ID: 904190474

View in Genome Browser
Species Human (GRCh38)
Location 1:28739073-28739095
Sequence TCTAATGTAAAATCACCTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 156}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904190470_904190474 12 Left 904190470 1:28739038-28739060 CCCAGAGAACTTTGGATTCATAT 0: 1
1: 0
2: 0
3: 16
4: 200
Right 904190474 1:28739073-28739095 TCTAATGTAAAATCACCTGAAGG 0: 1
1: 0
2: 1
3: 16
4: 156
904190471_904190474 11 Left 904190471 1:28739039-28739061 CCAGAGAACTTTGGATTCATATG 0: 1
1: 0
2: 0
3: 9
4: 184
Right 904190474 1:28739073-28739095 TCTAATGTAAAATCACCTGAAGG 0: 1
1: 0
2: 1
3: 16
4: 156
904190469_904190474 13 Left 904190469 1:28739037-28739059 CCCCAGAGAACTTTGGATTCATA 0: 1
1: 0
2: 0
3: 17
4: 193
Right 904190474 1:28739073-28739095 TCTAATGTAAAATCACCTGAAGG 0: 1
1: 0
2: 1
3: 16
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904190474 Original CRISPR TCTAATGTAAAATCACCTGA AGG Intronic
900078539 1:837200-837222 TCTAACCTGAAATCTCCTGAGGG + Intergenic
904190474 1:28739073-28739095 TCTAATGTAAAATCACCTGAAGG + Intronic
910685346 1:89910588-89910610 TCTAGTTTAAAATAAGCTGAGGG + Intronic
913189936 1:116404945-116404967 TGTAAATCAAAATCACCTGAGGG - Intronic
913646972 1:120866500-120866522 GCTAAAGTAATATCACCTGTTGG + Intergenic
914174571 1:145264902-145264924 GCTAAAGTAATATCACCTGTGGG - Intergenic
914529299 1:148506390-148506412 GCTAAAGTAATATCACCTGTGGG - Intergenic
915533044 1:156514884-156514906 TCTGAGGGAAAATCACCTGGTGG - Intergenic
918750820 1:188266998-188267020 TTTAATATAAAAACACCTCAAGG - Intergenic
920918085 1:210274465-210274487 TCTTCTGTAATATCTCCTGAAGG + Intergenic
920981432 1:210839885-210839907 ACAAATGAAGAATCACCTGACGG + Intronic
922092985 1:222415178-222415200 TCTAATGCACAAGCACCTCAAGG - Intergenic
924393913 1:243595779-243595801 TCTTTTGGAATATCACCTGAAGG + Intronic
1062895709 10:1101635-1101657 TGTGATGCAAAATCACCAGACGG - Intronic
1066028879 10:31396774-31396796 CCTGATGTGAAATTACCTGAAGG + Intronic
1066355297 10:34677785-34677807 TCTAATGAAAGACCACCGGAGGG + Intronic
1073661870 10:105484938-105484960 TATGAAGCAAAATCACCTGATGG - Intergenic
1074148671 10:110739485-110739507 CCTAATGTAAAATTCTCTGAGGG - Intronic
1074657230 10:115605031-115605053 TTTAATGTAAATTAACATGAGGG + Intronic
1075472456 10:122702035-122702057 CCTAATGTAAAAACAATTGAGGG - Intergenic
1077952472 11:6975318-6975340 TGCAATGTAAAATCACATCATGG + Intronic
1079147344 11:17865436-17865458 TCTTCTGTAATATCTCCTGAAGG - Intronic
1080605721 11:33863428-33863450 TATAATGTAAAATGCTCTGAGGG + Intronic
1080715266 11:34794071-34794093 TCAAACCTAAAATCACCCGATGG - Intergenic
1086895047 11:92302259-92302281 TGTAATGTAAAACCACCGGGAGG - Intergenic
1090396356 11:126421808-126421830 TTTAATGTGAAATCACCTATGGG + Intronic
1091839509 12:3609985-3610007 TCTGATGTAAAATTAGCTGTTGG - Intronic
1091995750 12:4992561-4992583 TCAAATGTAGAATCTCCTCAGGG + Intergenic
1093542766 12:20306719-20306741 TCTATTGAAAAATCTGCTGATGG - Intergenic
1096026425 12:48367789-48367811 TCTATTGTAAATTGACCTGGAGG + Intergenic
1096031725 12:48422292-48422314 TCCATTGTAAAAACACCTGCTGG + Intergenic
1097300379 12:58012371-58012393 GGTAATGTAAAATGAACTGAAGG + Intergenic
1097956679 12:65494065-65494087 GCTAATGTAATAGAACCTGAAGG + Intergenic
1100085927 12:90910727-90910749 TGTAATGTGATATCACCTTATGG - Intronic
1101794443 12:107960017-107960039 CCTAAATTAAAATCCCCTGAAGG + Intergenic
1106263161 13:28086316-28086338 AGTAATGTAACATCACCTAAAGG - Intronic
1107285438 13:38785064-38785086 TCAAAAGTTTAATCACCTGATGG - Intronic
1108974128 13:56416518-56416540 TATAATGTAAATTGAGCTGAGGG + Intergenic
1111471470 13:88688732-88688754 TATAATATCAAATCAACTGAGGG - Intergenic
1118101308 14:62606543-62606565 TCTCATGTAAAATAAACTCAGGG + Intergenic
1118936258 14:70291480-70291502 TGAAATGTAAGATCATCTGAAGG + Intergenic
1120345193 14:83279921-83279943 TACAATGTAAAATCAGCTTATGG + Intergenic
1125001488 15:34775314-34775336 TCTACTGTAAAAGAACCTCAGGG + Intergenic
1125010049 15:34861981-34862003 TCTATAGTATAATAACCTGAAGG + Intronic
1127492399 15:59477386-59477408 TGTAATATAAAATCACCTGCAGG - Intronic
1134269709 16:12722915-12722937 TCTAATGTGAAATGAGCTGAGGG + Intronic
1135508054 16:23056193-23056215 TCTTATGTAAGATGACCTGAAGG + Intergenic
1136866566 16:33762541-33762563 TATAATGCAAAATCAACTAAAGG + Intergenic
1203105594 16_KI270728v1_random:1353662-1353684 TATAATGCAAAATCACCTAAAGG - Intergenic
1203127920 16_KI270728v1_random:1608706-1608728 TATAATGCAAAATCACCTAAAGG + Intergenic
1144016719 17:11203152-11203174 TCTAGTGTGGAATCACCTGAAGG - Intergenic
1144220268 17:13093465-13093487 TCCTCTGTAAAATCACCAGATGG - Intergenic
1146898587 17:36564986-36565008 TGTTATGTAAGATCACCTAAAGG + Intronic
1152828633 17:82483633-82483655 ACTAATGTCAAATCTCCTGCAGG + Intronic
1156675207 18:39519836-39519858 TCTAATGTAAAATCTCCTGCCGG + Intergenic
1156762561 18:40611100-40611122 TTTATTTTAAAATCACCTGTTGG - Intergenic
1157827672 18:50826913-50826935 TCTAATGCACAATCCCTTGAAGG - Intergenic
1157889825 18:51404958-51404980 GCCAATGTAAAATCAACTGTGGG - Intergenic
1157933532 18:51849307-51849329 TGGCATTTAAAATCACCTGATGG - Intergenic
1159163684 18:64675975-64675997 TATAATGTAAAATCAATTTAAGG - Intergenic
1160658182 19:284748-284770 TGAAATGAAAAATCACTTGAGGG + Intronic
926351319 2:11997629-11997651 TCTCATGTAAAATAACCTAATGG - Intergenic
927043797 2:19256483-19256505 CCTAATGTAATATATCCTGAAGG - Intergenic
928053693 2:28028523-28028545 TGGAATGTAAAATCTCATGAGGG + Intronic
928563657 2:32519224-32519246 TCTAGTATAAAATGACCAGATGG - Intronic
929688268 2:44053336-44053358 TCCCAGGTAAAGTCACCTGATGG + Intergenic
934635256 2:95981125-95981147 TATAATGCAAAATCAGCTGAAGG + Intronic
934798372 2:97124094-97124116 TATAATGCAAAATCAGCTGAAGG - Intronic
934835056 2:97579382-97579404 TATAATGCAAAATCAGCTGAAGG + Intronic
939087165 2:137735267-137735289 TCTGCTGAAAAATCAACTGATGG + Intergenic
940531000 2:154875652-154875674 TCTAATACAAAATCACCTCTAGG - Intergenic
940807964 2:158209002-158209024 TCTTATTTAATATCATCTGATGG + Intronic
943099741 2:183473390-183473412 TCTAATGTGAAATCAGGAGAGGG + Intergenic
943118258 2:183702102-183702124 TCTAATGGAGAATCACTTAATGG - Intergenic
943617612 2:190111420-190111442 ATTAATGTAATATCACTTGATGG - Intronic
943904974 2:193487619-193487641 TCTAATGAATGATTACCTGAAGG - Intergenic
944369706 2:198967592-198967614 TCTATTATAAAATCAAATGAAGG + Intergenic
944882613 2:204028765-204028787 CTTAATGTAAGATCTCCTGAAGG + Intergenic
945950590 2:216035291-216035313 TCTGATGCAAAACCCCCTGAGGG - Intronic
946581709 2:221135301-221135323 TCTAAGATAAAAACAACTGAAGG - Intergenic
946869598 2:224073892-224073914 TGTATGGTAAACTCACCTGATGG - Intergenic
1172988898 20:39017301-39017323 TCTTATGTAAATCCAGCTGAAGG - Intronic
1174664640 20:52246596-52246618 TGTGATGAAAAATCACCTAATGG - Intergenic
1174755113 20:53150592-53150614 TCTAAGGTAAAATCAACTACAGG + Intronic
1174965635 20:55211425-55211447 TCAAATGTACAATCACCAAATGG - Intergenic
1175302030 20:57949560-57949582 TCCAAAGAAAAAGCACCTGAGGG - Intergenic
1176983286 21:15407610-15407632 TATTAGATAAAATCACCTGAGGG - Intergenic
1179378907 21:40880289-40880311 TCTGATGTTATATGACCTGAAGG - Intergenic
1181813017 22:25415769-25415791 TCTATTGGAAAATAACCTAAAGG - Intergenic
1181830994 22:25559960-25559982 TCTATTGGAAAATAACCTAAAGG - Intergenic
949334261 3:2956707-2956729 TCTAATGTACAATCTGGTGATGG - Intronic
951905738 3:27705114-27705136 TATAATATAATATCACTTGAAGG - Intergenic
953287357 3:41625011-41625033 TCAAATGTAATTTCAACTGACGG + Intronic
955195088 3:56797931-56797953 TCCAATGTCAAATTTCCTGATGG - Intronic
957123656 3:76129916-76129938 TCTCATGCTGAATCACCTGATGG + Intronic
957582680 3:82094795-82094817 TCTTATTTAAAATCACCTTATGG + Intergenic
957901781 3:86503658-86503680 TCTACTGTAAGCTCAGCTGACGG - Intergenic
958149557 3:89671907-89671929 TTGAATGTAAAATGACCTAAAGG + Intergenic
959001103 3:100965199-100965221 TCTAAGGTAAATCCACATGAGGG + Intronic
961114743 3:124319468-124319490 TCAGATGTCAAAACACCTGATGG - Intronic
963479646 3:145854833-145854855 TCTGATGTAAAATCACCATCAGG + Intergenic
967451971 3:189635353-189635375 TGTAAGTTAAAATCACCTAAAGG + Intronic
972949240 4:44298536-44298558 TGTATTTCAAAATCACCTGAGGG + Intronic
975306706 4:72857697-72857719 TCTAATTTAAAATTACATCAAGG - Intergenic
979669145 4:123343947-123343969 TCTGATGAAAAAGAACCTGATGG - Intergenic
981409675 4:144414484-144414506 TCTCATGTAAAATCTTCAGAGGG - Intergenic
981462085 4:145025270-145025292 TCTAATGGAAAAGTTCCTGAAGG - Intronic
982316965 4:154041725-154041747 TTTAATGCAAAATGACATGACGG - Intergenic
982810140 4:159815116-159815138 TCTGATTCAAAATCACCTGAAGG + Intergenic
983285295 4:165731727-165731749 TCTAAGGAAAAATCACTTGAAGG + Intergenic
983416566 4:167463464-167463486 TCTCATGAAAAATCATCTGATGG - Intergenic
983474461 4:168196693-168196715 TCTAATATAAAACCTGCTGAAGG + Intergenic
987148543 5:15016264-15016286 TCTACAGTAAAATCACTTTAGGG + Intergenic
989177838 5:38545895-38545917 TCCAATGTAAAATCAAATAATGG + Intronic
989437684 5:41433955-41433977 TGTGACGTAATATCACCTGATGG + Intronic
989978214 5:50609884-50609906 GCTAAAGTAATATCACCTGTGGG + Intergenic
992470260 5:77044677-77044699 TATAATGTAAAAGCTCCTCATGG + Intronic
993452660 5:88091683-88091705 TCCAATTTGAAATCACCTAAGGG + Intergenic
993551017 5:89273828-89273850 TCTAATTTAGAAGCACATGAGGG - Intergenic
993875428 5:93301071-93301093 ACTAATGGAAAATCAAATGAAGG + Intergenic
993904259 5:93605238-93605260 TCTAAGGTTAAATTACATGAAGG - Intergenic
994548568 5:101203753-101203775 TGCCATGTAAAATCATCTGAAGG - Intergenic
995074006 5:107959917-107959939 TCTACTGAAACATCCCCTGAAGG - Intronic
995460405 5:112397230-112397252 TCTTATGAAAAATCAGCTGGAGG - Intronic
1003728732 6:8795853-8795875 TTTAATATAACATCACCAGATGG + Intergenic
1004878860 6:19985403-19985425 TCTAATGTAAATTCAGCCAAAGG - Intergenic
1005092427 6:22071644-22071666 TTTAATTTAAAGCCACCTGAAGG + Intergenic
1005775189 6:29123663-29123685 TCAAATGTAAAAACTCATGAAGG - Intergenic
1008056983 6:46955460-46955482 TCTAAGGCAAAATGGCCTGAGGG - Intergenic
1008067868 6:47069726-47069748 TCAAGCGTAAAATCTCCTGAAGG - Intergenic
1008259524 6:49347709-49347731 ACTACTGTGAGATCACCTGAAGG - Intergenic
1013119436 6:107128229-107128251 TCTAATGTAAAATATTCAGAGGG - Intergenic
1013573979 6:111461134-111461156 TCTTCTGTAATATCTCCTGAAGG - Intronic
1014462979 6:121720659-121720681 TCTAAGGTAAAATCATCTATTGG - Intergenic
1014845742 6:126274774-126274796 TCTGTTATAAAAACACCTGAAGG + Intergenic
1018723859 6:166595700-166595722 TCTAATGTTAAATGATCTTAAGG + Intronic
1020653870 7:10907439-10907461 TTATATGTGAAATCACCTGATGG + Intergenic
1021337686 7:19423976-19423998 TCTCATGTAAAATGACCAGAGGG - Intergenic
1024504716 7:50152452-50152474 TCAAATTTGAAAGCACCTGATGG + Intronic
1024608704 7:51044859-51044881 TCAAATATACCATCACCTGATGG - Intronic
1025780936 7:64601249-64601271 TATATTGTAATATCTCCTGAGGG - Intergenic
1030860140 7:114615396-114615418 ACTAAGCTAAAATCACCTTAAGG - Intronic
1035527102 8:322544-322566 TCTAACCTGAAATCTCCTGAGGG - Intergenic
1037413021 8:18617821-18617843 TCTAATATAGCATCACATGATGG + Intronic
1037485370 8:19341936-19341958 TCTGATCTAAAATCTCCCGAGGG + Intronic
1043965254 8:86467308-86467330 CCTTATGTAACATCTCCTGAGGG + Exonic
1044414674 8:91923922-91923944 TCTACTGGAATATCCCCTGAAGG - Intergenic
1044496904 8:92897213-92897235 TCTCATTTAAAATCACATGTGGG - Intronic
1045628242 8:104083185-104083207 TGTAATGTTAAAAAACCTGAAGG - Intronic
1045795204 8:106035682-106035704 TCTAGTGTAAAAACAGATGAAGG + Intergenic
1046092133 8:109515717-109515739 GCTAATATAACATCAACTGAAGG + Intronic
1047939970 8:129820133-129820155 TCTAAATTAAAATCACCGTATGG - Intergenic
1050020076 9:1274291-1274313 TCTCATGTGAAATCACTTGGTGG - Intergenic
1051965157 9:22818700-22818722 TCTAATGTAAAGTCAACTCTTGG + Intergenic
1052426740 9:28314629-28314651 TTTAATGTGAAATAACATGATGG - Intronic
1052584334 9:30406478-30406500 TCTAATTTAAAATCAATTTAGGG - Intergenic
1052620544 9:30903205-30903227 ACTAATGTAAGATCATCTCAGGG + Intergenic
1058399182 9:104593886-104593908 TCTAAATTTAGATCACCTGATGG + Intergenic
1059537189 9:115092044-115092066 TCTATTGTTAAGTCCCCTGATGG - Intronic
1060709785 9:125848248-125848270 TCTCACCTAAAATCACCTCAAGG + Intronic
1060847432 9:126848533-126848555 TCAAATGAACAATCACCTGTTGG - Intergenic
1188065436 X:25653501-25653523 TCTAATGTACAACAACATGAAGG + Intergenic
1188418155 X:29962891-29962913 TCCAATCTAAAATAACCTTACGG - Intergenic
1188584290 X:31753478-31753500 ACAAATATAAAATCATCTGATGG + Intronic
1189050451 X:37639930-37639952 TCCAATGTGAATTCAACTGAAGG - Intronic
1189526191 X:41824576-41824598 TCTGCTGTAAAGGCACCTGAAGG - Intronic
1189827706 X:44936741-44936763 TCTTATATAAAATTACCTGTAGG - Intronic
1190846593 X:54198203-54198225 TCTAAAGTAAACTCAAATGAGGG + Exonic
1192031984 X:67523725-67523747 TCTAATATAAAATTTCATGATGG + Intergenic
1192708676 X:73556591-73556613 TCTGATGTAACATCACATGACGG - Intergenic
1193975772 X:88116696-88116718 TCTTAGGAAAAATCACTTGAAGG - Intergenic
1194301646 X:92194348-92194370 CCTAATGTTAAATTAGCTGATGG + Intronic
1196345236 X:114648140-114648162 TCTAATGTAATAAAACTTGAGGG + Intronic
1201969772 Y:19779259-19779281 TTTTATATAAAATCATCTGATGG - Intergenic