ID: 904199756

View in Genome Browser
Species Human (GRCh38)
Location 1:28812176-28812198
Sequence CTCCGGGCGAGGAGAGCGGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 176}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904199749_904199756 3 Left 904199749 1:28812150-28812172 CCTGCGGCTGCTCCTGGCTCACA 0: 1
1: 0
2: 1
3: 22
4: 316
Right 904199756 1:28812176-28812198 CTCCGGGCGAGGAGAGCGGGCGG 0: 1
1: 0
2: 0
3: 12
4: 176
904199752_904199756 -9 Left 904199752 1:28812162-28812184 CCTGGCTCACAGCGCTCCGGGCG 0: 1
1: 0
2: 3
3: 11
4: 153
Right 904199756 1:28812176-28812198 CTCCGGGCGAGGAGAGCGGGCGG 0: 1
1: 0
2: 0
3: 12
4: 176
904199747_904199756 11 Left 904199747 1:28812142-28812164 CCGAGGAGCCTGCGGCTGCTCCT 0: 1
1: 0
2: 0
3: 28
4: 307
Right 904199756 1:28812176-28812198 CTCCGGGCGAGGAGAGCGGGCGG 0: 1
1: 0
2: 0
3: 12
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904199756 Original CRISPR CTCCGGGCGAGGAGAGCGGG CGG Exonic