ID: 904197344

View in Genome Browser
Species Human (GRCh38)
Location 1:28795677-28795699
Sequence GAGATTGCAAAATTGTGTTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904197344_904197348 11 Left 904197344 1:28795677-28795699 CCTCAACACAATTTTGCAATCTC No data
Right 904197348 1:28795711-28795733 CTCCCAGCTGGGCAGTCATCAGG No data
904197344_904197346 0 Left 904197344 1:28795677-28795699 CCTCAACACAATTTTGCAATCTC No data
Right 904197346 1:28795700-28795722 ACCGCTAGTCACTCCCAGCTGGG No data
904197344_904197345 -1 Left 904197344 1:28795677-28795699 CCTCAACACAATTTTGCAATCTC No data
Right 904197345 1:28795699-28795721 CACCGCTAGTCACTCCCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904197344 Original CRISPR GAGATTGCAAAATTGTGTTG AGG (reversed) Intergenic
No off target data available for this crispr