ID: 904187007

View in Genome Browser
Species Human (GRCh38)
Location 1:28713324-28713346
Sequence CTTATCAGGTACTAAGTAAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 112}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904187007 Original CRISPR CTTATCAGGTACTAAGTAAT AGG Intronic
904187007 1:28713324-28713346 CTTATCAGGTACTAAGTAATAGG + Intronic
905590149 1:39156307-39156329 CTTATAAAATACTAAGTCATAGG - Intronic
906836107 1:49084857-49084879 CTTATCAGCAATTAAGTGATGGG + Intronic
908276971 1:62483399-62483421 ATTATCAGGTGCTCAGTTATGGG + Intronic
910097594 1:83541310-83541332 CTTATTAGGTCATAGGTAATTGG - Intergenic
910550533 1:88468941-88468963 ATTATCAGGCAATTAGTAATTGG + Intergenic
911902112 1:103519804-103519826 GTTTTAAGTTACTAAGTAATTGG + Intergenic
916429781 1:164716521-164716543 CTTATCAGGTACAGAATAAAAGG - Intronic
916866690 1:168867443-168867465 CATAGCAGGTATTCAGTAATTGG + Intergenic
919440895 1:197632575-197632597 TTTGCCAGGTACTAAGTACTGGG - Intronic
921890768 1:220351640-220351662 CTTTTCAGGTAGTAAGAAAAAGG - Intergenic
923067826 1:230536294-230536316 CTTCTCTGGTAATAAGTAAAAGG - Intergenic
1063707232 10:8442377-8442399 CTTACCAAGTACTAGGTAATAGG + Intergenic
1068941881 10:62688601-62688623 CATGTCAGTTACTAAGTTATTGG - Intergenic
1071356314 10:84799616-84799638 CTTAGCAGGACCTAAGTATTGGG - Intergenic
1071961780 10:90814315-90814337 TTTATCATGAACTAGGTAATGGG - Intronic
1073597678 10:104817238-104817260 CTTATTAGGTACTAAATAAGGGG - Intronic
1080265608 11:30398210-30398232 CTAATGAGTTACTAAGTGATAGG + Intronic
1083033142 11:59612851-59612873 CATATAAGGTTTTAAGTAATGGG + Intronic
1084584608 11:70050375-70050397 GTGACCAGGTACTAAGTAAGTGG - Intergenic
1086055963 11:82646770-82646792 TTCATCAGGTACTTGGTAATAGG + Intergenic
1087592237 11:100205026-100205048 CTTATGTGGTATTAAATAATAGG - Intronic
1100330223 12:93574071-93574093 CTTACCAGTCACTAAGAAATGGG - Intronic
1100842591 12:98628808-98628830 ATTATCAGGTACTAGGGAAATGG + Intronic
1103069072 12:117925863-117925885 CTTTTCAGAAACAAAGTAATGGG + Intronic
1120083422 14:80241345-80241367 CTTATAATGTCCTAAGCAATAGG + Intronic
1120672358 14:87377582-87377604 CTTATAAGGAACTAATTGATAGG + Intergenic
1125623192 15:41082937-41082959 TTCATCAGGTACTAAGTCATGGG + Intronic
1125780926 15:42266607-42266629 CTTATCAGGAACTAAGGCAGTGG + Intronic
1126313463 15:47342380-47342402 CTAATCAGCTAAGAAGTAATGGG + Intronic
1126740248 15:51769915-51769937 CATATCAGCTCCTAAGTAACTGG - Intronic
1127043631 15:55003224-55003246 ATTCTCAGGTACTAAGTGTTAGG - Intergenic
1139122464 16:64037072-64037094 CTTTTCATGTGCTAAGTAAATGG - Intergenic
1140620436 16:76723480-76723502 CTTACCAAATACTATGTAATTGG + Intergenic
1148627660 17:49082176-49082198 AATATCAGATACTAAATAATAGG + Intergenic
1153711587 18:7805376-7805398 CTTATAAGGCACTAAATAGTTGG - Intronic
1157386929 18:47265170-47265192 CTTATCTGGGACTAATAAATTGG - Intergenic
1164788988 19:30959972-30959994 CTTAGCAGGTAGTCAGTACTAGG - Intergenic
1167399668 19:49256392-49256414 CTTATGAGTTACTAACTTATGGG + Intergenic
926125150 2:10267510-10267532 CTTATCAGGTGCCAAGTGCTGGG + Intergenic
929007134 2:37406767-37406789 CTTATCAAGGACTCAGTAAGTGG + Intergenic
930713518 2:54571636-54571658 AGTATCAGGTACACAGTAATAGG - Intronic
933039842 2:77450337-77450359 CTCATCAGGTACAAAGTTACAGG + Intronic
936792544 2:116166315-116166337 CTTCTGTGGTAGTAAGTAATAGG + Intergenic
937563757 2:123258222-123258244 ATTATCATGTACAAAATAATAGG + Intergenic
939659530 2:144871011-144871033 CTTCTAAGGTAGTAATTAATAGG + Intergenic
940631531 2:156245645-156245667 ATTATCATGTACAAAATAATAGG + Intergenic
941588181 2:167385469-167385491 CTGAGCATGTACCAAGTAATGGG - Intergenic
941897841 2:170647725-170647747 CTTATAAGGAATTAAGTTATTGG - Intronic
942134051 2:172907849-172907871 CATATCAGGCACTTAGTAAATGG - Intronic
942223857 2:173797831-173797853 ATTATGAGGTACTAATTAAGTGG + Intergenic
943531256 2:189083883-189083905 TGTATCAGGCACTAAGTAAATGG - Intronic
1174842614 20:53914456-53914478 CTTGTGAGGCACTAAGGAATGGG - Intergenic
1174904261 20:54533555-54533577 CTTATTAAGCACTAAGTATTGGG + Intronic
1175558588 20:59895828-59895850 CCTGTCAGATACTAAGCAATTGG + Intronic
952737855 3:36707794-36707816 CTTATGAAGTGCTAAGTCATGGG - Intergenic
956919632 3:73913339-73913361 CTTATCAGCCACTAACTAAAAGG - Intergenic
966486536 3:180477156-180477178 TGCATCAGGCACTAAGTAATTGG - Intergenic
969967135 4:11008517-11008539 CTTATCAACTACTAACTAAACGG + Intergenic
970848675 4:20575034-20575056 CTTTACAAGTACTAAGCAATTGG + Intronic
975655685 4:76639199-76639221 TTTATTAGGTACTCAGTAAGTGG - Intronic
977440263 4:97057093-97057115 CTTGTTAGGGTCTAAGTAATGGG + Intergenic
977840667 4:101699798-101699820 CCTATCAGGTCCCACGTAATTGG + Intronic
977964798 4:103132822-103132844 TTCAACAAGTACTAAGTAATAGG - Exonic
979115140 4:116814375-116814397 CTTATAAGGTCCCCAGTAATTGG + Intergenic
981543644 4:145872127-145872149 GTTATTAGGTAATAAGTATTTGG - Intronic
981847424 4:149185291-149185313 GTTATCAGTTAAAAAGTAATGGG + Intergenic
982031816 4:151308683-151308705 CTTCTAAGGTACTAAATAATTGG - Intronic
983090877 4:163500510-163500532 CTTATCAAGTAATAAATAATGGG - Intronic
984460328 4:180028182-180028204 CTTATCAGGAACAAAGCGATAGG + Intergenic
988102755 5:26703642-26703664 CTTTTCATGTAGAAAGTAATAGG - Intergenic
989638442 5:43559970-43559992 CTTATTATGGACTAAGTACTGGG - Intergenic
990833912 5:59992939-59992961 CTTATCAGGTAGAAGGTAAGAGG + Intronic
996083965 5:119285114-119285136 ATTATTTGGTACTAGGTAATGGG + Intronic
997424595 5:133794627-133794649 CTTGTCAGGTTTTATGTAATAGG - Intergenic
998579519 5:143356974-143356996 CTTTCCAGGTACTAACTATTGGG - Intronic
1000461855 5:161532360-161532382 ATTATCATGTATAAAGTAATTGG - Intronic
1002513952 5:179742869-179742891 CTTATCAGGTGGTATTTAATAGG + Intronic
1006575511 6:35042477-35042499 CCTACCAGGTACTAAGCACTGGG - Intronic
1012451723 6:99359501-99359523 CTTATCAGGTACTAACAACATGG + Intergenic
1016282939 6:142439993-142440015 CTTATCAGTTATTAATGAATAGG + Intronic
1017924063 6:158895712-158895734 CTTATCTCGCACTAAGCAATGGG + Intronic
1023533748 7:41186364-41186386 CTTATCAGGGTCTAACCAATTGG - Intergenic
1024709259 7:51996513-51996535 CTGAACAGGTTCTAAGTAAGGGG - Intergenic
1027746889 7:82086834-82086856 CTCAACAGCTACTAAGTATTGGG + Intronic
1029063591 7:97825215-97825237 CTTATCAGGGACTGATTAAATGG - Intergenic
1029847186 7:103424411-103424433 CTTAGCAGGTGCTCAGTAACTGG + Intronic
1030779491 7:113581904-113581926 CTTCTAATGTACGAAGTAATGGG - Intergenic
1031269153 7:119623288-119623310 GTTATAAGATACTAAGTAGTTGG + Intergenic
1037014393 8:13884298-13884320 GTTATTAGTCACTAAGTAATTGG + Intergenic
1037488205 8:19370118-19370140 CTTATCAAGAAATCAGTAATAGG - Intronic
1038851448 8:31281285-31281307 AATATCTGCTACTAAGTAATAGG + Intergenic
1040350470 8:46561779-46561801 CTTATCAGGGACTTATTAAATGG - Intergenic
1040482670 8:47841066-47841088 CTAATCAGGTCCTAAGGAAGGGG + Intronic
1041432933 8:57804735-57804757 CAGATCAGGTAGCAAGTAATTGG + Intergenic
1042808036 8:72793169-72793191 CCTATCAGATTCTAAGTACTGGG + Intronic
1043174342 8:77005101-77005123 CATAGGAGGTACTTAGTAATTGG + Intergenic
1043852043 8:85226710-85226732 AAAATCATGTACTAAGTAATAGG - Intronic
1044271904 8:90254096-90254118 CTTTTCAGGCACTTAGTAAGAGG - Intergenic
1045921041 8:107529404-107529426 ATTATCAGGGACTAAGCTATGGG + Intergenic
1050912339 9:11087396-11087418 TTCATCAAGTACTAAGTAAAGGG - Intergenic
1051156990 9:14159263-14159285 CTTCCCAGGTTCTAAGAAATTGG + Intronic
1051189451 9:14495931-14495953 CTTCTAAGTTACTAAGTAATTGG - Intergenic
1052053376 9:23875260-23875282 ATTATCAGGTACTGAGGAAAGGG - Intergenic
1052089978 9:24316056-24316078 CTAATGATGTACTAAGCAATAGG + Intergenic
1054826000 9:69573979-69574001 CTTATTAGGTAATACGAAATTGG + Intronic
1056905087 9:90639769-90639791 CTGATAAAGAACTAAGTAATAGG + Intronic
1057410908 9:94815865-94815887 CTTTCCAGGTATTCAGTAATAGG - Intronic
1060032004 9:120222723-120222745 TTTAACAGGTGCAAAGTAATAGG - Intergenic
1186633168 X:11372932-11372954 CTTATCAGGTACAAAAAATTTGG + Intronic
1187554441 X:20338642-20338664 CATAGCAGGTACTGAGTAAATGG + Intergenic
1188646617 X:32576489-32576511 CTAGACAGGTACTGAGTAATGGG + Intronic
1189849379 X:45163826-45163848 CTTATCAGGTTCTATCTCATAGG + Intronic
1192656806 X:73002172-73002194 CTTATCAGGTACTTGGTGCTGGG - Intergenic
1192665314 X:73080829-73080851 CTTATCAGGTACTTGGTGCTGGG + Intergenic
1196376859 X:115042710-115042732 TTTATCAGGAACTAATTAAAAGG - Intergenic
1197899058 X:131348942-131348964 CTTAACAGGCACTAAGTAAAAGG + Intronic
1198384153 X:136112310-136112332 CATAGTAGGTACTCAGTAATTGG - Intergenic
1199199477 X:145070238-145070260 CTTACCAGGTACTAGATACTGGG - Intergenic
1200760352 Y:7032470-7032492 CTTATCATGTAATAATTACTGGG - Intronic