ID: 904192912

View in Genome Browser
Species Human (GRCh38)
Location 1:28761476-28761498
Sequence CCGTTATGTGCTGGGATTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 22159
Summary {0: 1, 1: 2, 2: 33, 3: 968, 4: 21155}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904192912_904192918 -10 Left 904192912 1:28761476-28761498 CCTGTAATCCCAGCACATAACGG 0: 1
1: 2
2: 33
3: 968
4: 21155
Right 904192918 1:28761489-28761511 CACATAACGGAGGCCAAGGCAGG 0: 1
1: 0
2: 6
3: 38
4: 615
904192912_904192919 -7 Left 904192912 1:28761476-28761498 CCTGTAATCCCAGCACATAACGG 0: 1
1: 2
2: 33
3: 968
4: 21155
Right 904192919 1:28761492-28761514 ATAACGGAGGCCAAGGCAGGTGG 0: 1
1: 3
2: 37
3: 1286
4: 34873
904192912_904192921 4 Left 904192912 1:28761476-28761498 CCTGTAATCCCAGCACATAACGG 0: 1
1: 2
2: 33
3: 968
4: 21155
Right 904192921 1:28761503-28761525 CAAGGCAGGTGGATCACCTGAGG 0: 5146
1: 20620
2: 47912
3: 74655
4: 86900
904192912_904192922 8 Left 904192912 1:28761476-28761498 CCTGTAATCCCAGCACATAACGG 0: 1
1: 2
2: 33
3: 968
4: 21155
Right 904192922 1:28761507-28761529 GCAGGTGGATCACCTGAGGTTGG 0: 1812
1: 5413
2: 9643
3: 10748
4: 11219
904192912_904192923 9 Left 904192912 1:28761476-28761498 CCTGTAATCCCAGCACATAACGG 0: 1
1: 2
2: 33
3: 968
4: 21155
Right 904192923 1:28761508-28761530 CAGGTGGATCACCTGAGGTTGGG 0: 1026
1: 18826
2: 47760
3: 81950
4: 99275

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904192912 Original CRISPR CCGTTATGTGCTGGGATTAC AGG (reversed) Intronic
Too many off-targets to display for this crispr