGAAACTGG + Intronic
1072757697 10:98031313-98031335 GGCCCCCGCAGGCGGGGAGCGGG + Intergenic
1072891540 10:99329495-99329517 GGCCGCCGCCGCCTGGCTGCTGG + Exonic
1072950152 10:99840240-99840262 AGCCGCCGCCGCCCGACCGCCGG - Intronic
1073063519 10:100745667-100745689 CGCCGCCGCGGCCGAAGGGCCGG - Intronic
1073297631 10:102450746-102450768 GGGCGCCGTGGCCGGAGGGCGGG - Exonic
1074169718 10:110919950-110919972 CGCCGCCGCCGCCGCAGGCCCGG - Intronic
1076116949 10:127907395-127907417 GGCCGCTGCCGCGGGAGGGAGGG + Intronic
1076908120 10:133373294-133373316 GGCCGCGGACGCAGGACAGCAGG + Exonic
1077385534 11:2267878-2267900 GCTCCCCGCAGCCGGAGAGCTGG - Intergenic
1077492760 11:2869797-2869819 GGCTGCTGCAGCCGCAGAGCCGG - Intergenic
1081492584 11:43579622-43579644 GCCCGCCGCCGCCGCGGCGCGGG - Intronic
1082029515 11:47594303-47594325 GTCCGCTGCCGCCTCAGAGCCGG - Exonic
1083595546 11:63916959-63916981 CGCCGCCGCCGCCGGTGCCCCGG - Intergenic
1083965738 11:66042677-66042699 GGCCGGCGCCGCCGCCGGGCAGG + Exonic
1084546846 11:69818946-69818968 AGCCGCCGCCGCCGCGGGGCGGG - Exonic
1089543664 11:119206281-119206303 CGCCGCCGCCGCCGGCTATCCGG - Exonic
1089554896 11:119310875-119310897 AGCTGCCGGAGCCGGAGAGCCGG - Exonic
1090375135 11:126283058-126283080 GGGCGGCGCTTCCGGAGAGCGGG + Intronic
1090616769 11:128522270-128522292 GGCAGCCGCCGGCGGAGAGGAGG - Intronic
1090635802 11:128689862-128689884 GGCCGCGGCGGCGGGAGGGCCGG - Intronic
1091762471 12:3096109-3096131 AGCCGCCGCCGCCCGACCGCCGG - Intronic
1092502650 12:9064542-9064564 GCCCGCCGCCGCCGCGGAGTGGG + Intergenic
1093464893 12:19439582-19439604 CGCCGACGCCGCTGCAGAGCAGG - Intronic
1094199229 12:27780135-27780157 GGCCGCCGCCTCGCGGGAGCGGG + Exonic
1094466036 12:30754767-30754789 GGCCGCCGCTGCCGCAGCCCGGG + Intronic
1094564937 12:31590853-31590875 GGCCGCCGCCGCCGCCGCCCGGG + Exonic
1095439317 12:42227060-42227082 AGCCGCCGCCGCCCGACCGCCGG + Intronic
1095958426 12:47819445-47819467 GGCCCCGGCCGCCGGTGTGCGGG - Intronic
1096022511 12:48333878-48333900 AGCCGCCGCCGCCCGACCGCCGG - Intergenic
1096134591 12:49188801-49188823 CCCCGCCGCCGCCGCAGTGCGGG - Intronic
1096396507 12:51270218-51270240 GGGCGGGGGCGCCGGAGAGCCGG - Intronic
1096482476 12:51951791-51951813 ACCCGCCGCTGCCGGCGAGCAGG - Exonic
1096495423 12:52037071-52037093 GGCCGCCGCCGCCGGGATTCCGG + Intronic
1098426086 12:70366615-70366637 CGCCGCCGCCGCGCGACAGCAGG - Exonic
1100260660 12:92929342-92929364 GCCCGCGGCCGCCGGGGGGCGGG + Intergenic
1101493960 12:105236161-105236183 GGCCGCCGCCGCCTGCCCGCCGG + Intronic
1101647473 12:106644841-106644863 GGCCACTGCCGCTGGAGAGAGGG - Intronic
1101935355 12:109052613-109052635 CGCCGCCGCCGCCGGACCGAGGG - Exonic
1101970454 12:109309138-109309160 GGCCGCCGCTGCCGGCGCTCCGG + Exonic
1102122081 12:110449803-110449825 GGCCGCCGCTGCCGGGAAGTGGG + Intronic
1102518474 12:113465296-113465318 GGCCGCGGCCCGCGGCGAGCCGG + Intronic
1102519842 12:113471502-113471524 GGCCGAAGCCGCCGGGGCGCGGG - Exonic
1103563597 12:121804674-121804696 GGCCGCCGCCGCCGCCGCGGCGG + Intronic
1103649638 12:122422634-122422656 CGCCGCCGCCGCCGCGGGGCCGG + Intergenic
1105356134 13:19661724-19661746 GCTTGCCGCCGCCGGAGGGCAGG + Exonic
1105409596 13:20160890-20160912 GGTCGCCGCCGCGGCAGAGCGGG - Exonic
1107467571 13:40664895-40664917 GGCCACCGCCTGCGGAGCGCCGG - Intronic
1107481513 13:40789588-40789610 GGCCGCCCCAGCCGGCGACCCGG + Exonic
1107604014 13:42040754-42040776 GGCCGCCGCCGCCGCCGCCCCGG - Intronic
1107624841 13:42272044-42272066 CGCCGCCGCCGCCGCAGCTCCGG - Intergenic
1108688942 13:52845886-52845908 GGTCGCCGCGGCCGAAGTGCCGG - Exonic
1108688979 13:52846010-52846032 GGCGGCCTCCTCCGGGGAGCCGG + Exonic
1110119770 13:71866572-71866594 CGCCGCCGCCGCCGAAGCGATGG + Exonic
1112216315 13:97434311-97434333 CGCCGCCGCCGCCGGCGCCCAGG + Exonic
1112402211 13:99086742-99086764 GGCCGCCGCGGCGGGACGGCGGG + Intergenic
1112652640 13:101416099-101416121 GGGCGCCTCCACCCGAGAGCGGG - Intronic
1113656040 13:112068236-112068258 CGCCGCCGCCGCCACCGAGCCGG - Exonic
1113737879 13:112690692-112690714 GGCGGCCGCGGCCAGGGAGCAGG - Intronic
1117545901 14:56794723-56794745 GGCCGCCGCCCCCCGGAAGCGGG - Intergenic
1117875930 14:60249724-60249746 GCCCGCCGCCGCCGCCGCGCAGG - Intronic
1122543357 14:102509680-102509702 AGCCGCCGCGGCCGGATCGCAGG + Exonic
1122620966 14:103057479-103057501 CGCCGCCGCCGCCGCAGACTAGG + Intergenic
1122964050 14:105112810-105112832 AGCCGCCGCCGCCCGACCGCCGG - Intergenic
1124109482 15:26773046-26773068 CGCCGCCGCCGCCGCCGCGCTGG + Exonic
1127293732 15:57592061-57592083 TGGCGGCGCCGCCCGAGAGCAGG - Exonic
1128743960 15:70100826-70100848 CGCCGCCTCCTCCGCAGAGCCGG + Intergenic
1129333220 15:74838320-74838342 GGAGGCCGCCGGCGGGGAGCAGG - Exonic
1129539407 15:76338480-76338502 GGCCGCGGGCGCCGGGAAGCGGG - Exonic
1131061573 15:89407790-89407812 GCCCGCGGCCGCCGTGGAGCTGG - Intergenic
1131693879 15:94855567-94855589 CGCCGCCGCCGCCTCAGCGCTGG - Intergenic
1131827011 15:96330395-96330417 CGCCGCCGCCGCCGCCGAGAGGG - Intronic
1132897870 16:2237463-2237485 GGCCCCCGGCACCGGTGAGCGGG + Exonic
1135517682 16:23149220-23149242 GGCCGCCGGCGGCGGCGAGCGGG - Exonic
1135994360 16:27237238-27237260 GGCCTCGGCGGCTGGAGAGCAGG + Intronic
1136546470 16:30957796-30957818 GGCCGCATCCCCCGGAGAGTCGG - Exonic
1137728603 16:50673600-50673622 GGCCTTCGCGGCCGGAGAGAGGG - Exonic
1138104995 16:54283115-54283137 GGGCGCCGCAGCAGGAGAGGTGG - Intergenic
1138360746 16:56425436-56425458 TGCCGCCGCCGCCGCCGCGCCGG + Exonic
1139459427 16:67110033-67110055 TGCCGCTGCCGCCGGGGAGGAGG + Exonic
1140223270 16:73058763-73058785 GGCGGCCGCAGCCGGGGAGCCGG + Intronic
1141352592 16:83311957-83311979 TGCCGCAGCCTCCCGAGAGCTGG - Intronic
1141582724 16:85011324-85011346 CGCCGCCGCCGCCGCAGGCCGGG - Exonic
1141633901 16:85303717-85303739 GGCCGCCGCCTCCCGAGTTCTGG + Intergenic
1141693968 16:85611451-85611473 GGGGGGCGCCGCCGGTGAGCTGG + Intronic
1141838048 16:86555508-86555530 GGCCGCCTCCTCCGGAAAGCCGG + Intergenic
1142155711 16:88532098-88532120 GGCGGCTGCGGCCGGGGAGCCGG - Exonic
1142708453 17:1710442-1710464 GGCCGCCGCCCCCGGAGCCTTGG + Intergenic
1142764668 17:2058487-2058509 GGCCGGCGCGGCCGGGGCGCTGG + Exonic
1143590665 17:7884683-7884705 GGACGCCGCCGCCGAGGAGGAGG + Intronic
1143742599 17:8965470-8965492 AGCCGCCGCAGCCCGAGGGCTGG - Intronic
1144339730 17:14301589-14301611 CGCCCCCGCCGCCGGTGAGGAGG + Exonic
1144734416 17:17546993-17547015 GGCCTGCGCCCCCGAAGAGCTGG + Intronic
1145012587 17:19378321-19378343 GGCGGCTCCCGCCGGCGAGCTGG + Intronic
1145205639 17:20983901-20983923 AGCCGCCGCCGCCCGACCGCCGG + Intergenic
1146132628 17:30291949-30291971 CGCCGCCGCCGCCGCCGAGCCGG - Exonic
1146398636 17:32487249-32487271 GGCCGCCTCCGTCGGCGACCGGG + Intronic
1147150391 17:38510665-38510687 GGCCGCTGTCGCCCGAGACCCGG + Exonic
1147183649 17:38702356-38702378 GGCCGCCGCCGGAGCCGAGCGGG - Intergenic
1147900224 17:43778861-43778883 AGCCGCTGCCGTCCGAGAGCAGG + Exonic
1147963156 17:44179903-44179925 AGCCGCCGCCGCCCGACCGCCGG + Intergenic
1148084833 17:44987829-44987851 CGCCGCCGCCGCCGTAGATGGGG + Intergenic
1148122612 17:45221854-45221876 GGCCGCCGGGGCCAGAGGGCTGG - Exonic
1148556595 17:48582224-48582246 CGCCGCCGCCGCCGGTGCGCAGG - Intronic
1148698631 17:49575659-49575681 CGCCGCCGCCGCCGGTGGGAGGG + Intergenic
1148826461 17:50397620-50397642 CGTCGCCGCCGCCGGAGGGGTGG + Intergenic
1148945758 17:51260493-51260515 GGCCGCCGCCGCCGAAGCCCCGG - Intergenic
1149658908 17:58324443-58324465 TCCCGCCGCCGCCGTAGAGCGGG - Intronic
1149908699 17:60550735-60550757 AGCCGCCGCCGCCCGACCGCCGG + Intergenic
1150003657 17:61456655-61456677 CGCCGCCGCCGCCGCGGAGCAGG + Exonic
1150790909 17:68199568-68199590 GCCCGCCGCGGGAGGAGAGCGGG + Intergenic
1152111688 17:78360449-78360471 GGGCGCCGCTTCGGGAGAGCGGG + Intergenic
1152299256 17:79485727-79485749 GGCCGCCGAGTCCGGAGGGCAGG + Intronic
1152714323 17:81891289-81891311 GGCCGGCCGCGCCGGAGAGTGGG - Intronic
1152870722 17:82751789-82751811 GGCCGCCGCCGGAGGACAGCGGG - Intergenic
1157476964 18:48029628-48029650 GGCCGCCGGGCCCGAAGAGCAGG + Exonic
1158695217 18:59697433-59697455 GGCAGGGGGCGCCGGAGAGCAGG + Intergenic
1158964484 18:62611212-62611234 GGCCGCCGCTGCCTTAGTGCAGG + Intergenic
1159511325 18:69401052-69401074 GGCCGCCGCGGACGGGGAACGGG - Exonic
1160763817 19:798246-798268 GGCTGCCCCGGCCCGAGAGCCGG - Intronic
1160804156 19:984443-984465 GGCCGCCGCGGTAGGTGAGCAGG - Exonic
1160862161 19:1242022-1242044 GGCCGCCGCCCCCGGAGTCCAGG + Intronic
1160865515 19:1254298-1254320 GGCCGCCGCCGCTGCTGCGCGGG + Exonic
1160873168 19:1286079-1286101 CGCCGCCGCCGCCGCCGAGCGGG - Intergenic
1160957590 19:1700554-1700576 GGCCCCCGCCGCCGGCCCGCAGG + Intergenic
1160967693 19:1753818-1753840 CGCCGCCGCCGCCGTCCAGCAGG - Exonic
1161031893 19:2061441-2061463 CGCGGCCGCCGCCGGGGAGGGGG - Intergenic
1161222037 19:3122317-3122339 GAGCGCCGCCCCCGGGGAGCGGG + Exonic
1161397999 19:4054803-4054825 GGGCGCCGACGCCGGGCAGCTGG - Exonic
1161461903 19:4402721-4402743 CGCCTCCGCCGCCTGAGAGGAGG + Exonic
1161703248 19:5805944-5805966 CGCCGCCGCCGCCGGGGACACGG + Intergenic
1161802684 19:6424645-6424667 GGCCGCCGCCGCCCGCCGGCGGG - Exonic
1162341908 19:10096377-10096399 GGCCGCCAACGCCAGCGAGCTGG - Exonic
1163282463 19:16325815-16325837 GGCCGCCGCCGCGGCAGCCCTGG + Exonic
1164653368 19:29901816-29901838 AGCCGCCGCCGCCCGACCGCCGG - Intergenic
1165058785 19:33194928-33194950 GGATGCCGCGGCCGGAGAGGAGG - Intronic
1166092609 19:40519968-40519990 GGCCGCCGACGGCGCAGAGCTGG + Exonic
1166261409 19:41644131-41644153 AGCCGCCGCCGCCCGACCGCCGG + Intronic
1166543287 19:43619578-43619600 TGCAGCCGCCGCCGCAGAGCCGG - Exonic
1166984142 19:46649575-46649597 AGGCGCCGCCGCCGGGGGGCGGG - Exonic
1167157123 19:47745653-47745675 CGCCGCCGCCGCCTCAGCGCTGG - Exonic
1167220399 19:48195369-48195391 GGCCGACGCGGCCGGGGAGGCGG + Exonic
1167233065 19:48297452-48297474 GGCCGCCGCCGCCGCGAAGCTGG - Exonic
1168293852 19:55369593-55369615 GGCCGCGGGAGCGGGAGAGCTGG + Intronic
1168401682 19:56088984-56089006 GGCGGCCGCGGCCGGGGAGGCGG + Exonic
1168614484 19:57826766-57826788 GGCCGCCGCCATGGGAGTGCAGG - Intronic
1202693080 1_KI270712v1_random:105002-105024 GGCGGCCGGCGGCGGAGAGGCGG + Intergenic
1202693233 1_KI270712v1_random:105573-105595 GGCGGCCGGCGTCGGAGAGGCGG + Intergenic
926189955 2:10721284-10721306 GGCGGCCGCAGCGGGAGGGCGGG + Intergenic
926801807 2:16665840-16665862 GGCCGCCGCAGCCTGCGAGACGG + Intronic
927866590 2:26591826-26591848 GGCAGCCTCCGGCTGAGAGCCGG + Intronic
928511771 2:32010089-32010111 GCCCGCCGCCGCCGCGGGGCCGG + Intronic
931253503 2:60552413-60552435 CGCCGCCGCCGCCGAAGGGCAGG - Intronic
932220821 2:69997627-69997649 GGCGGCCCCTGCCAGAGAGCAGG - Intergenic
932231343 2:70086880-70086902 ACCGGCCGCCGCCGGGGAGCAGG + Intergenic
932336674 2:70935704-70935726 GGCCCCCGTCACCTGAGAGCTGG - Intergenic
932567688 2:72919982-72920004 GGCCGCCGCGGCCGAGGGGCTGG + Intronic
932599189 2:73112453-73112475 CTCCGCCGCCGCCTGCGAGCTGG - Exonic
933684709 2:85133690-85133712 CGCCGCCCCCGCCGCCGAGCTGG - Exonic
934031903 2:88055744-88055766 CGCCGCCTCCGCCGCCGAGCAGG + Intergenic
934098199 2:88627019-88627041 GCCGGCAGCCGCGGGAGAGCAGG - Exonic
935592778 2:104856383-104856405 CGCCGCCGCCGCCGTGGTGCGGG - Exonic
936122758 2:109760663-109760685 CGCCGCCGCCGCCGAAGCTCGGG - Intergenic
936221935 2:110610810-110610832 CGCCGCCGCCGCCGAAGCTCGGG + Intergenic
936608402 2:113979313-113979335 GGTCACCGCCCCCGGGGAGCCGG + Intergenic
937160932 2:119760173-119760195 GGCCGGCGCCGCTGGGGAGGTGG - Exonic
937436331 2:121884860-121884882 GGCCTCCGCCTCTGCAGAGCAGG - Intergenic
938277343 2:130038037-130038059 GGCCGCCGCCGCCACAGCCCTGG + Intergenic
938438041 2:131299343-131299365 GGCCGCCGCCGCCACAGCCCTGG - Intronic
940848857 2:158669748-158669770 GGCCATTGCCGCCGGGGAGCCGG - Exonic
940918882 2:159286537-159286559 TGCCGCCACCGCCGCTGAGCCGG + Exonic
941508368 2:166375902-166375924 GACAGCCGCCGCTGGAGCGCTGG + Exonic
941929911 2:170929220-170929242 ACTCGCTGCCGCCGGAGAGCCGG - Exonic
942241109 2:173964676-173964698 CGCCGCCGCCGCCGGGGGGCGGG - Intronic
946856760 2:223957630-223957652 GCCCGCCGCCGCCCGTGCGCCGG + Exonic
948116007 2:235494581-235494603 CGCCGCAGCCCCCGGGGAGCCGG - Exonic
948467434 2:238159067-238159089 GGCCGCCGCCGCCGCGGGCCTGG + Exonic
948584244 2:239009094-239009116 GGCCGACGCCGACGGAATGCAGG - Intergenic
1168769870 20:408202-408224 GTCCGCCGCCGCCGGGTAGCCGG + Exonic
1169214621 20:3786019-3786041 GGCAGGCGCCGCCGGGGTGCGGG + Exonic
1170890176 20:20369233-20369255 GCCCGCCGCCGCCCGCGCGCCGG + Exonic
1171437174 20:25132855-25132877 GGCAGGCGCCGCTGGAGGGCTGG + Intergenic
1172083252 20:32358753-32358775 TGCCGCCGCCGCCGGGGAGAAGG + Exonic
1172640189 20:36436105-36436127 CGCCGCCGCCGCCGGGCACCTGG - Exonic
1176073836 20:63239636-63239658 GGCCCCCTCCGCAGGAGGGCTGG - Intronic
1178535130 21:33404100-33404122 GGCGGCCCCCGCCGGAGCCCTGG - Intronic
1178992449 21:37367036-37367058 CGCTGCCGCCGCCGGCGAGCAGG + Intronic
1178992690 21:37367854-37367876 GGCCGCGGCCTCCCGGGAGCCGG + Intronic
1179209722 21:39314214-39314236 GGCCCCCGCCCCAGGAGCGCGGG - Intronic
1179449917 21:41461311-41461333 GGCCACGGAAGCCGGAGAGCAGG - Intergenic
1180559227 22:16601981-16602003 GGCCGCCGCCGCCGCTGCTCGGG - Intergenic
1181068784 22:20319999-20320021 CGCCGCCGCCGGCGGCTAGCGGG - Exonic
1181478092 22:23180833-23180855 CGCCGCCGCCGCCGCCGCGCGGG + Exonic
1182226176 22:28800431-28800453 CGCCTCCGCCGCCGGAGCCCCGG - Exonic
1183050688 22:35258006-35258028 GGCCGCGGCCACGGGAGGGCTGG + Intronic
1183444503 22:37844214-37844236 GGCAGCCGCCGCCGGGGACGCGG - Exonic
1183702294 22:39457424-39457446 AGCCGCTGCCGCCGGAGCCCGGG + Exonic
1183845076 22:40536325-40536347 AGCCGCCGCCGCCCGACCGCCGG + Intronic
1183983694 22:41557665-41557687 GGCCTCAGCCTCCTGAGAGCTGG + Intergenic
1184472258 22:44702543-44702565 GGCCGCCGCCGCGGACGAGCGGG + Exonic
1184759590 22:46537104-46537126 GGCCGCCGCCGCCGCCCTGCCGG - Exonic
1185041878 22:48508326-48508348 GGCTGCCGCCCCCCCAGAGCTGG + Intronic
1185333524 22:50261815-50261837 GGCCGCCGCCGGGGGAGGGCCGG + Exonic
949559399 3:5188017-5188039 GGCTGCAGCCGCCGGGGACCGGG + Exonic
950012386 3:9732378-9732400 CGCCGCCGCATCCGGAGAGTGGG + Intronic
950168026 3:10816206-10816228 CGCCGCCGCCCCGGGCGAGCTGG - Exonic
950729784 3:14947603-14947625 CGCCGCCGCCGCCCGCGCGCTGG - Intronic
951080304 3:18444729-18444751 CGCCGCCGCCGCCGGAGCTGCGG + Intronic
952382958 3:32818490-32818512 GCCCGCTCCCGCCGGAGCGCCGG - Exonic
953657009 3:44862080-44862102 GGCCGCCGCCTCCGCCAAGCTGG + Exonic
954779071 3:53046019-53046041 CGCCGCCTCCGCCGGAGCGCGGG - Exonic
956713504 3:72058643-72058665 GGGCACTGCCGCCAGAGAGCCGG - Intergenic
959419622 3:106112748-106112770 AGCCGCCGCCGCCCGACCGCCGG - Intergenic
959530734 3:107431541-107431563 CGCCGCCGCCGCCGGGGCTCGGG + Intergenic
961144770 3:124584723-124584745 CAGCGCCGCCGCCCGAGAGCCGG - Intronic
961574454 3:127823222-127823244 GGCCGCCCCCGCCGCCGAGCCGG - Intronic
963236724 3:142963614-142963636 CGCCGCCGCTGCCGCAGCGCGGG - Exonic
966871139 3:184291244-184291266 GGCCTCAGCCGCTGGAGGGCTGG - Intronic
966878358 3:184336160-184336182 GGCTGCGGCCGCCGGTGCGCGGG + Intronic
968225220 3:196968839-196968861 CGCCGCCGCCGGCGCAGGGCGGG + Intronic
968727687 4:2255887-2255909 GGCTGCCGCTGCCGGGGAGCTGG + Intronic
969710137 4:8838452-8838474 GGCCCCTGCCGCCGAAAAGCTGG + Intergenic
970333149 4:15004223-15004245 CGCCGCAGCAGCCGCAGAGCCGG + Exonic
971019071 4:22516107-22516129 GGCGGCCGCCGGCGGCGGGCGGG - Intergenic
971457933 4:26861322-26861344 GGCCGCCGCGGCGGGAGAGGAGG - Exonic
975131882 4:70839558-70839580 GGCCGCGGCCGCGGCAGAGGTGG + Exonic
975701999 4:77075737-77075759 GGCCGCCGCCGCTCGAGCCCGGG + Exonic
975779059 4:77819925-77819947 GGCCGCGGCCGCCGGCGCGAAGG + Intergenic
975986236 4:80203145-80203167 GGCCGCCGCCGCCGCTCGGCAGG - Exonic
976226586 4:82799019-82799041 GGCCGCCTCCGCCCGGGGGCGGG + Intergenic
976595581 4:86892252-86892274 GGCCGCCGGCGCCGGCTCGCGGG - Intronic
980130015 4:128809785-128809807 GGCCGCGGCGGGCGGGGAGCCGG - Exonic
982288803 4:153759967-153759989 CTCCGCCGCCGCCGCAGATCCGG - Exonic
982616134 4:157637868-157637890 AGCCGCCGCCGCCCGACCGCCGG - Intergenic
983077498 4:163343916-163343938 TGCCGCCACCGCCGGGGTGCAGG + Intronic
985763557 5:1764555-1764577 AGGAGCCGCAGCCGGAGAGCTGG + Intergenic
987415192 5:17655135-17655157 GCCCGCCGCCTCCGCAGAGAGGG - Intergenic
992105782 5:73448196-73448218 CGCCGCCGCCGCCGCTGCGCGGG + Exonic
992373685 5:76170961-76170983 AGCCGCCGCCGCCCGACCGCCGG + Intronic
994072732 5:95620470-95620492 GCCCGCCGCCGCCGCACAGGCGG - Exonic
995052738 5:107724771-107724793 GGCCGCCGCCGCCGGGGGCCGGG - Intergenic
995809079 5:116084974-116084996 GGCCGCGGCGGACGGAAAGCCGG - Exonic
996379113 5:122845766-122845788 GGCCGCCGCCGCCTTGGCGCAGG + Intronic
996862877 5:128084506-128084528 CGCCGCCGCCGCCGGAGTGCAGG - Exonic
998228790 5:140346250-140346272 TGCCGACGCCCCCGGAGATCGGG - Intronic
998957642 5:147453737-147453759 GGCAGCCGCCGCGGGAGCCCGGG - Intronic
1000985212 5:167858731-167858753 AGCCGCCGCCGCCCGACCGCCGG + Intronic
1001025233 5:168218643-168218665 GGCTGCATCCCCCGGAGAGCAGG + Exonic
1002091790 5:176810482-176810504 GGAGCCCGCAGCCGGAGAGCGGG - Exonic
1002341447 5:178518917-178518939 AGCCGCCGCCGCCCGACCGCCGG - Intronic
1002771317 6:292611-292633 GGCAGCCGACGCCGGCGAGACGG - Intronic
1002898812 6:1393923-1393945 GGGAGCCGCCCCGGGAGAGCAGG + Intronic
1004044689 6:12012448-12012470 CGCCGCCGCCGCCGCCGCGCGGG + Exonic
1006071053 6:31498250-31498272 GGCAGCCGCCGCTGGTGAGTGGG + Exonic
1006312171 6:33268561-33268583 GGCAGCCGCAGTCAGAGAGCAGG - Exonic
1006492096 6:34396881-34396903 AGCCGCCGCCGCCCGACCGCCGG + Intronic
1007327287 6:41072474-41072496 GGCCGCCCCCGCCCGGTAGCGGG + Exonic
1007423475 6:41733561-41733583 GGCCGCGGGGCCCGGAGAGCTGG - Intronic
1007451139 6:41941075-41941097 GGCCGCCCCCGCCCGGGAGCCGG - Intronic
1007581127 6:42960790-42960812 GGCCGCCACCCCCAGGGAGCGGG - Exonic
1007630306 6:43269747-43269769 AGCCGCCGCCGCCGGGGTGAGGG - Intronic
1007674462 6:43581667-43581689 AGCCGCCGCCGCCCGACCGCCGG - Intronic
1007936972 6:45741121-45741143 GACCGCGGCATCCGGAGAGCAGG - Intergenic
1008649024 6:53544803-53544825 AGGGGCCGCCGCCGGGGAGCCGG - Exonic
1009437627 6:63636077-63636099 CGCTGCCGCCGCCGAAGAGGAGG - Exonic
1013793619 6:113860201-113860223 GGGCGCGGCCTCCGGGGAGCAGG + Exonic
1015476504 6:133664191-133664213 AGCCGCCGCCGCCCGACCGCCGG + Intergenic
1016329871 6:142945118-142945140 GGCCGCCGCAGCCGCAGCGGTGG + Exonic
1016714068 6:147203991-147204013 GGCGGCCGCGGACAGAGAGCCGG + Intergenic
1017103197 6:150866074-150866096 GGCCACAGCCGCTGGAGACCTGG - Intronic
1017146772 6:151241252-151241274 GGCCGCTGCCGCAGGAGGACTGG - Intronic
1017164158 6:151391553-151391575 CGCCGCCGCCGCCGCCGCGCCGG - Intergenic
1017568003 6:155709418-155709440 GGCCGCCGTCAGCTGAGAGCTGG + Intergenic
1017662424 6:156687447-156687469 GGCCGCCGCGGCCGGGGCGTGGG - Intergenic
1018400489 6:163415135-163415157 CGCCGCCGCCGCCGGAGAGGAGG - Exonic
1019111926 6:169724007-169724029 CGCCGCCGCCGCCGCCGCGCGGG + Exonic
1019279564 7:193021-193043 GGCGCCCGCCGCCGGAGCGCTGG - Exonic
1019474251 7:1236437-1236459 CGCCGCCGCCGCCGCGGGGCTGG + Exonic
1019476360 7:1246554-1246576 GGCCGCCGCCGCCCCAGGACCGG - Intergenic
1020756604 7:12211292-12211314 GCGCGCGGCCGCCGTAGAGCTGG - Exonic
1021231103 7:18086899-18086921 CGCCGCCGCCGCCGCCGCGCGGG - Intergenic
1021827895 7:24573184-24573206 TGCCACCGCCTCCGGAAAGCCGG - Intergenic
1021872113 7:25017856-25017878 AGCCGCCGCCGCCCGACCGCCGG + Intergenic
1021998482 7:26202114-26202136 GGGCGCCTCCGCCGGAACGCGGG - Intronic
1022528447 7:31052799-31052821 GACCTCCACCGACGGAGAGCGGG + Intronic
1022923296 7:35037280-35037302 GGACGTCGGCGCCGGGGAGCCGG - Intronic
1022936692 7:35185948-35185970 GGCCTCCCCCGCCCGGGAGCTGG - Intergenic
1029281591 7:99439067-99439089 GGCCGCCGCCGCCGCCATGCAGG + Exonic
1029832927 7:103280059-103280081 GGCCTCCCCCGCCCGGGAGCGGG - Intergenic
1032174353 7:129611692-129611714 CGCCGCCGCCGCCGAGGAGGGGG - Exonic
1032174357 7:129611695-129611717 CGCCGCCGCCGCCGCCGAGGAGG - Exonic
1034128920 7:148698595-148698617 GGCCGCCGGCAGCGGCGAGCGGG + Intronic
1034741836 7:153481540-153481562 TGCCTCAGCCTCCGGAGAGCTGG - Intergenic
1035455426 7:159005936-159005958 GGCCGCAGGCACCGGAGCGCGGG - Intergenic
1035508140 8:150704-150726 AGCCGCCGCCGCCCGACCGCCGG - Intergenic
1035553015 8:544655-544677 GGCCGCCGCCGCCGCCGCCCAGG - Exonic
1035580745 8:737965-737987 GCCCGCCGGGGCCGGAGCGCTGG + Intronic
1036466561 8:9003122-9003144 AGTCGCCGCGGCCGGAGGGCGGG + Exonic
1036536904 8:9658415-9658437 AGCCGCCGCCGCCCGACCGCCGG - Intronic
1042216351 8:66432519-66432541 GGCCGCTGCCGCCCGAGCCCGGG + Exonic
1044660436 8:94590116-94590138 AGCCGCCGCCGCCCGACCGCCGG + Intergenic
1047687088 8:127315781-127315803 AGCCGCCGCCGCCCGACCGCCGG + Intergenic
1048881858 8:138877945-138877967 GGCTGCGGCCGTCGGTGAGCAGG + Exonic
1049585306 8:143430169-143430191 CGCCGCCGCCGCCGGTGCCCGGG + Exonic
1049585391 8:143430482-143430504 GACCGCCGCCCGCGGGGAGCAGG - Intergenic
1049693718 8:143973627-143973649 GGCCGCCGCGGCCGGGCAGAGGG + Intronic
1053157537 9:35791511-35791533 GGCAGCCGGCGCCGGAGGGTGGG + Intergenic
1053198437 9:36136977-36136999 GGAGGCCCCCGCCGGAGAGCCGG + Intronic
1053372726 9:37576242-37576264 GGCCGCGGCCGCCGGTGCCCTGG + Exonic
1053457038 9:38241452-38241474 AGCCGCCGCCGCCCGACCGCCGG + Intergenic
1057436857 9:95048552-95048574 GGCCGCCGCGGCCGGAGGGGTGG - Intronic
1058861211 9:109119445-109119467 GGCCGCCGGCGCCGAGCAGCAGG + Exonic
1059210830 9:112513612-112513634 AGCCGCCGCCGCCCGACCGCCGG + Intronic
1060064749 9:120494965-120494987 AGCCGCCGCCGCCCGACCGCCGG + Intronic
1061059795 9:128244698-128244720 CACCGCCGCCACTGGAGAGCTGG - Intronic
1061878738 9:133557806-133557828 GGCCGTGACTGCCGGAGAGCTGG - Intronic
1061984120 9:134119157-134119179 AGCCGCCGCCGCCCGACCGCCGG - Intergenic
1062105763 9:134753943-134753965 CGTCGCTGCCGCCGGAGAACGGG - Intronic
1062626044 9:137441849-137441871 GGCCGCCGCCGTCGGGGTCCGGG + Intergenic
1062659198 9:137619365-137619387 CGCCGCCGCCGCCCGCAAGCCGG + Intronic
1062696330 9:137877972-137877994 GGGCCCCGGCGGCGGAGAGCGGG + Exonic
1188003523 X:25002639-25002661 CGCCGCCGCCGCCGGCCAGTCGG - Intergenic
1190320534 X:49177004-49177026 AGCCGCCGCAGCTGGAGTGCCGG - Exonic
1191618342 X:63190430-63190452 AGCCGCCGCCGCCCGACCGCCGG - Intergenic
1192214605 X:69150021-69150043 GGCCGCCGAGGCCTGGGAGCCGG + Intergenic
1192224974 X:69221742-69221764 GGCCGCCGAGGCCTGGGAGCCGG - Intergenic
1192621050 X:72680746-72680768 AGCCGCCGCCGCCCGACCGCCGG + Intronic
1195036351 X:100973488-100973510 AGCCGCCGCCGCCCGACCGCCGG - Intronic
1195954795 X:110317831-110317853 CGCCGCCGCCGCCGCAGCCCTGG + Exonic
1200001912 X:153066525-153066547 GGCCGCGGCCGGTGGGGAGCTGG + Intergenic
1200005820 X:153083500-153083522 GGCCGCGGCCGGTGGGGAGCTGG - Intergenic