ID: 904190313

View in Genome Browser
Species Human (GRCh38)
Location 1:28737745-28737767
Sequence TCTCCGGGAAGCGCCCCGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 72}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904190295_904190313 17 Left 904190295 1:28737705-28737727 CCCTGAGCCGGGAGGGGGACGCG 0: 1
1: 0
2: 0
3: 14
4: 126
Right 904190313 1:28737745-28737767 TCTCCGGGAAGCGCCCCGGGCGG 0: 1
1: 0
2: 0
3: 8
4: 72
904190301_904190313 10 Left 904190301 1:28737712-28737734 CCGGGAGGGGGACGCGGGGCGGT 0: 1
1: 0
2: 0
3: 17
4: 253
Right 904190313 1:28737745-28737767 TCTCCGGGAAGCGCCCCGGGCGG 0: 1
1: 0
2: 0
3: 8
4: 72
904190296_904190313 16 Left 904190296 1:28737706-28737728 CCTGAGCCGGGAGGGGGACGCGG 0: 1
1: 0
2: 3
3: 36
4: 321
Right 904190313 1:28737745-28737767 TCTCCGGGAAGCGCCCCGGGCGG 0: 1
1: 0
2: 0
3: 8
4: 72
904190289_904190313 27 Left 904190289 1:28737695-28737717 CCGCCGGTGGCCCTGAGCCGGGA 0: 1
1: 0
2: 1
3: 6
4: 147
Right 904190313 1:28737745-28737767 TCTCCGGGAAGCGCCCCGGGCGG 0: 1
1: 0
2: 0
3: 8
4: 72
904190291_904190313 24 Left 904190291 1:28737698-28737720 CCGGTGGCCCTGAGCCGGGAGGG 0: 1
1: 0
2: 2
3: 34
4: 358
Right 904190313 1:28737745-28737767 TCTCCGGGAAGCGCCCCGGGCGG 0: 1
1: 0
2: 0
3: 8
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904190313 Original CRISPR TCTCCGGGAAGCGCCCCGGG CGG Intronic
900087516 1:905430-905452 TCTCTGGGGAGCGCCCGGGAGGG - Intergenic
900100346 1:959804-959826 TCCCCGGGAAGAGCCGCGGTCGG - Intergenic
900755310 1:4430453-4430475 TTTCCAGGAAGGGCCCCGGGGGG + Intergenic
902780231 1:18700245-18700267 CCTCCAGGAAGCCCCCCAGGAGG - Intronic
903986640 1:27234116-27234138 TCTCAGGCTAGGGCCCCGGGGGG - Intergenic
904190313 1:28737745-28737767 TCTCCGGGAAGCGCCCCGGGCGG + Intronic
904405161 1:30283700-30283722 TCCCCAGCAAGGGCCCCGGGAGG + Intergenic
904782952 1:32964438-32964460 TCGGCGGGCAGCGCCTCGGGCGG + Exonic
907541028 1:55215408-55215430 GCTCCCGGAAGCGGCACGGGAGG + Intergenic
919926406 1:202194030-202194052 CCTCCGGGAAGCGCACAGCGCGG - Exonic
924561105 1:245156659-245156681 TGCCCGGGAAGGGCCCCGGGAGG - Exonic
1062979778 10:1712528-1712550 TCTGTGGGAAGCAACCCGGGAGG + Intronic
1069557875 10:69409185-69409207 TCCCTGGGAGGCGCCCAGGGTGG - Intronic
1071579390 10:86756268-86756290 TCTGCGGGAAGCTACCCGGGCGG + Intergenic
1075690103 10:124388794-124388816 GCTCCGGGCAGAGTCCCGGGAGG + Intergenic
1076909164 10:133378951-133378973 TCAGAGGGAAGCGCCCCGCGTGG - Intergenic
1079690177 11:23407040-23407062 TCTTCTGGAAAAGCCCCGGGGGG + Intergenic
1081528370 11:43942417-43942439 TCTCCCGGAACCCCCGCGGGCGG + Exonic
1084621003 11:70270472-70270494 TCTCCGGGATGAGCCACAGGTGG - Intergenic
1105512325 13:21061218-21061240 GCTCCGGGAAGGGCGCCCGGCGG - Intronic
1106054925 13:26229071-26229093 TCTCAGGGAAGGGCCCTAGGAGG - Intergenic
1118259662 14:64235299-64235321 TCTCAGGGAAGATCCCCTGGGGG - Intronic
1123039927 14:105486346-105486368 TCTGCGGGTAGCGCCCAGGGCGG - Intergenic
1124349112 15:28942699-28942721 TCTCCAGTAAGCGACCTGGGAGG + Intronic
1124640374 15:31392835-31392857 CCTCCCGGAAGCGTCGCGGGCGG - Intronic
1130015036 15:80179933-80179955 TCTCTGGGCAGCTCCCCAGGAGG + Intronic
1132537916 16:492442-492464 TCCCCGGGAAGGGCCCTGGGCGG - Intronic
1132537930 16:492474-492496 TCTCCCGGGAGGGCCCTGGGCGG - Intronic
1132537944 16:492504-492526 TCTCCCGGGAGGGCCCTGGGCGG - Intronic
1133277720 16:4648515-4648537 ACCACGGGAAGAGCCCCGGGAGG - Intronic
1133277749 16:4648586-4648608 ACCACGGGAAGAGCCCCGGGAGG - Intronic
1133277814 16:4648764-4648786 ACCACGGGAAGAGCCCCGGGAGG - Intronic
1133277828 16:4648799-4648821 ACCACGGGAAGAGCCCCGGGAGG - Intronic
1133277842 16:4648834-4648856 ACCACGGGAAGAGCCCCGGGAGG - Intronic
1136477992 16:30525324-30525346 TCTGCGGGAAGAGCTTCGGGCGG - Exonic
1144520946 17:15951871-15951893 TCTCAGGGCAGGGCCCAGGGTGG - Intronic
1144640934 17:16936091-16936113 TCTGAGGGAAGGGCCCTGGGAGG - Intronic
1152546848 17:81004395-81004417 TTCCCGGGGAGCGCGCCGGGTGG - Intronic
1152642858 17:81456437-81456459 TCTCCCGGATGCGCCCCCCGGGG - Exonic
1152662705 17:81550358-81550380 TCTCGGGGAAGCACCCCGCTGGG - Exonic
1158954438 18:62524651-62524673 CCTCCGAGAGGGGCCCCGGGCGG - Intronic
1160934673 19:1588248-1588270 TCTCCGGGAAGAGCCCTCAGTGG - Intronic
1163320462 19:16571846-16571868 CCGGCGGGACGCGCCCCGGGCGG + Intronic
925905230 2:8536177-8536199 TCTGGGGGAAGCGGCCCAGGGGG + Intergenic
927679575 2:25131054-25131076 TTTCCGGCAAGAGCCACGGGAGG - Intronic
932299663 2:70657409-70657431 TCTCCGGGAAGAGGCCAGGTGGG - Exonic
934495214 2:94790022-94790044 TCTGTGGGAAGGGCCCTGGGAGG - Intergenic
935590623 2:104843530-104843552 TCTCCTGGCAGAGCCGCGGGAGG + Intergenic
948805857 2:240453276-240453298 ACGCCGGGATGCGGCCCGGGAGG - Intronic
1168965663 20:1896431-1896453 TCTCCTGGGAGGGCACCGGGTGG + Intronic
1174956393 20:55103357-55103379 TTTCCGGGAAGTGCCCAGGATGG - Intergenic
1175180893 20:57146696-57146718 TCTCCGGGAAGGACCCTGGCTGG + Intergenic
1175540752 20:59746223-59746245 CCTCAGGGAAGCCACCCGGGAGG + Intronic
1176192572 20:63819342-63819364 TCTTCGGGATGCGCTCCTGGAGG - Intronic
1178351282 21:31874168-31874190 GCCCCGGGAAGCGTCCCGCGCGG + Intronic
1184065218 22:42114937-42114959 CCTCCGGGAAGCGACCAGAGTGG - Intergenic
953099198 3:39809314-39809336 CCGCAGGGAAGAGCCCCGGGAGG + Intronic
963091670 3:141487822-141487844 TCGCGGGTGAGCGCCCCGGGAGG + Intronic
968590866 4:1459051-1459073 TCTCCTGGCAGCGCTCTGGGGGG + Intergenic
970609179 4:17709569-17709591 GCTGCGGGAAGCGCACCAGGAGG - Exonic
972533184 4:39978035-39978057 CCTCCGGGAGGCGCCCCGCGCGG - Intergenic
991291232 5:65035528-65035550 TCTCCGGCCAGCGGCCTGGGTGG - Intergenic
1002867061 6:1130898-1130920 TTTCCGGGAAGCTCCCCTGAGGG - Intergenic
1007774853 6:44219384-44219406 TCTCAGGGAGGCGACCCAGGGGG + Intergenic
1027244228 7:76355618-76355640 TCTCCTGGAAGAGCCTGGGGGGG + Intronic
1029708576 7:102287604-102287626 GCTCCGGGGAGCTCCCCGGCTGG - Intronic
1032334488 7:131012515-131012537 TCTCAGGGAAGTGCCCAGGAAGG + Intergenic
1036396944 8:8377856-8377878 CCTCCGGGAAGCTCACCGGGTGG + Exonic
1039921208 8:41895905-41895927 GCTCCGGGGAGCGGGCCGGGGGG - Intronic
1043463845 8:80486531-80486553 GCTCCGGGCAGCGTCCCGCGCGG - Exonic
1049577154 8:143394656-143394678 TCCCCGGGAAAGGCCCTGGGGGG + Intergenic
1053198314 9:36136590-36136612 TCTCCGGGAGGCCCACGGGGTGG + Intronic
1053535530 9:38922117-38922139 TCTGCGGGAAGCACTCCAGGTGG - Intergenic
1054207751 9:62146521-62146543 TCTGCGGGAAGCACTCCAGGAGG - Intergenic
1054630601 9:67441830-67441852 TCTGCGGGAAGCACTCCAGGAGG + Intergenic
1056773808 9:89497696-89497718 TCTCTGGGAGGCGTCCCAGGAGG + Intronic
1056991955 9:91421348-91421370 TCTCTGGGAGGCGCCGCGTGGGG - Intronic
1060269690 9:122131857-122131879 TCTCCAGGAAGCCCAGCGGGTGG - Intergenic
1061679762 9:132237228-132237250 TCTCCTCGAAGAGCCCAGGGAGG - Intronic
1062619336 9:137412483-137412505 TCTCCTGGAAGGGCCCCGGTGGG - Intronic
1187915374 X:24149259-24149281 TCTCCAGGGAGGCCCCCGGGGGG + Intronic