ID: 904187241

View in Genome Browser
Species Human (GRCh38)
Location 1:28715070-28715092
Sequence CACACAGACGAGCCTGGAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 234
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 215}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904187241_904187244 -10 Left 904187241 1:28715070-28715092 CCATTTCCAGGCTCGTCTGTGTG 0: 1
1: 0
2: 0
3: 18
4: 215
Right 904187244 1:28715083-28715105 CGTCTGTGTGTGTAGGCATGTGG 0: 1
1: 0
2: 6
3: 57
4: 620
904187241_904187245 26 Left 904187241 1:28715070-28715092 CCATTTCCAGGCTCGTCTGTGTG 0: 1
1: 0
2: 0
3: 18
4: 215
Right 904187245 1:28715119-28715141 AAGATGCATTGACCAAACTCTGG 0: 1
1: 0
2: 0
3: 6
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904187241 Original CRISPR CACACAGACGAGCCTGGAAA TGG (reversed) Intronic
900150511 1:1176938-1176960 GAAACAAACCAGCCTGGAAAAGG - Intronic
901337788 1:8466112-8466134 CCCACAGAAGAGTCAGGAAAGGG + Intronic
901850363 1:12011137-12011159 GACACAGCTGAACCTGGAAAGGG + Intronic
902775403 1:18671451-18671473 CAGACAGCCGAGCCTGGAAGGGG + Intronic
903815779 1:26063444-26063466 CAAAAAGACAAGCCTGGAAAGGG - Intronic
904187241 1:28715070-28715092 CACACAGACGAGCCTGGAAATGG - Intronic
907761491 1:57365950-57365972 CACACAAACCAGACTGAAAAGGG - Intronic
908441314 1:64157483-64157505 CCCTCAGAAGAGCCTGGAGAGGG - Intronic
911991372 1:104701705-104701727 CACTCAGAGAAGCCTGGAGAAGG + Intergenic
912406230 1:109440275-109440297 CACAAAGAGGAGCCGAGAAATGG - Intergenic
912508895 1:110175044-110175066 CACCCAGAAGACCCTGCAAAGGG - Intronic
913605937 1:120465968-120465990 CACGCTGTTGAGCCTGGAAAAGG - Intergenic
914082618 1:144423244-144423266 CACGCCGTAGAGCCTGGAAAAGG + Exonic
914177521 1:145291757-145291779 CACGCCGTTGAGCCTGGAAAAGG + Exonic
914269415 1:146066549-146066571 CACGCCGTTGAGCCTGGAAAAGG + Exonic
914367677 1:146994322-146994344 CACGCTGTTGAGCCTGGAAAAGG - Exonic
914485302 1:148103900-148103922 CACGCTGCTGAGCCTGGAAAAGG + Exonic
914532248 1:148533236-148533258 CACGCCGTTGAGCCTGGAAAAGG + Exonic
914585264 1:149055887-149055909 CACGCCGTTGAGCCTGGAAAAGG + Exonic
914636146 1:149554485-149554507 CACGCTGTTGAGCCTGGAAAAGG - Intergenic
915321822 1:155060657-155060679 CACACATAAGTGCCTGCAAAGGG + Intronic
915481468 1:156188796-156188818 TACACAGAAGAGCCTCAAAAGGG - Intergenic
917485782 1:175453427-175453449 CACAAAGATGAGCCCGGAGAGGG + Intronic
919737657 1:200963338-200963360 CCCACAGAGGAGACTAGAAAAGG + Intergenic
921297492 1:213718424-213718446 GACCCAGACCAGTCTGGAAAAGG - Intergenic
921995455 1:221413287-221413309 CACACACACACGCCTGGAAGTGG - Intergenic
921998374 1:221446996-221447018 AACACAGACGAGCTAGGACAGGG + Intergenic
922398039 1:225222977-225222999 TACACAGAAGAGCCTAAAAAGGG + Intronic
922583048 1:226712652-226712674 CAGACAGACGGGCCTGAACAAGG - Intronic
1063424845 10:5942779-5942801 GACAGAGGCCAGCCTGGAAATGG - Intronic
1064195813 10:13243287-13243309 GACACAGATGAGTGTGGAAAGGG + Intergenic
1069226421 10:65950877-65950899 CACACACACAAACCTGGATATGG - Intronic
1069560130 10:69423353-69423375 CCCAGAGATGAGCCTGGAGAGGG + Intergenic
1070359344 10:75672270-75672292 TACCCAGACAAGCCCGGAAAAGG + Intronic
1070426497 10:76293269-76293291 CACACAGACTAGGCTGGGCATGG - Intronic
1070933642 10:80277555-80277577 CACACACACGGCCCTGGGAAAGG + Intronic
1071759427 10:88583463-88583485 CGCCCAGAAAAGCCTGGAAATGG + Intronic
1072423333 10:95308129-95308151 CAAACAGACGAATCTGCAAAAGG - Intergenic
1074273549 10:111979070-111979092 CACACACACAAACCTGGAATCGG + Intergenic
1076820172 10:132934410-132934432 CAAACAAACCAGCCTGAAAAAGG + Intronic
1083969238 11:66063211-66063233 GACACAGCAGAGCCTGGAAAAGG + Intronic
1084565969 11:69929222-69929244 TACACAGGAGAGCCTGGAACAGG - Intergenic
1085388816 11:76171902-76171924 CCCACAGACAAGCCAGGACAGGG + Intergenic
1087499556 11:98932899-98932921 TACACAGAAGAGCCTAAAAAGGG - Intergenic
1089124009 11:116163198-116163220 CACTCACACGATCCTGGAAAAGG - Intergenic
1089968940 11:122676846-122676868 CACACAGAAGAGCCTGGGGGCGG - Intronic
1090987225 11:131779184-131779206 CACACAAATGAGCCTGGAAGAGG + Intronic
1091411229 12:240833-240855 CACAAAGACGTGCCTGGAAGGGG + Intronic
1091899754 12:4135141-4135163 CAAACAGAGGAGCAGGGAAAGGG + Intergenic
1092944559 12:13440672-13440694 AACCCAAACAAGCCTGGAAAAGG + Intergenic
1094148516 12:27256284-27256306 CACACTAAGGAGCCTGGAAGAGG - Intronic
1096116007 12:49055600-49055622 CTTACAGAGGAGCCTGGAAGTGG - Intronic
1097190073 12:57215439-57215461 CACACACACGAGTCAGGAAAAGG - Intergenic
1099909336 12:88810582-88810604 CACACAGAAGGGCCTGTCAAGGG + Intergenic
1100529001 12:95447118-95447140 CCCACAGAAGAGCCTAAAAACGG - Intergenic
1100981270 12:100164533-100164555 TACACAGAAGAGCCTAAAAAGGG - Intergenic
1100995621 12:100297584-100297606 CCCACAGATGACCCTGGAATAGG - Intronic
1103837022 12:123829696-123829718 CACACACACGGCCATGGAAATGG - Intronic
1104145617 12:126031160-126031182 TACACAGAAGAGCCTAAAAAGGG + Intergenic
1104941197 12:132396155-132396177 CCCACAGACGAGGCAGGAGATGG - Intergenic
1117784638 14:59269915-59269937 CTGAGAGACGAGCCTGGGAAAGG + Intronic
1121448708 14:93994561-93994583 CACACAGACAAGGCTGGGAGAGG - Intergenic
1121590250 14:95100863-95100885 CACACAGGCTAGCAGGGAAAAGG + Intronic
1122268634 14:100558391-100558413 CCCACAGAGGAGCCTGAGAAGGG - Intronic
1122543714 14:102511013-102511035 CACACAGAGAAGCCAGGACAGGG - Intergenic
1125540908 15:40469633-40469655 CACACAGATGAGCCAGGGGAAGG - Intergenic
1128061619 15:64739047-64739069 CCCAAAGCCGTGCCTGGAAAGGG - Intergenic
1131882004 15:96871831-96871853 CACACGGACGCGCATGAAAATGG - Intergenic
1132126471 15:99230896-99230918 AAAACAGACGACCTTGGAAATGG + Intronic
1133888124 16:9851026-9851048 AACACAGACAAGCCTGGATTTGG - Intronic
1134741353 16:16549902-16549924 CACACAGACTAGCCATGAAGCGG - Intergenic
1134926205 16:18162539-18162561 CACACAGACTAGCCATGAAGCGG + Intergenic
1136299109 16:29321299-29321321 CTCACAGAGGAGCCTGGAGCAGG - Intergenic
1145748920 17:27341408-27341430 CACAGAGACGAGCCAGGAGAGGG + Intergenic
1145925275 17:28642323-28642345 CTCACAGATTAGCCTGGGAAAGG + Exonic
1146317574 17:31820309-31820331 CACACAGGCGAGGCAGGACAGGG - Intergenic
1149990383 17:61379912-61379934 CACACACACCAGCATGGAGATGG - Intronic
1151243155 17:72773920-72773942 CCCACAGATGAGCCTGGACTGGG + Intronic
1151756166 17:76076422-76076444 CACTCAGCGGAGCCTGGAAATGG - Intronic
1152074732 17:78151928-78151950 CACAGAGACCAGTCTGGAGAGGG + Intronic
1155474885 18:26227289-26227311 CCGACAGACAAGGCTGGAAAGGG - Intronic
1155536583 18:26824969-26824991 CAAACAGACGAGCGTGAAACAGG - Intergenic
1155751101 18:29423018-29423040 TACACAGAAGAGCCTAGAAAGGG - Intergenic
1156505624 18:37589435-37589457 CACAGAGACGAGCCTGCAGCTGG + Intergenic
1157553269 18:48595844-48595866 CACACACATGAGCTTGGAAGTGG - Intronic
1158171639 18:54606547-54606569 TACACAGAAGAGCCTAAAAAGGG - Intergenic
1162746140 19:12799858-12799880 TACACAGACGAGCATGGGGAAGG - Exonic
1163533582 19:17864407-17864429 CCCACAGGTGAGGCTGGAAAAGG - Intergenic
1164258308 19:23548543-23548565 TACACAGAAGAGCCTAAAAAGGG + Intronic
1164293276 19:23886555-23886577 TACACAGAAGAGCCTTAAAAGGG - Intergenic
1164382477 19:27746729-27746751 TACACAGAAGAGCCTAAAAAGGG + Intergenic
1165028856 19:32982841-32982863 CACACAGAAGTGCCAGGAAATGG - Intronic
1166209198 19:41294847-41294869 CACACAGCTGAGCCTGGACTGGG + Intronic
1167359262 19:49021187-49021209 GACACAGACCACGCTGGAAACGG + Intergenic
929559132 2:42944965-42944987 CACAGAGAAGACCTTGGAAAGGG + Intergenic
929966607 2:46541994-46542016 CACACACACCAGCCAGAAAAAGG - Intronic
930162424 2:48171675-48171697 CACACACACAAGTCTAGAAAGGG - Intergenic
931999521 2:67871846-67871868 CACACAGACGCTACTGGTAAGGG + Intergenic
933948398 2:87308099-87308121 AACACAGGAGAGCCTGGAATAGG - Intergenic
934618937 2:95792423-95792445 ACCACAGGCTAGCCTGGAAAGGG - Intergenic
934641955 2:96032134-96032156 ACCACAGGCTAGCCTGGAAAGGG + Exonic
936331801 2:111553496-111553518 AACACAGGAGAGCCTGGAATAGG + Intergenic
937949201 2:127370788-127370810 TACACAGAAGAGCCTAAAAAGGG + Intronic
940652757 2:156453917-156453939 AAGACAGATGAGTCTGGAAAGGG + Intronic
940833404 2:158493538-158493560 CAACCAGTCCAGCCTGGAAAAGG - Intronic
941573104 2:167196025-167196047 CACACACAGCAGCCTGGGAATGG - Intronic
941843649 2:170112911-170112933 TACACAGAAGAGCCTAAAAAGGG + Intergenic
942093210 2:172513983-172514005 TACACAGAAGAGCCTAAAAAGGG + Intergenic
944993310 2:205263133-205263155 AACACAGATGAGCTTAGAAAAGG - Intronic
946189617 2:218001561-218001583 CACAGAGACGAACCTGGCCAAGG + Intronic
947872336 2:233446346-233446368 CACACAGAGGAGGCCTGAAATGG - Intronic
948045154 2:234937823-234937845 CAAACAGAATATCCTGGAAATGG - Intergenic
1169856770 20:10111528-10111550 TAAACAGACCAGCTTGGAAAGGG - Intergenic
1169923803 20:10761972-10761994 CACACGGACAAGCCTGAACAGGG + Intergenic
1170816906 20:19721341-19721363 CACACGGAGGAGGCAGGAAAGGG - Exonic
1172923576 20:38509731-38509753 CACACAGATGGGGCTGGAAGAGG - Intronic
1173861526 20:46286848-46286870 CAGACAGATGAGTCTGGAATTGG - Intronic
1173927223 20:46789782-46789804 CACAGAGCAGAGCCAGGAAAAGG - Intergenic
1174194180 20:48761403-48761425 CACACAGCAGACCCTCGAAAAGG + Intronic
1175401933 20:58705780-58705802 CACACAGCAATGCCTGGAAACGG - Intronic
1175604251 20:60299356-60299378 CACACACAAGACCCTTGAAAGGG - Intergenic
1175726582 20:61322641-61322663 CAAACAGCCTTGCCTGGAAAGGG - Intronic
1176165417 20:63670653-63670675 CAAACAGCCGAGCCGGGAGAAGG + Intronic
1176263420 20:64195300-64195322 CATGCAGATGAGTCTGGAAAAGG + Intronic
1176308048 21:5134671-5134693 CACACAGAGGAGCCAGGAGCAGG - Intronic
1177738703 21:25126339-25126361 AACAGCGATGAGCCTGGAAATGG + Intergenic
1179478953 21:41665837-41665859 CCCACATACCAGCCTGGAAGGGG - Intergenic
1179849012 21:44127361-44127383 CACACAGAGGAGCCAGGAGCAGG + Intronic
1181492793 22:23271091-23271113 GACACAGAGGATCCTGTAAATGG - Intronic
1182087221 22:27569437-27569459 CAGCCAGAAGAGCCTGGAGAGGG - Intergenic
1182732781 22:32508485-32508507 CACACAGACGCGCATGAAAGGGG + Intergenic
1183012443 22:34957987-34958009 CACACAGTCCAGCCTTGGAATGG + Intergenic
1184244775 22:43230416-43230438 CAGAAAGATGAGCCTGGAAGGGG + Intronic
952716692 3:36487036-36487058 GACACAGATGAGCCTTCAAATGG + Intronic
953834833 3:46333548-46333570 CACACAAAAGAGCCTAAAAAGGG + Intergenic
957040087 3:75329751-75329773 CAGACAGGAGAGCCTGGAAGGGG - Intergenic
957656238 3:83080724-83080746 CATAAAGACCATCCTGGAAATGG - Intergenic
961580841 3:127880773-127880795 CAAACAGAGGATGCTGGAAATGG + Intergenic
962569791 3:136701390-136701412 CACACACACGAGGATGGGAATGG - Intronic
962848950 3:139293607-139293629 TACACAGAGGACCCTGGAGAAGG - Intronic
963131426 3:141861867-141861889 CTTAAAGAAGAGCCTGGAAATGG + Intergenic
967723648 3:192841553-192841575 CTCACAGGCGAGCTTGGAAGTGG + Intronic
971422429 4:26485886-26485908 CTCACAGAGGTGCCTGGGAAAGG + Exonic
972165263 4:36276179-36276201 CAGACATACGAGTCAGGAAATGG - Intergenic
977559422 4:98517389-98517411 CACATAGCAGAGCCTGGGAAAGG + Intronic
977923937 4:102677655-102677677 CACACAGATGTACTTGGAAAAGG - Intronic
978208770 4:106110733-106110755 TACACAGAAGAGCCTAAAAAGGG + Intronic
980526548 4:133996207-133996229 TACACAGAAGAGCCTAAAAAGGG - Intergenic
986122653 5:4856308-4856330 AACACAGACGAGCTAGGAATAGG + Intergenic
986528223 5:8703900-8703922 CACACAGAGAAGCTTGTAAAGGG + Intergenic
988172789 5:27681378-27681400 CACACAGTGGGGCCTGGAGAAGG + Intergenic
994009307 5:94881589-94881611 CACACACACCAGCTTGTAAATGG - Intronic
994750623 5:103733181-103733203 CATACAGTCTATCCTGGAAAGGG + Intergenic
996175014 5:120345672-120345694 CACACAGACCAGCAAGCAAAAGG + Intergenic
996327081 5:122286967-122286989 CTCACAGAGGTCCCTGGAAAGGG - Intergenic
997294707 5:132762229-132762251 CTCATGGAGGAGCCTGGAAATGG - Intronic
997442496 5:133918744-133918766 CACAGAGATGAGCCAGGACAGGG - Intergenic
997530656 5:134579385-134579407 CACTCAGCAGAGACTGGAAATGG - Exonic
997986906 5:138508917-138508939 CACACAGACATGCCTATAAATGG - Intronic
999354732 5:150915435-150915457 TACACAGAAGAGCCTAAAAAAGG - Intergenic
999646236 5:153719533-153719555 CCCACAGAGGAGCCAGGAGAGGG - Intronic
1000136334 5:158355779-158355801 CACACATAAGATCCTGGAATAGG - Intergenic
1001056543 5:168454672-168454694 CGCACAGAGGTGCCTGGACACGG + Intronic
1002431260 5:179205493-179205515 CCCAACGACGCGCCTGGAAAAGG + Intronic
1003892514 6:10576038-10576060 CACACGGACGTGCATGAAAACGG + Intronic
1004428212 6:15520698-15520720 CACACACACGAAACTTGAAATGG + Exonic
1005129331 6:22486594-22486616 CACACAAATGAGACTTGAAAGGG - Intergenic
1005481305 6:26258027-26258049 TACACAGAAGAGCCTAAAAAAGG + Intergenic
1005527916 6:26669711-26669733 CACTCAGAAGAGTTTGGAAAAGG + Intergenic
1005542880 6:26831959-26831981 CACTCAGAAGAGTTTGGAAAAGG - Intergenic
1005854659 6:29851772-29851794 AACACAGACAGGTCTGGAAAGGG - Intergenic
1006280603 6:33050135-33050157 TACACAGAAGAGCCTAAAAAGGG + Intergenic
1008943316 6:57070770-57070792 TACACAGAAGAGCCTAAAAAGGG + Intergenic
1009013696 6:57874130-57874152 CACTCAGAAGAGTTTGGAAAAGG - Intergenic
1009800282 6:68528124-68528146 CTCACAGACGTCCTTGGAAAGGG - Intergenic
1010399984 6:75437215-75437237 CAGACAGAATAGCATGGAAAAGG + Intronic
1010625617 6:78133899-78133921 TACACAGAAGAGCCTAAAAAGGG + Intergenic
1011111600 6:83843168-83843190 CAAACAGACGAGTTTGGAAAAGG - Intergenic
1012777121 6:103511291-103511313 CACACAGAAGAGCCTGAATTTGG + Intergenic
1013316371 6:108947081-108947103 CAGAGGGAGGAGCCTGGAAAGGG + Intronic
1015484009 6:133747316-133747338 CACACAGAGGGGTCTGTAAAGGG - Intergenic
1016358846 6:143246987-143247009 CATACAGCAGAGCCTGGAAGGGG + Intronic
1016878933 6:148890988-148891010 TACAGAGACAAGCCTGGAAAGGG + Intronic
1017415948 6:154220744-154220766 TTCACAGACCACCCTGGAAATGG + Intronic
1018193866 6:161337536-161337558 TTCACAGAAGTGCCTGGAAAGGG + Intergenic
1018442543 6:163826296-163826318 CACACAGATGCCCCTGAAAACGG - Intergenic
1019615454 7:1957512-1957534 CAGACAGACGAGCCAGAAAACGG + Intronic
1019813884 7:3185126-3185148 CACCCAGAGGAGCCTGAAAATGG - Intergenic
1022968899 7:35498911-35498933 CACACAGGAGAGCATGGACAGGG + Intergenic
1023541939 7:41275170-41275192 TACTCATATGAGCCTGGAAAAGG - Intergenic
1023632805 7:42180410-42180432 CACACAGAGGAGCCAGGGGAAGG + Intronic
1024349659 7:48350740-48350762 CAGACTGCAGAGCCTGGAAACGG - Exonic
1025295191 7:57771073-57771095 CTCACAGAAAAGCCGGGAAAAGG - Intergenic
1026184571 7:68072382-68072404 CATACAGAAGAGGCTGGACATGG - Intergenic
1027600396 7:80233057-80233079 CACAAAAAGGAGCCAGGAAATGG - Intergenic
1031075464 7:117208304-117208326 CTCATGGACCAGCCTGGAAATGG + Intronic
1034648925 7:152674177-152674199 CACACAGACAAGGCAGGCAAAGG + Intronic
1035633188 8:1124268-1124290 CAAAGAGAAGAGCCTGGAAGCGG + Intergenic
1036102554 8:5802727-5802749 TACACAGAAGAGCCTAGAAAAGG - Intergenic
1036373914 8:8183844-8183866 CACACGGACGCGCCAGAAAAAGG + Intergenic
1036549052 8:9800740-9800762 TACACAGAAGAGCCTAAAAAGGG + Intergenic
1036823425 8:11957588-11957610 CACACACACATGCCTGGAGATGG - Intergenic
1036876989 8:12481797-12481819 CACACGGACGCGCCAGAAAAAGG - Intergenic
1038101912 8:24387392-24387414 TACACAGAAGAGCCTAAAAAGGG - Intronic
1038441606 8:27574542-27574564 CACTCAGAGCAGCCTGTAAAGGG + Intergenic
1040359580 8:46652391-46652413 TACACAGAAGAGCCTAGACAGGG + Intergenic
1040692179 8:49952439-49952461 CTCACAAACGAGCATGGAAATGG + Intronic
1043499786 8:80841408-80841430 CAGACAGAGGAGGCTGCAAAGGG - Intronic
1044336907 8:90996138-90996160 CAAACAAAGGAGCATGGAAATGG + Intronic
1048040419 8:130722367-130722389 CAGACATTGGAGCCTGGAAATGG - Intergenic
1048360023 8:133689666-133689688 CACACAGCCCGGCCTGCAAAAGG - Intergenic
1048881331 8:138875094-138875116 AAGACAGAGGAACCTGGAAATGG + Intronic
1054841638 9:69748061-69748083 GTCACAAAAGAGCCTGGAAAAGG + Intronic
1057141860 9:92731218-92731240 CACACCCACGAGCCTGGAGCTGG + Intronic
1058342252 9:103912740-103912762 CATACTGACCAGCCTGGAAAAGG + Intergenic
1058704475 9:107627302-107627324 CACAAAGATGAGTGTGGAAAGGG - Intergenic
1062569141 9:137176586-137176608 CATGAAGACAAGCCTGGAAATGG + Intronic
1188085065 X:25894023-25894045 TACACAGAAGAGCCTATAAAGGG + Intergenic
1188113593 X:26219025-26219047 TACACAGAAGAGCCTAAAAAGGG - Intergenic
1188771939 X:34163317-34163339 CACAGAGACCAGCCTGGCACTGG + Intergenic
1189219125 X:39356023-39356045 CACTGAGGCCAGCCTGGAAAAGG + Intergenic
1190282749 X:48941785-48941807 CATCCAGGCGAGGCTGGAAACGG + Intronic
1191811754 X:65196707-65196729 CACACACAAGAGCCTAAAAAGGG + Intergenic
1194258052 X:91658554-91658576 CACACTGAAGAACCTGTAAAGGG + Intergenic
1195162067 X:102180733-102180755 TACACAGAAGAGCCTAAAAAGGG - Intergenic
1198370307 X:135983405-135983427 CACACCGACTAACATGGAAAGGG + Intergenic
1199623604 X:149720815-149720837 TACACAGAAGAGCCTAAAAAGGG + Intergenic
1200576815 Y:4898056-4898078 CACACTGAAGAACCTGTAAAGGG + Intergenic
1200976324 Y:9215570-9215592 TACACAGAAGAGCCTAAAAAGGG - Intergenic
1201521047 Y:14873940-14873962 TACACAGAAGAGCCTAAAAAGGG - Intergenic
1202090198 Y:21180695-21180717 CACACAGAAAAGTCTGAAAAGGG + Intergenic
1202134845 Y:21650960-21650982 TACACAGAAGAGCCTAAAAAGGG + Intergenic
1202142746 Y:21745155-21745177 TACACAGAAGAGCCTAAAAAGGG + Intergenic
1202144112 Y:21760463-21760485 TACACAGAAGAGCCTAAAAAGGG - Intergenic