ID: 904190313

View in Genome Browser
Species Human (GRCh38)
Location 1:28737745-28737767
Sequence TCTCCGGGAAGCGCCCCGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 81
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 72}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904190291_904190313 24 Left 904190291 1:28737698-28737720 CCGGTGGCCCTGAGCCGGGAGGG 0: 1
1: 0
2: 2
3: 34
4: 358
Right 904190313 1:28737745-28737767 TCTCCGGGAAGCGCCCCGGGCGG 0: 1
1: 0
2: 0
3: 8
4: 72
904190296_904190313 16 Left 904190296 1:28737706-28737728 CCTGAGCCGGGAGGGGGACGCGG 0: 1
1: 0
2: 3
3: 36
4: 321
Right 904190313 1:28737745-28737767 TCTCCGGGAAGCGCCCCGGGCGG 0: 1
1: 0
2: 0
3: 8
4: 72
904190295_904190313 17 Left 904190295 1:28737705-28737727 CCCTGAGCCGGGAGGGGGACGCG 0: 1
1: 0
2: 0
3: 14
4: 126
Right 904190313 1:28737745-28737767 TCTCCGGGAAGCGCCCCGGGCGG 0: 1
1: 0
2: 0
3: 8
4: 72
904190289_904190313 27 Left 904190289 1:28737695-28737717 CCGCCGGTGGCCCTGAGCCGGGA 0: 1
1: 0
2: 1
3: 6
4: 147
Right 904190313 1:28737745-28737767 TCTCCGGGAAGCGCCCCGGGCGG 0: 1
1: 0
2: 0
3: 8
4: 72
904190301_904190313 10 Left 904190301 1:28737712-28737734 CCGGGAGGGGGACGCGGGGCGGT 0: 1
1: 0
2: 0
3: 17
4: 253
Right 904190313 1:28737745-28737767 TCTCCGGGAAGCGCCCCGGGCGG 0: 1
1: 0
2: 0
3: 8
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904190313 Original CRISPR TCTCCGGGAAGCGCCCCGGG CGG Intronic