ID: 904181401

View in Genome Browser
Species Human (GRCh38)
Location 1:28668997-28669019
Sequence CGCCGCCGCCGGGGAGCGAG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 295
Summary {0: 1, 1: 0, 2: 4, 3: 36, 4: 254}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904181392_904181401 -2 Left 904181392 1:28668976-28668998 CCCACGCCCTGTGCGTGCCGCCG 0: 1
1: 0
2: 0
3: 2
4: 67
Right 904181401 1:28668997-28669019 CGCCGCCGCCGGGGAGCGAGCGG 0: 1
1: 0
2: 4
3: 36
4: 254
904181389_904181401 11 Left 904181389 1:28668963-28668985 CCGCGGGCGCCTCCCCACGCCCT 0: 1
1: 0
2: 3
3: 36
4: 390
Right 904181401 1:28668997-28669019 CGCCGCCGCCGGGGAGCGAGCGG 0: 1
1: 0
2: 4
3: 36
4: 254
904181393_904181401 -3 Left 904181393 1:28668977-28668999 CCACGCCCTGTGCGTGCCGCCGC 0: 1
1: 0
2: 1
3: 13
4: 166
Right 904181401 1:28668997-28669019 CGCCGCCGCCGGGGAGCGAGCGG 0: 1
1: 0
2: 4
3: 36
4: 254
904181394_904181401 -8 Left 904181394 1:28668982-28669004 CCCTGTGCGTGCCGCCGCCGCCG 0: 1
1: 0
2: 2
3: 22
4: 198
Right 904181401 1:28668997-28669019 CGCCGCCGCCGGGGAGCGAGCGG 0: 1
1: 0
2: 4
3: 36
4: 254
904181391_904181401 -1 Left 904181391 1:28668975-28668997 CCCCACGCCCTGTGCGTGCCGCC 0: 1
1: 0
2: 1
3: 5
4: 142
Right 904181401 1:28668997-28669019 CGCCGCCGCCGGGGAGCGAGCGG 0: 1
1: 0
2: 4
3: 36
4: 254
904181390_904181401 2 Left 904181390 1:28668972-28668994 CCTCCCCACGCCCTGTGCGTGCC 0: 1
1: 0
2: 0
3: 25
4: 243
Right 904181401 1:28668997-28669019 CGCCGCCGCCGGGGAGCGAGCGG 0: 1
1: 0
2: 4
3: 36
4: 254
904181388_904181401 14 Left 904181388 1:28668960-28668982 CCTCCGCGGGCGCCTCCCCACGC 0: 1
1: 0
2: 3
3: 27
4: 296
Right 904181401 1:28668997-28669019 CGCCGCCGCCGGGGAGCGAGCGG 0: 1
1: 0
2: 4
3: 36
4: 254
904181395_904181401 -9 Left 904181395 1:28668983-28669005 CCTGTGCGTGCCGCCGCCGCCGC 0: 1
1: 0
2: 13
3: 102
4: 527
Right 904181401 1:28668997-28669019 CGCCGCCGCCGGGGAGCGAGCGG 0: 1
1: 0
2: 4
3: 36
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904181401 Original CRISPR CGCCGCCGCCGGGGAGCGAG CGG Intronic
900180124 1:1307648-1307670 CGCGGCCGCCGGGGAGGGGCTGG - Intronic
900240771 1:1616226-1616248 CGCCGGCGCAGGGGAACGGGCGG - Intronic
900269171 1:1778415-1778437 CGCCGGCGCCGGGGTCCGGGCGG - Intronic
900349739 1:2228677-2228699 GGGCGCCGCCGGGGCGCGCGGGG + Exonic
900513084 1:3069499-3069521 CGGCGCCTTCGGGGAGCGCGCGG - Intronic
901045980 1:6395982-6396004 CGCCGGCCCCGGGCAGTGAGGGG - Intergenic
901629021 1:10639238-10639260 CGCCGCCCCCGGGCCGCGCGAGG - Exonic
902148157 1:14420754-14420776 CGCCGGCCCCGGGCAGTGAGGGG - Intergenic
902330368 1:15728363-15728385 CGCCGCCCCCGGGCAGACAGCGG + Intronic
902336814 1:15758821-15758843 CGGAGCCGCCGGGGCGCGGGCGG + Intronic
904181401 1:28668997-28669019 CGCCGCCGCCGGGGAGCGAGCGG + Intronic
904724979 1:32539950-32539972 GGCCGCCGCGGGGGCGCGCGGGG + Intronic
905182657 1:36176494-36176516 CGCCCCCGCCGGTGAGCGCGGGG + Exonic
905442690 1:38005286-38005308 CGCCCAGGCCGGGGAGCGAAGGG - Intronic
906292988 1:44632009-44632031 CGCCGCCGCCGGGCAGCCACGGG + Intronic
906480955 1:46198478-46198500 CGCCGCTGCCGCGGGGTGAGAGG + Intronic
907010636 1:50959900-50959922 CGCCGCCGCCGGGCGCCGAGGGG + Exonic
907429931 1:54405902-54405924 CGCCGCCGCCGGGCTGCGGGCGG - Intronic
908131800 1:61082206-61082228 CGGGGGGGCCGGGGAGCGAGCGG + Intronic
908193295 1:61725156-61725178 CGCCTCCGCCCAGGAGCGGGAGG + Intronic
911348138 1:96721681-96721703 CGCCGGCGCCCGGCAGCGGGAGG - Intronic
912915644 1:113812069-113812091 CGCCGGTGAGGGGGAGCGAGAGG + Exonic
918044827 1:180935489-180935511 CGCCGGCACCGGGCAGCGAGAGG + Exonic
918388857 1:184037426-184037448 GGCGGCTGCCGGGGAGCAAGGGG + Exonic
920309971 1:205043252-205043274 CGCCGCACCCGGACAGCGAGCGG + Exonic
920367762 1:205457050-205457072 CGCCGCCGCCGGAGGCCGCGCGG + Intergenic
1062774475 10:134736-134758 CGCCGAGGCCGGGGCGCGAGGGG - Exonic
1063593141 10:7410958-7410980 GGCGGCGGGCGGGGAGCGAGCGG - Intronic
1065099864 10:22321787-22321809 CGGCGCGGCCGGGGCGCGGGGGG - Intronic
1070768619 10:79070061-79070083 CACCGCCGCCGGAGACGGAGAGG - Intronic
1072059744 10:91798479-91798501 CGCCGCCGCGGGGCAGCCGGGGG + Exonic
1073265629 10:102226685-102226707 CCCCGGGGCCGGGGCGCGAGGGG + Intronic
1074996350 10:118760399-118760421 CGCCGGCCCCGGGCAGTGAGGGG - Intergenic
1075031967 10:119029825-119029847 CGCGGCCGCGGCGGGGCGAGCGG - Exonic
1075048620 10:119165668-119165690 CGCCGCCGCCAGGCCGCGCGTGG + Intergenic
1075522216 10:123149684-123149706 CGCCCTCGCCGGGGTCCGAGCGG + Exonic
1075629401 10:123991950-123991972 CGCCGTCGCCGGGTTGCCAGGGG - Intergenic
1075768971 10:124917314-124917336 GGGCGCCGCCTGGGAGCGAGGGG - Intergenic
1076993794 11:288984-289006 CGCTGCCAGCGGGGACCGAGGGG + Intergenic
1076995679 11:296477-296499 CGCTGTCGCTGGGCAGCGAGAGG + Intergenic
1077107908 11:849867-849889 TTCCGCCGCCGGGGTCCGAGCGG + Intronic
1079459767 11:20669500-20669522 CGCCGCCGCCGCCGCGCCAGCGG + Intergenic
1083039123 11:59669070-59669092 CGCCGCCGCCGGGCGCCGAGCGG - Intergenic
1083237616 11:61361779-61361801 CTCCGGCGCCTGGTAGCGAGAGG - Exonic
1083457108 11:62786686-62786708 CGCTGCCGCCAGGGGGCGCGGGG + Exonic
1083617966 11:64035779-64035801 CGCCGCCGCCGCGAGGGGAGAGG + Intronic
1083618439 11:64037315-64037337 CGCGGCCGCCGGGCAGAGACAGG - Intronic
1084153944 11:67303646-67303668 CGCCGCTGCCCGGGGGCGAACGG - Exonic
1084680151 11:70662287-70662309 CGCCGGCGCCGGGACGGGAGAGG - Intronic
1086993426 11:93330591-93330613 CGCCGCGCGCGGGGAGGGAGAGG + Intronic
1091000924 11:131910524-131910546 CGGTGCCGCCTCGGAGCGAGCGG - Intronic
1091108488 11:132943978-132944000 CGGTGCCGCCTCGGAGCGAGCGG + Intronic
1091616088 12:2052578-2052600 CGCCGCCGGCGGGGCGCGAGGGG + Intronic
1091616124 12:2052689-2052711 CCCGGCCGCCGGCGGGCGAGGGG - Intronic
1094719941 12:33052925-33052947 CGCCGCCGCCGGGCAGGCCGGGG + Intergenic
1096482473 12:51951788-51951810 CGCCGCTGCCGGCGAGCAGGAGG - Exonic
1097264414 12:57737508-57737530 CGCCGCCGCCGCCGGGGGAGGGG - Exonic
1098029049 12:66235412-66235434 GGCCGCCGCCGCGCGGCGAGAGG - Intronic
1099989753 12:89709259-89709281 CGCCGCCAGCGTGGAGCGGGAGG - Intronic
1102256425 12:111418189-111418211 GGCCGCCGCCGGGGAGGCTGAGG - Exonic
1102853944 12:116277464-116277486 GGCCCCCGCCGGCGCGCGAGGGG + Intergenic
1104953448 12:132452775-132452797 TGCCGCAGCCTGGGAGTGAGGGG - Intergenic
1105830708 13:24161120-24161142 AGCCACCGCCGGGCAGGGAGCGG - Intronic
1106756077 13:32824265-32824287 CGCCTCTGCCGGGGAAGGAGAGG - Intergenic
1110887258 13:80655165-80655187 CGCCCCCGCCGGGCTGCGGGAGG - Intergenic
1112652763 13:101416515-101416537 CGCCGCCGCCGGGCAGGCTGGGG + Intergenic
1113657007 13:112073337-112073359 AGCCGCCGGCGGGGGGCGGGTGG + Intergenic
1114031530 14:18584240-18584262 CGCAGCCGCCAGGGAGGGACTGG - Intergenic
1114559636 14:23580705-23580727 CGCCGGCGCTGGGCAGTGAGGGG + Intergenic
1116223187 14:42113701-42113723 CGCCGGCCCCGGGCAGTGAGGGG - Intergenic
1117377589 14:55129798-55129820 CACGGCCGCGGGGGAGCGAAGGG + Intronic
1117424463 14:55580385-55580407 CGCCGGCGGCGGGGAGCGCGGGG + Intronic
1117899139 14:60515148-60515170 CGCCGCCGACGGGAAGGCAGCGG + Intronic
1118350872 14:64971907-64971929 GGCCGCGGGCGGGGAGGGAGGGG + Intronic
1118351007 14:64972378-64972400 CGCCGCCGCCCCGGAGAGAGGGG + Intronic
1119652784 14:76395360-76395382 TGCAGCCCCCGGGGAGCCAGTGG - Intronic
1120168030 14:81220940-81220962 CGCCGCCGCCGCCGAGAGACAGG + Intronic
1120914796 14:89701676-89701698 CGCCGGCGCCGGGAAGCGGGGGG - Intergenic
1122544975 14:102517157-102517179 CGCCGAGGCCGCGGGGCGAGGGG - Intergenic
1124061596 15:26298314-26298336 CGCCGGCCCCGGGCAGTGAGGGG - Intergenic
1124431740 15:29614282-29614304 CGCCGCCGCAGAAGAGGGAGAGG + Intergenic
1125462679 15:39920997-39921019 CGCGGCAGCCTGGGCGCGAGGGG - Intergenic
1125594236 15:40874069-40874091 CGCCGCCGCGGGGGAGGGGTCGG + Exonic
1125674252 15:41494071-41494093 CGCCGCCGCGGGGGAGCCCCGGG + Exonic
1126997576 15:54462563-54462585 CCCCGGCCCCGGGGAGTGAGGGG + Intronic
1128322029 15:66701161-66701183 CGCCGCGCCCGGGGGGGGAGGGG + Intergenic
1128743020 15:70096425-70096447 CGCTGCCGACGGGGAGAGATGGG - Intronic
1129189250 15:73927799-73927821 CGCCCCCGCCGGGTGGGGAGCGG + Exonic
1129644737 15:77419832-77419854 CGCCGCCGCCGGGGCTCTGGCGG - Intronic
1129761475 15:78131428-78131450 CGCCGCCGGCGGGAAGAGGGCGG + Exonic
1131012708 15:89031909-89031931 CGCCGGCCCCGGGCAGTGAGGGG - Intergenic
1131180237 15:90234150-90234172 CCCCGCCTCCGGGGTGGGAGGGG + Intronic
1132099802 15:99015195-99015217 CGCCGAGGCCGGGGCGCGCGTGG - Intergenic
1133097582 16:3458002-3458024 CGCTGCCGGCAGGGAGCGGGAGG + Intronic
1133156588 16:3880512-3880534 CGCCGCCGCCGGGCTCCGGGAGG + Exonic
1138688769 16:58748963-58748985 CGCCGGCCCCGGGCAGTGAGGGG + Intergenic
1139390544 16:66604609-66604631 CCCCGCAGCCGGGGTCCGAGGGG + Intronic
1139459429 16:67110036-67110058 CGCTGCCGCCGGGGAGGAGGTGG + Exonic
1139974794 16:70800979-70801001 CGCCGGCGCCGGGGGCAGAGCGG - Exonic
1141608608 16:85169325-85169347 CGCCGCCGCCGGGGGGTGCTCGG + Intergenic
1141683379 16:85556644-85556666 CGCCGCGGCGGCGGAGCGAGCGG + Intergenic
1142136941 16:88455843-88455865 GGCTGCCGACGGGGAGCGCGGGG + Intronic
1142191975 16:88722276-88722298 CACCGACCCCGGGGAGCGTGAGG - Exonic
1142549910 17:732311-732333 CGCGGCCGCTCGGGAGGGAGCGG + Intergenic
1142610825 17:1108634-1108656 CGCCGCCTCCCTGGAGCGGGTGG - Intronic
1142983628 17:3685464-3685486 TGCGGCCGCCGGGGAGAGGGTGG + Intronic
1143155501 17:4833679-4833701 CCCCGCCGCAGGGGAGGGAGCGG + Intronic
1143590666 17:7884686-7884708 CGCCGCCGCCGAGGAGGAGGAGG + Intronic
1143830299 17:9645669-9645691 CGGCGGGGCCGGGGCGCGAGCGG - Exonic
1145765517 17:27456269-27456291 CGCGGCCGCCGGGAGGGGAGGGG + Intergenic
1146034041 17:29390655-29390677 GGCCGCGGCGGGGGACCGAGAGG + Exonic
1146370966 17:32265677-32265699 CGGCGCGGCCCGGGAGCGGGAGG - Intergenic
1146955856 17:36936106-36936128 CGCCGGCGCGGGGGAAGGAGTGG - Intergenic
1147307408 17:39573641-39573663 CGCCGCCGCCGGGCCGCGCCGGG + Intergenic
1147971297 17:44220070-44220092 TGCCGCCGCCGGGGAAGGGGGGG + Intronic
1148060134 17:44830327-44830349 CGCCGCGGCCCGGGAGCGGGGGG + Intronic
1148262312 17:46193824-46193846 GGCCGGCGCCGCGGAGCGAGAGG + Intronic
1148440416 17:47709022-47709044 CGCCGCCCCCGCCGGGCGAGAGG + Exonic
1148560609 17:48603933-48603955 CGCCGAGGCCGGCGAGGGAGAGG - Intronic
1148633949 17:49132914-49132936 CGCCGGAGCCAGGGAGCGGGCGG + Intronic
1149685386 17:58531885-58531907 TGCAGCCGCCCGGGAGCGACCGG + Intronic
1151513387 17:74576678-74576700 CACAGCCGCCGGGGAGCCATAGG - Intergenic
1151797151 17:76353893-76353915 CGCCGCCGCCTCAGAGCCAGAGG + Exonic
1152744184 17:82031594-82031616 CGCGGCCGGCGGGGGGCGGGGGG - Intergenic
1152785397 17:82245344-82245366 CACCGACGGCGGGGAGTGAGTGG + Intronic
1153815279 18:8785441-8785463 TGCCGCCGCTGGGGAGGGCGCGG + Intronic
1154255321 18:12777106-12777128 CGCCGGCCCCGGGCAGTGAGGGG - Intergenic
1154304254 18:13218635-13218657 GGCCGGGGCCGGGGAGCGCGCGG - Intronic
1155053819 18:22169038-22169060 CGCCGCCGCCGCGGCGGGAGGGG - Intergenic
1155461725 18:26090908-26090930 CGCCGCCGCGGGAGAAGGAGAGG + Intronic
1157464245 18:47930623-47930645 CGCCGCCCGCGGGGAAGGAGGGG + Intronic
1160024929 18:75209227-75209249 CGCCGGCGCCGGGGAGGCGGGGG - Exonic
1160067419 18:75588914-75588936 CCCGGCCGCCTGGAAGCGAGAGG + Intergenic
1160791549 19:925882-925904 CGCCGCGGCCCGGGCGCGGGAGG - Intronic
1160873166 19:1286076-1286098 CGCCGCCGCCGCCGAGCGGGCGG - Intergenic
1160967627 19:1753570-1753592 CGCAGCCACCGGGGAGCGGGCGG + Exonic
1160967869 19:1754442-1754464 CGCCGCCTCCGGGCAGCCCGCGG - Exonic
1161238088 19:3207795-3207817 AACCACCGCCGGGGAGGGAGAGG - Exonic
1161238169 19:3208137-3208159 CGCCACCATCGGGGAGCGGGAGG - Exonic
1161400800 19:4065709-4065731 CGCCCTCCCCGGGGAGCGCGGGG + Intronic
1161959503 19:7516104-7516126 AGGCGCTCCCGGGGAGCGAGAGG - Exonic
1162486018 19:10961049-10961071 CGCCGCCGCCGCCAAACGAGGGG - Exonic
1163513082 19:17747720-17747742 CGCCGCAGCCGCGGAGGGAGGGG + Exonic
1163606973 19:18280974-18280996 CGCCGCCGCCGGGGGGCCCTCGG - Exonic
1165243111 19:34482477-34482499 CGCAGGCTCCGGGGAGCGAGCGG - Exonic
1165415532 19:35691310-35691332 CGCCGGCCCCGGGCAGTGAGGGG - Intergenic
1165861665 19:38912256-38912278 CGCCGCGGGCGGGGAGGGGGCGG - Intergenic
1166106692 19:40601246-40601268 CGCGGCCGCCGGGGAGGGAGTGG + Intronic
1166361151 19:42253587-42253609 CCCAGCCACCCGGGAGCGAGTGG + Intronic
1168344233 19:55642618-55642640 CCCCGCCGCCGAGGAAGGAGTGG - Exonic
925172607 2:1759548-1759570 CGCCGGCCCCGGGCAGTGAGGGG - Intergenic
925922102 2:8645093-8645115 CGCGGCCACCAGGGAGCGTGGGG - Intergenic
926095972 2:10080580-10080602 ACCCGACGGCGGGGAGCGAGGGG - Intronic
927357077 2:22186451-22186473 CGCCGGCCCCGGGCAGTGAGGGG + Intergenic
927596579 2:24402968-24402990 CGCCAGCGCCGGGGAGTGAGGGG + Intergenic
927942190 2:27111719-27111741 CGCCGGCCCCGGGCAGTGAGGGG - Intronic
927964784 2:27262269-27262291 GGCGGCCGCCGGGAAGCGAGGGG - Intronic
928241281 2:29588956-29588978 AGCCCCCGGAGGGGAGCGAGGGG - Intronic
929857621 2:45650304-45650326 CGCGCCCTCCGGGGGGCGAGTGG - Intergenic
930700739 2:54456458-54456480 CCCGGCCGCCGAGGAGCGGGAGG + Exonic
931106966 2:59067037-59067059 CGCTGGCCCCGGGGAGTGAGGGG + Intergenic
936038394 2:109129978-109130000 CCCCGCCGCCCGCGAGCGTGGGG - Exonic
936104531 2:109613747-109613769 CGCGGGGGCCGGGGAGCGCGGGG + Intronic
937901693 2:127024872-127024894 CGCCGCCTCCTGGGAGAGCGTGG - Intergenic
938496666 2:131801553-131801575 CGCAGCCGCCAGGGAGGGACTGG + Exonic
941020965 2:160407653-160407675 GGCCGCCGCCGCGCGGCGAGAGG - Intronic
941029308 2:160493433-160493455 CGCCGCCGCCGGAAAGGGAGAGG - Exonic
942241107 2:173964673-173964695 CGCCGCCGCCGGGGGGCGGGTGG - Intronic
942566007 2:177264940-177264962 CGCCGGCACCGGGGAGCTAACGG - Exonic
943593056 2:189822022-189822044 CGCCCCGCCCGGAGAGCGAGTGG - Intronic
944743505 2:202634785-202634807 CGCCCCCCGCGGGGAGGGAGCGG - Intergenic
945225877 2:207530484-207530506 CGCCGCCGCCGGGCCGGGCGCGG + Intronic
945869140 2:215207982-215208004 CGCCGGCCCCGGGCAGTGAGGGG + Intergenic
945907902 2:215615137-215615159 CGCCGGCCCCGGGCAGTGAGGGG - Intergenic
946325086 2:218980929-218980951 CGCCGCCCGCAGGCAGCGAGAGG - Intergenic
946376503 2:219312929-219312951 CGCCGGCCCCGGGCAGTGAGGGG + Intergenic
1169214624 20:3786022-3786044 AGGCGCCGCCGGGGTGCGGGGGG + Exonic
1169214736 20:3786519-3786541 CGCCGCCGCCCCGGGGCGGGGGG + Exonic
1170150423 20:13221475-13221497 CGCCGCCGCCAGGCAGCGCCGGG + Intergenic
1171034717 20:21705889-21705911 CGCCGCCGCCGCCGCGTGAGAGG - Exonic
1174494671 20:50931138-50931160 CCCCGCTGCTGAGGAGCGAGAGG - Exonic
1175926783 20:62475206-62475228 CGCCGCTGCCGGGCCCCGAGGGG + Exonic
1175962097 20:62642436-62642458 CGCCCCCGCCGCAGAGGGAGGGG - Exonic
1178513832 21:33229899-33229921 CGCCGCCGCCGGCGCGGGGGCGG - Intronic
1178992450 21:37367039-37367061 TGCCGCCGCCGGCGAGCAGGCGG + Intronic
1179605625 21:42513753-42513775 CGCGGCGGCCGGGGAGGGGGAGG + Intronic
1180455642 22:15511297-15511319 CGCAGCCGCCAGGGAGGGACTGG - Intergenic
1180650008 22:17369674-17369696 CGCCCCCGCCGAGGACCGCGCGG + Exonic
1180962030 22:19766489-19766511 CGCCGGCCCCGGGCAGCGAGGGG - Exonic
1181147451 22:20858876-20858898 CACCGCTGCAGGGGAGAGAGGGG + Intronic
1181270823 22:21657628-21657650 CGCCGCGGCCGTGGGGAGAGAGG + Intronic
1184620320 22:45671873-45671895 CGCCGCCGCCGGAGAGCTCTAGG - Exonic
1184680596 22:46070720-46070742 CGCCGGCCCCGCGGAGCAAGGGG - Intronic
1185055238 22:48575792-48575814 CGCCGCCGCCGGGGTCCGCGCGG - Intronic
950215224 3:11154316-11154338 GGCCGCCCCCGCGGAGAGAGGGG - Intronic
953998208 3:47536621-47536643 CCCCGTCGCCGGGGCCCGAGTGG - Intergenic
954110105 3:48429002-48429024 CGTCGCCGCCGGGGACCGGCCGG - Intronic
954779069 3:53046016-53046038 CGCCTCCGCCGGAGCGCGGGTGG - Exonic
954838929 3:53494631-53494653 CGCGGCGGGCGCGGAGCGAGCGG + Intergenic
955387636 3:58492155-58492177 CGCCGCCGCCGCGCAGTGAGTGG + Intronic
959530736 3:107431544-107431566 CGCCGCCGCCGGGGCTCGGGCGG + Intergenic
960896747 3:122514376-122514398 CGCCGCGGCCGGGCGGCGGGCGG - Intronic
962520744 3:136195850-136195872 GGCCGCCGCCGGCGGGCGGGAGG + Intronic
962676948 3:137764570-137764592 GGCAGCCCCGGGGGAGCGAGTGG - Exonic
963107618 3:141660266-141660288 CGCCGGCGCCGGGGAGACAGCGG - Intergenic
968727690 4:2255890-2255912 TGCCGCTGCCGGGGAGCTGGGGG + Intronic
971432607 4:26584137-26584159 GGCCGCCGGCGCGGAGCGAACGG - Exonic
971564202 4:28117392-28117414 CGCCGGCGCCAGGCAGTGAGCGG - Intergenic
973137311 4:46724414-46724436 CGCCGCCGCGGCCCAGCGAGCGG - Intergenic
975401504 4:73944284-73944306 CGCAGTAGCCGGGGAGCGCGGGG + Intergenic
976226588 4:82799022-82799044 CGCCTCCGCCCGGGGGCGGGTGG + Intergenic
979349659 4:119628955-119628977 CGCCGCCTCCTGGGAACCAGGGG - Exonic
979547163 4:121951556-121951578 CGCCGCCGCCGGGGCTGGAGGGG - Exonic
980115214 4:128672772-128672794 CGCTGCCCCCGGGCAGTGAGGGG + Intergenic
981528855 4:145733344-145733366 CGTCGCCCCCGCGGAGCGCGCGG + Intronic
988547696 5:32173950-32173972 CGCCGCCGACAAGGAGCGGGCGG - Exonic
989576454 5:42992654-42992676 CGCCGCCGCCCGGGAACGCCAGG - Intergenic
992105506 5:73447166-73447188 CGCCGCCACCGGCGAGGGCGAGG + Exonic
993900946 5:93584189-93584211 GGCCGCAGCCGGAGCGCGAGCGG - Exonic
994171406 5:96662608-96662630 CGCCCCCGCGGGGCAGGGAGAGG + Intronic
997980697 5:138465908-138465930 CGGCGCCGCCGGGGCCCCAGAGG + Exonic
998203917 5:140145964-140145986 CGGCGCCGCCAGGGGGCGAATGG + Intergenic
999129406 5:149271676-149271698 CGCCGCGGAGGGCGAGCGAGCGG + Intergenic
1000609140 5:163355967-163355989 CGCCGGCCCCGGGCAGTGAGGGG + Intergenic
1001823002 5:174724601-174724623 CGCCGCTGCCGGGTTGCCAGCGG + Exonic
1001841537 5:174880778-174880800 CGCCGGCCCCGGGCAGTGAGGGG + Intergenic
1002058069 5:176610053-176610075 CGCCGCCGCCGCCGCCCGAGCGG + Exonic
1002131917 5:177087112-177087134 CCCAGCCGCCAGGGGGCGAGAGG + Intronic
1002140287 5:177133732-177133754 CGCGGCCGCGGGGGCGCGCGCGG + Intronic
1002190057 5:177473336-177473358 CCCCGCCGCCGGGAAGGGAGGGG - Intronic
1003139306 6:3457233-3457255 CGCCGCCGCCCGGGATCCACGGG + Intergenic
1003589603 6:7425892-7425914 CGCCGGCCCCGGGCAGTGAGGGG + Intergenic
1003868727 6:10385133-10385155 CGTGGCGGCCGGGGAGCGCGAGG - Intergenic
1004220608 6:13743314-13743336 CGGCCCCGCCGGGGTGTGAGGGG + Intergenic
1004906210 6:20239173-20239195 CGCCGGCCCCGGGCAGTGAGGGG + Intergenic
1006137144 6:31902038-31902060 CGCCGCCGCCGCCGCGCGCGCGG - Intronic
1006679494 6:35787129-35787151 CGCCGCCCGGGGGGAGCCAGAGG + Intronic
1006737555 6:36285306-36285328 CGCCGCCGCCTCGCAGCGATTGG + Intronic
1008649063 6:53544939-53544961 CGCCGCCGCATCGGAGCGGGAGG - Exonic
1011419443 6:87155867-87155889 CGCCTCCGCCTGGGTGGGAGCGG + Intronic
1013359661 6:109382434-109382456 CGGCGCCGCAGGGGATTGAGGGG - Exonic
1015773466 6:136791993-136792015 CGCCGCCGCCGGGCAGCTTCTGG - Exonic
1016863816 6:148747233-148747255 CCCCGCCGCCGCGGCCCGAGCGG - Intergenic
1017163879 6:151390638-151390660 CGCCCCCGCCCGCGAGCGGGAGG + Intronic
1018400483 6:163415129-163415151 CGCCGCCGGAGAGGAGGGAGGGG - Exonic
1018890106 6:167976993-167977015 CGATGCCGGCGGGGAGCGGGCGG + Intergenic
1020238529 7:6374708-6374730 CGCCGCCGCGGCCCAGCGAGCGG + Exonic
1020281679 7:6653246-6653268 GGCCGCGGCCGAGGAGAGAGAGG + Exonic
1021231099 7:18086896-18086918 CGCCGCCGCCGCCGCGCGGGGGG - Intergenic
1021600256 7:22357124-22357146 CGCCTTCGCCAGGAAGCGAGAGG + Intronic
1026765107 7:73155205-73155227 CGCCGCGGACGGGGCGCGGGCGG + Intergenic
1027041580 7:74964960-74964982 CGCCGCGGACGGGGCGCGGGCGG + Exonic
1027082062 7:75237409-75237431 CGCCGCGGACGGGGCGCGGGCGG - Intergenic
1027238014 7:76309687-76309709 CGCCGGCCCCGGGCAGTGAGGGG - Intergenic
1029270610 7:99374854-99374876 GGGCGCCGCCTGGGAGTGAGCGG + Intronic
1029506499 7:100966549-100966571 CGCCGAGGCCGGTGAGCGTGCGG + Exonic
1029832925 7:103280056-103280078 CTCCCCCGCCCGGGAGCGGGAGG - Intergenic
1030102128 7:105956016-105956038 CGCCGGCTCCGGGCAGTGAGCGG - Intronic
1031361906 7:120857673-120857695 CGCCCCCGGCAGGGCGCGAGGGG + Intronic
1032174351 7:129611689-129611711 CGCCGCCGCCGAGGAGGGGGAGG - Intergenic
1033099926 7:138460925-138460947 CGCGGCCGCTGGGGAGCCCGGGG + Intronic
1033589477 7:142797533-142797555 CTCCGACTCCGGGGACCGAGGGG - Intergenic
1033654374 7:143362821-143362843 CGCCGCGGCCGGGGAGGGGGCGG + Intergenic
1035705961 8:1675194-1675216 GGCCGCCGCCGTGGATCCAGGGG - Intronic
1040039147 8:42897920-42897942 CGGCGCGGCCGGGGAGGGGGAGG + Intronic
1040065599 8:43141303-43141325 CGCCGCCGCCTGGGAGGGGCCGG + Intronic
1041244768 8:55879866-55879888 CGCCACGGCCGGGGAGCGAGCGG - Exonic
1042722987 8:71844243-71844265 CGCCTCCGCCAGGGAGCGGAAGG - Exonic
1043502807 8:80873844-80873866 CGCCGCCGCCGCGCAGCGCCGGG - Intronic
1043502962 8:80874332-80874354 CGCCGCCGCCCGGGAGCCGCGGG + Intronic
1044088486 8:87971268-87971290 CGCCGGCCCCGGGCAGTGAGAGG + Intergenic
1044719853 8:95134300-95134322 CGCCGCCGCCGCGGGGGGACGGG + Intronic
1044862157 8:96534060-96534082 CGCCGGCCCCGGGCAGTGAGGGG - Intronic
1045305180 8:100951815-100951837 CGCCGCCACCGCGGGGCGAGTGG + Intronic
1045674067 8:104588986-104589008 CGCCGCCGCCGCCGAGCCACCGG + Exonic
1049585387 8:143430479-143430501 CGCCGCCCGCGGGGAGCAGGGGG - Intergenic
1049675910 8:143888937-143888959 AGCAGACGCCGGGGAGGGAGAGG + Intergenic
1052362165 9:27573224-27573246 CGCCGCCGCCGGGAAGCCCGGGG + Intronic
1053153468 9:35757214-35757236 CCCCGCCGCCGGAGGGAGAGGGG + Exonic
1053493251 9:38527300-38527322 GGCCGCCACTGGGAAGCGAGAGG - Intergenic
1056475341 9:86947029-86947051 CGCCACCACCGGGGGCCGAGCGG - Exonic
1057673939 9:97121878-97121900 GGCCGCCACTGGGAAGCGAGAGG - Intergenic
1057726912 9:97574328-97574350 CGCCGGCTCCGGGCAGTGAGGGG + Intronic
1057921911 9:99104909-99104931 CCCAGCCCCCGGGGAGCGTGGGG + Intronic
1059234491 9:112750680-112750702 CGCGGCCGCCCGGGAGGGGGCGG - Intergenic
1060952328 9:127612206-127612228 CCCCGCCGCCGGCGCGCGCGGGG - Intergenic
1060979819 9:127785681-127785703 CGCCTCCGCCGGGCTGCGCGGGG - Intronic
1061666585 9:132163584-132163606 CGCCCCTGCCGAGGAGGGAGAGG + Intronic
1061727579 9:132589932-132589954 CGCCCCCGCCAGGGAGAGAAGGG + Exonic
1061896345 9:133650220-133650242 GGCCGCTGCTTGGGAGCGAGAGG + Intronic
1062105762 9:134753940-134753962 CGCTGCCGCCGGAGAACGGGAGG - Intronic
1062537793 9:137028426-137028448 CGCCGCCGCCGGGAAGCCTCCGG + Intronic
1185761300 X:2691417-2691439 CGCCGCCCCGGGTGAGCGAGCGG + Exonic
1197754026 X:129982732-129982754 CGCCGCCGCCGCCGAGAGAGAGG + Intronic
1199445097 X:147912023-147912045 CGCCGCTGCCAGGGGGCGTGCGG + Intronic