ID: 904183905

View in Genome Browser
Species Human (GRCh38)
Location 1:28687706-28687728
Sequence CACTGCTACTGCCTTAATTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 354
Summary {0: 2, 1: 2, 2: 6, 3: 60, 4: 284}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904183905_904183910 -4 Left 904183905 1:28687706-28687728 CCTGAATTAAGGCAGTAGCAGTG 0: 2
1: 2
2: 6
3: 60
4: 284
Right 904183910 1:28687725-28687747 AGTGGAGATAGAGACAGGGAGGG 0: 1
1: 0
2: 5
3: 112
4: 1118
904183905_904183907 -9 Left 904183905 1:28687706-28687728 CCTGAATTAAGGCAGTAGCAGTG 0: 2
1: 2
2: 6
3: 60
4: 284
Right 904183907 1:28687720-28687742 GTAGCAGTGGAGATAGAGACAGG 0: 1
1: 0
2: 2
3: 44
4: 293
904183905_904183912 3 Left 904183905 1:28687706-28687728 CCTGAATTAAGGCAGTAGCAGTG 0: 2
1: 2
2: 6
3: 60
4: 284
Right 904183912 1:28687732-28687754 ATAGAGACAGGGAGGGAGGATGG 0: 1
1: 1
2: 164
3: 1738
4: 9931
904183905_904183911 -1 Left 904183905 1:28687706-28687728 CCTGAATTAAGGCAGTAGCAGTG 0: 2
1: 2
2: 6
3: 60
4: 284
Right 904183911 1:28687728-28687750 GGAGATAGAGACAGGGAGGGAGG 0: 1
1: 2
2: 71
3: 1043
4: 5392
904183905_904183909 -5 Left 904183905 1:28687706-28687728 CCTGAATTAAGGCAGTAGCAGTG 0: 2
1: 2
2: 6
3: 60
4: 284
Right 904183909 1:28687724-28687746 CAGTGGAGATAGAGACAGGGAGG 0: 1
1: 0
2: 1
3: 56
4: 548
904183905_904183908 -8 Left 904183905 1:28687706-28687728 CCTGAATTAAGGCAGTAGCAGTG 0: 2
1: 2
2: 6
3: 60
4: 284
Right 904183908 1:28687721-28687743 TAGCAGTGGAGATAGAGACAGGG 0: 1
1: 0
2: 4
3: 38
4: 369

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904183905 Original CRISPR CACTGCTACTGCCTTAATTC AGG (reversed) Intronic
901668054 1:10837619-10837641 CACTGCTACTGTCCTGCTTCTGG + Intergenic
903002430 1:20275805-20275827 CACTGCCACTGCCTTGGCTCAGG - Intergenic
903009869 1:20322068-20322090 CACTGCTACTGCCCGTGTTCAGG - Intronic
903073075 1:20737724-20737746 CACTCCTGCTGCTTTATTTCCGG + Intergenic
904183905 1:28687706-28687728 CACTGCTACTGCCTTAATTCAGG - Intronic
904700625 1:32355835-32355857 CACTGCCACTGCCCTGAGTCAGG - Intronic
904880097 1:33689994-33690016 CACTGCCACTGCCTGACTTCTGG + Intronic
905353475 1:37364013-37364035 CACTTCTCCAGCCTTAAGTCTGG - Intergenic
905455795 1:38087173-38087195 CACTGCCCCTGCCCTAATCCAGG - Intergenic
906280225 1:44548174-44548196 CCCTGCTACTGACTTAGTTCAGG + Intronic
906550660 1:46663821-46663843 TACTGTAACTACCTTAATTCAGG + Intronic
906750733 1:48257442-48257464 CACGGCTACTGTCCTAATTCAGG - Intergenic
907085296 1:51666980-51667002 CTCTGCTACTTCTGTAATTCAGG - Intronic
909579486 1:77218378-77218400 CAGTTCCACTGACTTAATTCAGG - Intronic
909997146 1:82294735-82294757 CACAGCCCCTGCCTTAGTTCAGG + Intergenic
910382317 1:86641511-86641533 CACTGCCACTGCCTTTATTTGGG - Intergenic
911293711 1:96087958-96087980 TGCAGCTACTGCCTTAATTCAGG + Intergenic
911708092 1:101038672-101038694 CACTGCTCAAGCTTTAATTCTGG + Intergenic
912067806 1:105766900-105766922 CACTACAACTGCCTTAGGTCAGG + Intergenic
912158230 1:106948731-106948753 CAGTGCCACTGCCTTAGTTCAGG - Intergenic
912913018 1:113781826-113781848 CAGTACCACTGCCTTAATTCAGG + Intronic
912936988 1:114012295-114012317 CACAGCCACTGCCTTAGTTCAGG + Intergenic
912963081 1:114213397-114213419 TGCTGCCACTGCCTTAATTCAGG - Intergenic
913268246 1:117066340-117066362 CACTGCTGCTACTTCAATTCAGG - Intronic
915300566 1:154949102-154949124 CACTGTACCTGCCTTAGTTCAGG + Intronic
916428792 1:164707899-164707921 CAATGCTCTTGCCTTAATGCAGG - Intronic
916533577 1:165681394-165681416 CAAAGCTAGTGACTTAATTCTGG + Intronic
917271489 1:173279771-173279793 CAGTGCTACTACCTTTTTTCAGG + Intergenic
917371032 1:174294688-174294710 CACTGCCACTGCCTTTCTTGAGG - Intronic
917675802 1:177318221-177318243 CACAGTAACTGGCTTAATTCAGG + Intergenic
917726161 1:177829250-177829272 CTCTGCTTCTGCTTTAATTTAGG - Intergenic
920114358 1:203609578-203609600 CAGGGCTTGTGCCTTAATTCTGG - Intergenic
920868668 1:209774859-209774881 TACTGCTGCTTCCTTAGTTCAGG - Intronic
921220150 1:212967916-212967938 CACTGGCACTGTCTTAGTTCAGG - Intronic
921811229 1:219516684-219516706 CACTGCTGCTACCATAATTGAGG + Intergenic
922212308 1:223495582-223495604 TACAGCCACTGCCTAAATTCAGG + Intergenic
924666517 1:246078704-246078726 CACTGCCAGTCCCTTAATTGAGG - Intronic
1064593781 10:16922362-16922384 TACTGCCATTGCCTTAGTTCAGG + Intronic
1065578984 10:27152793-27152815 CACTGCAACAGCTTTAATTGGGG + Intronic
1066048195 10:31612658-31612680 CACTGCTACTCCTCTGATTCTGG - Intergenic
1068698426 10:59994341-59994363 CACTGCTACTATCATAACTCTGG - Intergenic
1069939895 10:71948197-71948219 CAATGCTGCAGCCTTATTTCTGG - Intergenic
1069968429 10:72142699-72142721 CATTGCTACTGCTCTAGTTCAGG + Intronic
1071438289 10:85666987-85667009 CAGTGCTACTGCCCTAGTTTAGG + Intronic
1072061984 10:91822048-91822070 TACTGCCACTGCCTTAGTTTGGG - Intronic
1072483415 10:95831018-95831040 CACAGACAATGCCTTAATTCTGG - Intronic
1073547410 10:104362661-104362683 CAGTGCTACTGCCTTGGTTCAGG + Intronic
1074844772 10:117388036-117388058 TACTGCCACTGCCTTAATCTGGG - Intergenic
1074932305 10:118141064-118141086 CTCTACTGCTGTCTTAATTCAGG + Intergenic
1075320716 10:121489794-121489816 CACTGCTAATGCCTTAGTCCAGG + Intronic
1075399650 10:122151751-122151773 CACGGCCACTGCTTTAGTTCAGG - Intronic
1077916288 11:6613569-6613591 CACTGCTACTACCTTAGTTTAGG - Exonic
1078417048 11:11174440-11174462 CACTGGTGCAGCCTTAAATCAGG - Intergenic
1078562268 11:12383367-12383389 CAGTGCTGCTGGCCTAATTCGGG - Intronic
1078817402 11:14839681-14839703 CACTTCTATTGTCTTAGTTCTGG + Intronic
1080125829 11:28732672-28732694 TACTACGACTGCCTTAGTTCAGG + Intergenic
1080351749 11:31393018-31393040 ATCTGCTAGTGCCTTGATTCAGG + Intronic
1080591014 11:33723205-33723227 CACTGCCACCTCCTTATTTCAGG - Intronic
1081078809 11:38713058-38713080 CATTGCTACTGATTTAATTGAGG + Intergenic
1081099609 11:38986172-38986194 CACTGCTACTGCCATCTCTCAGG - Intergenic
1082623586 11:55455703-55455725 GACTGCTTCTCCCTTTATTCTGG + Intergenic
1083952172 11:65962776-65962798 CACTGCTGCTGCCTTGGTGCAGG - Intronic
1085063821 11:73473693-73473715 CACAGCTCCTCACTTAATTCAGG + Intronic
1086453574 11:86940449-86940471 CTCTGCTACCACCTTCATTCAGG + Intronic
1086670881 11:89546141-89546163 CACTGTCACTGCCTTAGTTCAGG + Intergenic
1087117464 11:94541095-94541117 CACAGCTACTGTCTCAGTTCAGG + Intergenic
1087551848 11:99660561-99660583 CCCTGTTACTACCCTAATTCAGG - Intronic
1087620932 11:100540876-100540898 CACTGCCACTGTATTAGTTCAGG + Intergenic
1087974588 11:104529310-104529332 CACTCCTACTGCCTTGGTTCAGG + Intergenic
1088047736 11:105473847-105473869 CTATGCTACTGCACTAATTCAGG - Intergenic
1088161651 11:106878861-106878883 CTCTGCCAATTCCTTAATTCTGG + Intronic
1088479526 11:110281766-110281788 TACTATTACTGCCTTAGTTCAGG + Intronic
1090516937 11:127438726-127438748 CACTGCTATCGCCCTAAGTCAGG + Intergenic
1090994959 11:131857719-131857741 CATTGCTAAAGCCTTAATCCTGG + Intronic
1091042589 11:132295930-132295952 CATTGTTACTGTCTTAATTCAGG - Intronic
1092489013 12:8927800-8927822 TACTGCTCCTGCCTGAATTCAGG + Intronic
1092945359 12:13449382-13449404 CATTGCTGCTGCCCTAATTCAGG + Intergenic
1093543668 12:20319522-20319544 CACTGCCACGGCTTTAATCCAGG + Intergenic
1093902336 12:24650311-24650333 CATTGCTGCTGCCTTAATTCAGG - Intergenic
1094356301 12:29581677-29581699 CACTGTTAGTACCTTTATTCAGG + Intronic
1094767564 12:33614888-33614910 CACTTCTACTGGTTAAATTCAGG + Intergenic
1094774628 12:33710735-33710757 CACCACCACTGCCTTAGTTCAGG - Intergenic
1097115757 12:56695708-56695730 TACTGCCACTGCTTTAGTTCTGG - Intergenic
1097278259 12:57827651-57827673 CACTGCTTCTGTCTTAAGCCTGG + Intronic
1097385591 12:58946842-58946864 CAATGCTCCTACCTTAAATCAGG - Intergenic
1097989219 12:65817643-65817665 CACTGTCACTGCCTTAGTTAGGG - Intergenic
1099051718 12:77789089-77789111 AATTGCTTCTGCCTTAGTTCAGG + Intergenic
1099300585 12:80889919-80889941 CACTGCCATTGCATTATTTCAGG + Intronic
1099424384 12:82504352-82504374 CACTGCTACTGTCTAAGCTCAGG + Intergenic
1099888102 12:88556472-88556494 CACTGCCACTGCCCTAGTTAAGG - Intronic
1100454575 12:94740112-94740134 CACTGCTGTGGCCTTAATTCAGG - Intergenic
1100543411 12:95579217-95579239 CCCTGCCACTACCTTAATTCAGG - Intergenic
1100866830 12:98866290-98866312 CACTGCTACTACCTCAATCTAGG + Intronic
1100929331 12:99587599-99587621 CATTGCTACTACCCTAATTTAGG - Intronic
1101134677 12:101730201-101730223 CACTGCTACTACCCTAGTTTAGG - Intronic
1101538457 12:105642296-105642318 TTCTGCTACTGCCTTCATTATGG - Intergenic
1101722145 12:107359440-107359462 CACTGCTGCTGGGTAAATTCAGG + Intronic
1101798741 12:108002090-108002112 CACTGATACTGCCCTGATCCAGG + Intergenic
1105205344 13:18218600-18218622 CACTGCTACTGCATTTATCATGG - Intergenic
1106677972 13:31981864-31981886 CACTGCTACTGACCTGGTTCAGG + Intergenic
1106851312 13:33795718-33795740 CCCTGCTAATGCCTTGATTTTGG + Intergenic
1106993242 13:35449355-35449377 GACTGCCACTGCCCTAGTTCAGG - Intronic
1107004511 13:35593178-35593200 ATCTCCTACTGCCTTAATTTGGG + Intronic
1107010917 13:35670191-35670213 CACTGCCACTGACTGAACTCAGG - Intronic
1107330481 13:39294903-39294925 CCCTGCTGCTGCCTTAATTTTGG - Intergenic
1107519797 13:41168241-41168263 CACTGTGACTATCTTAATTCAGG - Intergenic
1109014415 13:56991440-56991462 ATCTGCTACTTCCTTAATCCTGG - Intergenic
1109175562 13:59151160-59151182 CATTGCTACTGCTCTAATTATGG - Intergenic
1110800729 13:79691641-79691663 TATTACTACTGCCTTAATTTGGG - Intergenic
1112686890 13:101839447-101839469 CAGTGCTCCTGGCTTAATACAGG + Intronic
1114644574 14:24247735-24247757 TACTGCTTCTACCCTAATTCAGG + Intergenic
1114799939 14:25762052-25762074 CACTGCTTCTTCTTTAATTCAGG + Intergenic
1115160161 14:30384795-30384817 CAATGTCACTGTCTTAATTCAGG - Intergenic
1115388162 14:32821884-32821906 CACTCTCACTGCCTGAATTCTGG - Exonic
1117046986 14:51823077-51823099 TACTGCAACTGCATTCATTCTGG + Intergenic
1118665021 14:68059184-68059206 CACTGCCACTGCCCTAATTCTGG + Intronic
1118851086 14:69584052-69584074 CACTGCTGCTGCCTTAGTTCAGG - Intergenic
1119660334 14:76446819-76446841 CACTCCTCTTGCCTAAATTCAGG - Intronic
1121141519 14:91546666-91546688 ATCTGCTAGTGCCTTAATTTTGG + Intergenic
1124792247 15:32739434-32739456 TAGGGCTGCTGCCTTAATTCAGG - Exonic
1126034552 15:44534916-44534938 CATTGCCATTGCCTTAATTTAGG + Intergenic
1127418472 15:58780833-58780855 TACTGCTACTACCCTAGTTCAGG + Intronic
1127473356 15:59309998-59310020 CACAGCCACTGCCTTACTTAAGG + Intronic
1129380622 15:75163270-75163292 CTCTGCTACTGCCTTGCTTTGGG + Intergenic
1129611098 15:77058101-77058123 CAGTGCTTCTGTCTTAATTTGGG + Intronic
1130059046 15:80556469-80556491 CACTGCTCCTGCCCATATTCTGG - Intronic
1130352104 15:83101879-83101901 CACTGCCATTGCCTTGGTTCAGG + Intergenic
1131533720 15:93216317-93216339 CACTGCTACTCCTCTAGTTCAGG + Intergenic
1134273947 16:12759210-12759232 GACTGCTTCTGCTTTAAATCTGG - Intronic
1135788237 16:25369591-25369613 CATTCATACTCCCTTAATTCTGG - Intergenic
1136481428 16:30544468-30544490 CACTGCTAGTGCTTTAAGGCAGG + Intronic
1137717890 16:50610268-50610290 CACTCCTACTGCCTTATTTACGG - Intronic
1137801408 16:51265520-51265542 CCCTGCTAATACCTTAATTTTGG - Intergenic
1139810586 16:69613225-69613247 CACTGCCACTGCCTTGGTTCAGG + Intronic
1141243338 16:82283551-82283573 CACTTCTCCTCCCTTAATTCAGG - Intergenic
1141627414 16:85268630-85268652 CACTGCTGCTGCCATGATCCCGG + Intergenic
1142495985 17:306570-306592 GGCTGCTCCTGCCTTAATTCAGG + Intronic
1143013486 17:3879251-3879273 TGCTGCCACTGCCTTAATCCAGG + Intronic
1143485863 17:7253405-7253427 TACTGCCACTGCCTTAAACCAGG - Intronic
1143502343 17:7346874-7346896 CATTGCTTCTGCCTTCAGTCAGG + Exonic
1144322732 17:14145822-14145844 CAGTGCCACTTCCTTAATTCAGG - Intronic
1146010628 17:29191639-29191661 CACTGCCATCGCCTCAATTCAGG + Intergenic
1147712506 17:42479474-42479496 CACTGGTACTCCCTGAAATCAGG - Intronic
1151175047 17:72281206-72281228 CACTGCTGTTGCCTTAGTTGAGG + Intergenic
1152365615 17:79854682-79854704 CACTGCTCCTGCCTTCCTTCTGG - Intergenic
1158264990 18:55651958-55651980 CACTGCTATAGCCTTAAGACTGG + Intronic
1158324771 18:56302209-56302231 CATTGCTACTGCCATGATTTTGG + Intergenic
1158382593 18:56950353-56950375 CAGTGCCCCTGCCTTGATTCGGG + Intronic
1162794623 19:13080093-13080115 CACTAGCCCTGCCTTAATTCAGG - Intronic
1162856603 19:13473444-13473466 CACTGCTGATGCCTTGATTTTGG + Intronic
1162888828 19:13717234-13717256 AACTGCTAATGCTTTAGTTCAGG - Intergenic
1163195733 19:15718225-15718247 CAATGCTTCTTCCTTAACTCTGG - Intergenic
1164717688 19:30405417-30405439 CACTGCTACTTCCTGAACTTGGG + Intronic
1168470753 19:56638778-56638800 CATTGCCACTGCCTTACTCCAGG + Intergenic
926095381 2:10078221-10078243 CACCGCCACTGCCTTGGTTCAGG + Intronic
929029125 2:37634623-37634645 CACTGCCACTGACTCCATTCAGG - Intergenic
929532137 2:42759990-42760012 CTCTGCTGCTGCCTTTCTTCAGG + Intergenic
930306390 2:49679921-49679943 CTCTACTTCTACCTTAATTCAGG - Intergenic
932707650 2:74038978-74039000 GTCTGCTAGTGCCTTAGTTCAGG + Intronic
933306452 2:80605896-80605918 CATTGCTATTGCCTAATTTCAGG + Intronic
934760086 2:96850261-96850283 CAATTCCACTGCCTTAATTCAGG + Intronic
936479752 2:112875393-112875415 CACCACTACTGCCTTATCTCAGG - Intergenic
937540620 2:122947891-122947913 CATGGCTAATTCCTTAATTCAGG - Intergenic
937713051 2:124999632-124999654 CACTGCTATTGTCTTACTTATGG - Intergenic
940277916 2:151958673-151958695 CACTACTGCTGCCCTAGTTCAGG + Intronic
941394884 2:164962183-164962205 CTCTGCTATTGCCTTGATTTGGG - Intergenic
941475880 2:165951626-165951648 TAATGCTACTGCCTTGGTTCAGG + Intronic
941596914 2:167488419-167488441 CACTGCCATTGTATTAATTCTGG + Intergenic
942111020 2:172682834-172682856 CACTGCTAATGCCTTTTTCCAGG - Intergenic
942395051 2:175538142-175538164 TACTGCTATTGCCTTAGTTCTGG + Intergenic
943010279 2:182439636-182439658 CACAGAAACTGCCTTAATTAAGG - Intronic
943041130 2:182806896-182806918 CACTGATACTGTCTTTATTCAGG + Intergenic
943086768 2:183321832-183321854 CATTGCAACTGCCTTAATTTAGG + Intergenic
944455903 2:199893825-199893847 CTCTGTTACTGCCATAGTTCAGG + Intergenic
944951484 2:204755182-204755204 CTCTGCTAGTGCCATAATTTAGG + Intronic
946505770 2:220299143-220299165 CACTGCTGCTGCCTTAGGTCAGG - Intergenic
946694035 2:222333877-222333899 CACTGCTACTGCCATCACCCAGG + Intergenic
946716019 2:222556250-222556272 CACTGATATTGCCTTAATTTTGG - Intronic
947764227 2:232625802-232625824 TGATGCCACTGCCTTAATTCAGG - Intronic
948884755 2:240877102-240877124 CACTGCTCCTGCCTCAGCTCTGG - Intronic
1169624701 20:7551913-7551935 CATTGCTACTGCTATAATTGAGG + Intergenic
1169955395 20:11097379-11097401 CAAAGCTACTGCAATAATTCTGG + Intergenic
1170895976 20:20414704-20414726 GTCTCCTACTGCCTTAATTTAGG - Intronic
1172014331 20:31863925-31863947 CACTGCTGCCGCCTTAATGGGGG - Exonic
1178226308 21:30723402-30723424 TACTGCAACAGGCTTAATTCTGG + Intergenic
1180760630 22:18200117-18200139 CACTGCTACTGCATTTATCATGG + Intergenic
1180770944 22:18384414-18384436 CACTGCTACTGCATTTATCATGG + Intergenic
1180775038 22:18424579-18424601 CACTGCTACTGCATTTATCATGG - Intergenic
1180808112 22:18735634-18735656 CACTGCTACTGCATTTATCATGG - Intergenic
1180828886 22:18887374-18887396 CACTGCTACTGCATTTATCATGG + Intergenic
1181071036 22:20340599-20340621 CACTGCTACTGCATTTATCATGG - Intergenic
1181194108 22:21169548-21169570 CACTGCTACTGCATTTATCATGG - Intergenic
1181215334 22:21323230-21323252 CACTGCTACTGCATTTATCATGG + Intergenic
1181257455 22:21573010-21573032 CACTCCCACTGCCTCAGTTCAGG + Intronic
1181699485 22:24612090-24612112 CACTGCTCCTGGCCTAATTATGG + Intronic
1182668409 22:31975447-31975469 CACTGCTATTGCCCTAGTCCAGG - Intergenic
1184261307 22:43318362-43318384 CACTGCTACTGGCTAACTTTTGG - Intronic
1203232779 22_KI270731v1_random:125586-125608 CACTGCTACTGCATTTATCATGG + Intergenic
1203278976 22_KI270734v1_random:113362-113384 CACTGCTACTGCATTTATCATGG + Intergenic
949503242 3:4702309-4702331 GACTGCTACTTCTTTATTTCTGG - Intronic
950108013 3:10400553-10400575 CACTGCTGCAGCCTTAGTGCCGG + Intronic
950983585 3:17335356-17335378 CATTGCTACTTCCATAATGCTGG + Intronic
952543574 3:34395221-34395243 CACTGCTGCTGCCATTATCCAGG - Intergenic
953664643 3:44917190-44917212 CGGTGCTACTGTCTTAACTCTGG + Intronic
954872375 3:53777484-53777506 CACTTCTGCTGCCTTCGTTCTGG - Intronic
955431613 3:58851340-58851362 CACTGCCATTGCCTTAATTCAGG - Intronic
955873132 3:63460907-63460929 GCCTGCTAGTGCCTTAGTTCAGG - Intronic
957531488 3:81445981-81446003 CACTTCTACCGCCTTAGTTTAGG - Intergenic
959088332 3:101875366-101875388 CAGTATTCCTGCCTTAATTCAGG + Intergenic
959622357 3:108412002-108412024 GACTCCTACTGCCTTAAGTCAGG - Intronic
960050707 3:113236780-113236802 CATTGCCACTGCATTAAATCAGG + Intronic
960682662 3:120265228-120265250 CACTACTACTGCCTTATATTTGG + Intronic
961618836 3:128207064-128207086 TACTTCTACTGCTATAATTCAGG + Intronic
962729376 3:138265880-138265902 CACTCCTACTGCTTTATTCCAGG - Intronic
964434708 3:156639393-156639415 CACTTCTACTGCTGTGATTCTGG + Intergenic
964448465 3:156785815-156785837 CAGTGCTACTGCCTTTGTTTTGG + Intergenic
965253981 3:166380106-166380128 CACTGCTATTGCAATAATTCTGG - Intergenic
965373383 3:167891853-167891875 AACTGGTAATGCCTTACTTCTGG - Intergenic
966433936 3:179862040-179862062 CCCTGCTAATGCCTTGATTTTGG - Intronic
966857663 3:184206500-184206522 TTCTGCTACTGCCTAATTTCAGG + Intronic
967075747 3:186000272-186000294 TACTGCTACTACCTTAGTTCAGG + Intergenic
967182313 3:186916637-186916659 CACTGATAGTGCCTAAATGCTGG - Intergenic
967247002 3:187498030-187498052 CACTGCCACTGCCTTAGGTGAGG + Intergenic
969981576 4:11162036-11162058 CACTGCTATTACCTGAGTTCAGG + Intergenic
970968378 4:21952951-21952973 TACTGTTACTGCCTGAGTTCTGG - Intergenic
971189781 4:24416454-24416476 CACTGCCTATGCCCTAATTCTGG - Intergenic
971652885 4:29302311-29302333 CCCTGCCAGTGCCTTAGTTCAGG + Intergenic
972466189 4:39359201-39359223 CACTGCCACTGCCTTGATTCAGG + Intronic
973599924 4:52531933-52531955 CCCTGCCACTGCCTTGGTTCTGG + Intergenic
973964428 4:56147075-56147097 CACCGCTACTGGCCTAAGTCAGG - Intergenic
974623895 4:64397615-64397637 ATCTGCTGGTGCCTTAATTCTGG + Intronic
975113917 4:70658200-70658222 CATTATTACTGCCTTAATTCAGG + Intronic
975604608 4:76141606-76141628 AACTGTCACTGCCTTAATTCAGG + Intronic
975703126 4:77085756-77085778 CACTGCTCCTGGCTTGATTGTGG - Intergenic
975886430 4:78971630-78971652 CAGTTCTTCTGCCTTATTTCTGG + Intergenic
976368221 4:84255190-84255212 CACTGCTGGTGCCTTAATCAAGG + Intergenic
977313133 4:95411857-95411879 CACTGCTACTGTCTTCGTTAAGG + Intronic
977371721 4:96145476-96145498 CACTGCCCCTGCCTTAGTTCAGG + Intergenic
977616294 4:99090250-99090272 CACTGCTGCTGTATTAGTTCAGG + Intergenic
978173505 4:105702627-105702649 CTCTTCCACTGCCTTAATCCAGG + Intronic
978173885 4:105706828-105706850 CACTGCTACTACTGAAATTCAGG + Intronic
978341142 4:107721801-107721823 CACTGCTACTGTCTTAAATTAGG + Intergenic
980135269 4:128852747-128852769 CACTGCCACCACCTCAATTCTGG - Intronic
980542907 4:134217525-134217547 CATTGCTACTGCCTTAATTCAGG - Intergenic
980947507 4:139337079-139337101 AACAGCAACTGCCTTCATTCAGG + Intronic
981140868 4:141267488-141267510 CACCGCCATTGCCTTAGTTCAGG + Intergenic
981451862 4:144907430-144907452 CACTTCTACAGCTTTACTTCAGG + Intergenic
982187581 4:152818592-152818614 TACTGTTCCTCCCTTAATTCTGG - Intronic
982793815 4:159622103-159622125 CACTGCCACTGTCTTTGTTCAGG + Intergenic
983911514 4:173244715-173244737 CACTGCTACTGCCTTAATTCAGG - Intronic
986211625 5:5678961-5678983 CATGGCTGCTGCCCTAATTCAGG - Intergenic
986248377 5:6031807-6031829 CGGTGCTACTGCTTCAATTCAGG - Intergenic
990874323 5:60467590-60467612 CATTTCTTCTGCCTTAATTCTGG + Intronic
991052325 5:62286579-62286601 TATTTCTACTGCCTTAATTAAGG - Intergenic
992960388 5:81952701-81952723 CACTGCTCCTGCCTTATTGGAGG - Intergenic
993189298 5:84660889-84660911 TACTTCTGTTGCCTTAATTCAGG + Intergenic
996063167 5:119053762-119053784 CACTGAATCTGCCTTAATCCTGG + Intronic
998225930 5:140326206-140326228 CTCTGCTACCACCCTAATTCTGG + Intergenic
998606667 5:143642451-143642473 TATTGCCACTGCTTTAATTCAGG + Intergenic
999756513 5:154668609-154668631 CTCTGCTACCACCTTAATTTTGG - Intergenic
1001735420 5:173994543-173994565 CGCTGCCACTGCCTTAGTTCAGG - Intronic
1001798594 5:174523593-174523615 CCCAGTTGCTGCCTTAATTCTGG - Intergenic
1002558518 5:180063264-180063286 CACGGCTGCCGCCTTAGTTCAGG - Intronic
1005694387 6:28337479-28337501 TATTGCTACTGCCTTGATTCAGG - Intronic
1006560766 6:34910139-34910161 CACTGGTACTGCCTTCCTTCAGG - Intronic
1008537593 6:52518568-52518590 CTCTTCTCCTGCCTTGATTCAGG - Intronic
1008664003 6:53697876-53697898 CACTGCTACTTCCACAGTTCAGG - Intergenic
1008892214 6:56507977-56507999 CACTGTTTTTGCCTTATTTCAGG - Intronic
1009982982 6:70747536-70747558 CACTGCCATTACATTAATTCAGG - Intronic
1010286800 6:74087962-74087984 CTCTAGTACTTCCTTAATTCTGG - Intergenic
1010396310 6:75396406-75396428 CACTGCCACCGCTTTACTTCAGG - Intronic
1010434798 6:75816942-75816964 CTCTACTACTGCCTTCCTTCAGG - Intronic
1010487396 6:76432036-76432058 CAATGCAAATGCCTTAATTTGGG + Intergenic
1011165294 6:84439722-84439744 CACTGTTACTGCTTTAGTTTTGG + Intergenic
1011401989 6:86973280-86973302 CACAGCCACTGCCTTTGTTCTGG - Intronic
1012782752 6:103583584-103583606 CACTACTTCAGTCTTAATTCTGG + Intergenic
1013994687 6:116294679-116294701 CACTGGTAATGCCATGATTCAGG - Intronic
1014011489 6:116481222-116481244 CACTGCCACTGCTTTAGTTTTGG - Intergenic
1014904538 6:127010449-127010471 CACTGCTACTGCAGTAAGTCAGG - Intergenic
1016859336 6:148701128-148701150 CAATGATGCTGCCTTGATTCTGG + Intergenic
1018929064 6:168228061-168228083 TACTGCTGCTGCCACAATTCAGG - Intergenic
1024042123 7:45563997-45564019 CACCGCTGCTGCCTTCATTCAGG - Intergenic
1026439310 7:70430082-70430104 CATGGCTACTGCGTTAGTTCAGG - Intronic
1027434392 7:78149259-78149281 CACTGCTAATGCCTTCCTTAAGG - Intronic
1027672604 7:81119937-81119959 CTCTGTTGCTGCCTTAGTTCAGG - Intergenic
1028003454 7:85531288-85531310 CACTGCCAGTGCCTTGATTTTGG - Intergenic
1028270553 7:88783297-88783319 CACTTCTACTGCCTTATTTTGGG - Intronic
1028479851 7:91292795-91292817 CACTGTCACTGCCCTAGTTCAGG + Intergenic
1028981615 7:96973368-96973390 CATTGCTACTACCTTAGTTTGGG - Intergenic
1029994752 7:104996673-104996695 CACTGCCACTACTTTAATTCAGG - Intergenic
1030311283 7:108071737-108071759 CCCTGCCACTTCCCTAATTCAGG + Intronic
1031083827 7:117282867-117282889 CACTACCACTGTCTTAATCCAGG - Intronic
1032294353 7:130622368-130622390 CATTGTTACTGCCTTACTTCAGG - Intronic
1032484289 7:132272258-132272280 CATTTCTACAGCCTTAAATCAGG + Intronic
1032599131 7:133274417-133274439 CCCTGCAGCTGCCTTACTTCAGG - Intronic
1033994704 7:147331141-147331163 CACTGCCATTGCCTTATTTCAGG - Intronic
1034057524 7:148051286-148051308 AAATGCTACTGCTTTAATTTTGG - Intronic
1034156855 7:148962879-148962901 ATCTGCTGCTGCCTTGATTCAGG + Intergenic
1036524468 8:9521932-9521954 CTCTGCTGCTGCCTTAACTTCGG + Intergenic
1036993649 8:13629742-13629764 CACAGTAACTACCTTAATTCTGG - Intergenic
1037479065 8:19287375-19287397 CACTGCTTGTGCCTCAGTTCTGG + Intergenic
1038094920 8:24297693-24297715 CCCTGCTGCCTCCTTAATTCAGG - Intronic
1040578420 8:48674746-48674768 CTCTGCTTCTGCCTCACTTCTGG - Intergenic
1041716239 8:60934904-60934926 CACTGCTACCCCTTTAAATCTGG + Intergenic
1043457200 8:80424470-80424492 CATTACAACTGCCTTAATTTAGG + Intergenic
1043588163 8:81793931-81793953 ATCTACTACTGCCTGAATTCAGG + Intergenic
1044312855 8:90714236-90714258 CACTGCTACTCCCTTAGCTCAGG - Intronic
1044316060 8:90751219-90751241 CACAGCCAGTGCCTGAATTCTGG - Intronic
1044895192 8:96884301-96884323 TGCTACTACTGCCTTAATTCAGG + Intronic
1044974366 8:97649257-97649279 CACTGCCACTGCCCTACTTTAGG + Intronic
1045613059 8:103870749-103870771 CTCTTCCACTGCTTTAATTCAGG + Intronic
1045899699 8:107262362-107262384 CACTACTACTTCACTAATTCAGG + Intronic
1046781660 8:118222026-118222048 CACTGGTACTGCCATGATTCGGG - Intronic
1047226521 8:122959828-122959850 CACTTCCACTTACTTAATTCTGG + Intronic
1047715192 8:127588845-127588867 AACTGCCACTGCTTTATTTCGGG - Intergenic
1048830825 8:138475637-138475659 CGCTGCCTCTGCCTTAGTTCAGG + Intronic
1051122597 9:13768251-13768273 CACTGCTTCTGCCTTAGCTTAGG + Intergenic
1051461239 9:17318702-17318724 CATTACTACTTCCCTAATTCTGG - Intronic
1052344936 9:27399995-27400017 CACAGCCCCTGCCTTAAATCAGG + Intronic
1052427793 9:28327176-28327198 TTCTGCTGCTGCCTTAATTTTGG + Intronic
1053451650 9:38198653-38198675 CACTGTTTCTGCTTCAATTCAGG - Intergenic
1055254080 9:74345199-74345221 CACTGCTAATGCCTTGGTTTAGG - Intergenic
1055680294 9:78707620-78707642 CCCTGCTACTACCTAATTTCTGG + Intergenic
1056202852 9:84293437-84293459 CTCTGCTACTACCTGTATTCTGG + Intronic
1057891256 9:98871730-98871752 CACTGCTATTGCCTCTGTTCGGG + Intergenic
1058481297 9:105398102-105398124 CACAGCTACTGCCTAAATGATGG - Intronic
1059196770 9:112377929-112377951 TACTATTACTGCCTTAGTTCAGG + Intergenic
1059799757 9:117738298-117738320 TCCTGCCCCTGCCTTAATTCAGG + Intergenic
1060257833 9:122048036-122048058 CACTGCCTCTGCCTTACTTCAGG + Intronic
1060334085 9:122705282-122705304 CACTGCCACTGCCCTAGCTCAGG - Intergenic
1187030362 X:15480971-15480993 TACTGCCATTGCCTTAGTTCTGG - Intronic
1187211496 X:17236775-17236797 TACTGCTTCTGCCTAAATGCAGG + Intergenic
1187695186 X:21912492-21912514 CATCGCTAGTGCCTTAATTCAGG + Intergenic
1191731322 X:64338767-64338789 CACTGCTACTACCTTACCTCAGG - Intronic
1191915791 X:66200030-66200052 CACTGCTACTGCCCTGGTTCTGG - Intronic
1192474399 X:71427366-71427388 CACTTCTACTGCCAGAATTCTGG - Intronic
1195830049 X:109046934-109046956 CACTGCTACTGCCTTACTTCAGG + Intergenic
1196067916 X:111486129-111486151 CACTTCTGGTGCCATAATTCAGG + Intergenic
1196698911 X:118644979-118645001 CACTGTCACTGCCTTACTTCAGG - Intronic
1196789321 X:119449838-119449860 CACTGGCACTCCCATAATTCAGG - Intronic
1197106777 X:122726014-122726036 CATTGTTTCTGCCTTACTTCAGG - Intergenic
1197222729 X:123929252-123929274 CACTGCCACAACCTTATTTCAGG + Intergenic
1197886220 X:131221047-131221069 CACTGCTGCTCCCTTATTCCAGG - Intergenic
1197899616 X:131356159-131356181 TACTGTTATTGCCTTACTTCTGG + Intronic
1197922254 X:131607904-131607926 CACTGCCTCTCCCTTAACTCTGG + Intergenic
1197970509 X:132110327-132110349 CACTACCACTGTCTTAATCCAGG - Intronic
1198443843 X:136691684-136691706 TGCTGCCACTGCCTTAGTTCAGG + Intronic
1198560036 X:137839663-137839685 CACTGATATTGCCTTCATTTTGG - Intergenic
1198835320 X:140798710-140798732 CACTGAAACTGCCTTAATCTTGG - Intergenic
1199049416 X:143219658-143219680 CCTTTCTACTGCCATAATTCTGG - Intergenic
1199328040 X:146524565-146524587 CACTGCTACTGCCTCAATACAGG + Intergenic
1199600483 X:149538798-149538820 CGCTGCTACTTCCAGAATTCAGG - Intergenic
1199650105 X:149941143-149941165 CGCTGCTACTTCCAGAATTCAGG + Intergenic
1199661717 X:150057488-150057510 CACTGCTACTGCTATGATTCAGG - Intergenic