ID: 904199897

View in Genome Browser
Species Human (GRCh38)
Location 1:28812703-28812725
Sequence TGCAGGAAATGCGGAGGCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 180
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 167}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904199897_904199914 23 Left 904199897 1:28812703-28812725 CCCGCGCCTCCGCATTTCCTGCA 0: 1
1: 0
2: 2
3: 10
4: 167
Right 904199914 1:28812749-28812771 GGCGAGGCCACTTACATCGAGGG 0: 1
1: 0
2: 0
3: 2
4: 26
904199897_904199913 22 Left 904199897 1:28812703-28812725 CCCGCGCCTCCGCATTTCCTGCA 0: 1
1: 0
2: 2
3: 10
4: 167
Right 904199913 1:28812748-28812770 AGGCGAGGCCACTTACATCGAGG 0: 1
1: 0
2: 0
3: 3
4: 30
904199897_904199908 2 Left 904199897 1:28812703-28812725 CCCGCGCCTCCGCATTTCCTGCA 0: 1
1: 0
2: 2
3: 10
4: 167
Right 904199908 1:28812728-28812750 GGCACCTGGGGCCCAGCGAGAGG 0: 1
1: 0
2: 3
3: 49
4: 457
904199897_904199915 24 Left 904199897 1:28812703-28812725 CCCGCGCCTCCGCATTTCCTGCA 0: 1
1: 0
2: 2
3: 10
4: 167
Right 904199915 1:28812750-28812772 GCGAGGCCACTTACATCGAGGGG 0: 1
1: 0
2: 0
3: 2
4: 11
904199897_904199906 -10 Left 904199897 1:28812703-28812725 CCCGCGCCTCCGCATTTCCTGCA 0: 1
1: 0
2: 2
3: 10
4: 167
Right 904199906 1:28812716-28812738 ATTTCCTGCAGGGGCACCTGGGG 0: 1
1: 1
2: 2
3: 24
4: 225
904199897_904199910 7 Left 904199897 1:28812703-28812725 CCCGCGCCTCCGCATTTCCTGCA 0: 1
1: 0
2: 2
3: 10
4: 167
Right 904199910 1:28812733-28812755 CTGGGGCCCAGCGAGAGGCGAGG 0: 1
1: 0
2: 1
3: 37
4: 388

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904199897 Original CRISPR TGCAGGAAATGCGGAGGCGC GGG (reversed) Intronic
900794583 1:4700396-4700418 TTCAGAAAATGCTGAGGCCCAGG - Intronic
901055580 1:6447426-6447448 TGCAGGAAATGCGACACCGCAGG - Intronic
901451720 1:9340064-9340086 TGCTGGAAATGCAGAGTCTCGGG - Intronic
902361991 1:15946944-15946966 TGGGGGAAATGCGGAGGCCTTGG - Exonic
904199897 1:28812703-28812725 TGCAGGAAATGCGGAGGCGCGGG - Intronic
906214565 1:44031253-44031275 GGCAGGACAGACGGAGGCGCGGG + Intronic
909393101 1:75137076-75137098 TGCAGGAAACCGCGAGGCGCAGG - Intronic
914428587 1:147600127-147600149 AGCCGGAAAGGGGGAGGCGCCGG + Intronic
914676647 1:149911447-149911469 TGCAGGAAATGTGTAGACTCTGG + Intronic
915593658 1:156884378-156884400 TAGAGTAAATGCGGAGGAGCTGG - Intergenic
916912733 1:169368209-169368231 TGCTGGATATGCGGAGGGACTGG + Exonic
919767501 1:201136697-201136719 TGCAGGAAATGCAGAGGCTCCGG - Intronic
920892394 1:210001932-210001954 TGCAGGAAATGAGGAGCCATTGG + Intronic
923034035 1:230271784-230271806 TGCCGGACATGCGGAGGCGCTGG - Intronic
923410924 1:233708230-233708252 AGCAGGAAGTGAGGAGGGGCTGG - Intergenic
924114301 1:240730121-240730143 AGCAGGAAATGGGCAGGCCCGGG - Intergenic
1063377624 10:5563546-5563568 TGCCGGAAATGGGGAGCTGCCGG + Intergenic
1064793407 10:18985087-18985109 TGCTTGAAATTCGGAGGCGGAGG - Intergenic
1067708255 10:48627139-48627161 TGCAGGAAATGCGTAGGGCCAGG - Intronic
1069903355 10:71718451-71718473 TGCCGCAAAGGCGGAGGCCCTGG - Intronic
1070933879 10:80278829-80278851 TGCAGGACAAGAGAAGGCGCTGG + Intronic
1072912114 10:99511726-99511748 TGGGGGAAATGAGGAGACGCTGG + Intergenic
1079033209 11:17001042-17001064 TGCAGAAAATGTGAAGGAGCTGG - Intronic
1079452072 11:20605966-20605988 AACAGGAAGTGCGGAGGGGCGGG + Intronic
1081997567 11:47375179-47375201 GGCAGGAAGTGCGGATGTGCCGG + Intronic
1086229909 11:84555977-84555999 TGTAGGAAATGCAGATGGGCAGG - Intronic
1086613878 11:88790896-88790918 TGCAGGCAATGGGGAGCCTCTGG + Intronic
1089029774 11:115313650-115313672 ACCAGGAAATGCAGAGGAGCAGG - Intronic
1098194804 12:67988321-67988343 TGGAGAAAATGCAGAGGGGCTGG - Intergenic
1101052415 12:100876613-100876635 TGGAGGACATGTGGAGGAGCTGG + Intronic
1102084239 12:110123194-110123216 TGCTGGAAATGCAGAAGGGCAGG - Intergenic
1102853916 12:116277370-116277392 AGCAGGGAAGGCGGAGGCGGTGG - Intergenic
1103724748 12:122992062-122992084 TGCAGGAGATGCGTTGGGGCAGG - Intronic
1103860157 12:124005930-124005952 TGCAAGAACTGCAGAGGCACAGG - Intronic
1107483561 13:40805144-40805166 TGCAGCAAAGGCAGAGGCGAAGG - Exonic
1110390404 13:74967061-74967083 TGCAGGAAGTCAGGAGGCCCTGG + Intergenic
1111037939 13:82704228-82704250 TTCAGGGAATACGGAGGAGCTGG + Intergenic
1118159256 14:63272694-63272716 TGCCTGAATTGCGGAGGGGCAGG - Intronic
1118319773 14:64746436-64746458 GGGAGGAAATGAGGAGGCGGCGG - Exonic
1120897871 14:89550407-89550429 TCCAGGAAATGGGGAAGGGCTGG - Intronic
1121246323 14:92463368-92463390 TGCAGGAAATGGGGATGCTGTGG + Intronic
1122179713 14:99946424-99946446 TGCAGGAGATGGGGAGGGGCAGG - Intergenic
1122788133 14:104173306-104173328 TGCAGGAAAGGCAGAGGCAGCGG - Intronic
1123014622 14:105367847-105367869 GGCAGGAAGTGGGGAGGGGCAGG - Intronic
1127583266 15:60356959-60356981 TGCAGGCAATGAGGAGGTGAAGG + Intronic
1128260135 15:66227624-66227646 TGCAGGAGATGCTGAGAAGCTGG - Intronic
1128682064 15:69659627-69659649 AGCAGGAAAGGAGTAGGCGCTGG + Intergenic
1129844405 15:78761656-78761678 GGCAGGAAATGGGGTGGCCCTGG - Intronic
1130257392 15:82332123-82332145 GGCAGGAAATGGGGTGGCCCTGG + Intergenic
1130597553 15:85257842-85257864 GGCAGGAAATGGGGTGGCCCTGG - Intergenic
1130931624 15:88432488-88432510 TGCTGGAAATGCAGAGTCTCAGG - Intergenic
1132009628 15:98265080-98265102 TGCAGGAGACACGGAGGGGCAGG - Intergenic
1134544165 16:15094919-15094941 TGCTGGAACTGGGGAGGCGGAGG - Intronic
1137733766 16:50709426-50709448 TTCAGGAAATGGGGAAGTGCTGG - Intronic
1138639984 16:58377791-58377813 TGCAGGAAATATGGAGGTGAGGG - Intronic
1140265904 16:73420443-73420465 TGCAGGGAAGGCGGCGTCGCTGG + Intergenic
1142489273 17:267387-267409 TGCAGGAAATGAATAGGGGCTGG + Intronic
1143141948 17:4745804-4745826 TGCAGTACCTGCGGGGGCGCGGG - Exonic
1144814637 17:18025464-18025486 TGCAGGAAAAGCTGGGGTGCTGG + Intronic
1146670418 17:34733697-34733719 AGCAGGAAGTGCGGAGGGGTGGG - Intergenic
1148241195 17:46000436-46000458 TGCAGGCAAGGAGGAGGAGCTGG + Intronic
1148561193 17:48607391-48607413 TGCTGGGAAGGCGGAGGCTCAGG + Exonic
1150820621 17:68431422-68431444 TGGAGGAAATGAGGAGGTTCTGG + Intronic
1151277833 17:73049315-73049337 TGCAGGAAAGGCTGAGAAGCAGG + Intronic
1151653628 17:75485404-75485426 TGCAGGCAAGCAGGAGGCGCTGG - Intronic
1151960807 17:77404705-77404727 TGTAGGAAATGCAGAGTCCCAGG - Intronic
1152073154 17:78144002-78144024 GGGAGGAAACGCGGAGACGCTGG + Intergenic
1154308591 18:13249199-13249221 TGCAGTAAATGTGGAGGTGCAGG + Intronic
1157180004 18:45488645-45488667 TGCAGGAAATGAAGATGCTCTGG + Intronic
1158648838 18:59269191-59269213 TTCAGGAAGGGCGGAGGCGGCGG + Exonic
1160192319 18:76724136-76724158 AGCAGGAAAGGGGGAGGCCCAGG - Intergenic
1160669421 19:352308-352330 TGCAGGAAATTCTGACGCGAGGG + Intergenic
1160822947 19:1066814-1066836 TGCAGGAGAGGCGGTGGAGCGGG + Intronic
1161003578 19:1923475-1923497 TGCAGGAACAGCTGAGGCCCTGG + Intronic
1161816721 19:6503724-6503746 TACAGGAAATGCAGAGGCAAGGG - Intergenic
1162477885 19:10911857-10911879 TGCTAGAACTGCGGAGGCCCCGG + Intronic
1166563235 19:43747398-43747420 TGCAGGATGTGCGGAAGCTCAGG + Intronic
1167626841 19:50595934-50595956 CTCAGGAAATGAGGAGGCCCAGG - Intergenic
1167661018 19:50796188-50796210 TACAAGTAATGTGGAGGCGCTGG + Intergenic
925242048 2:2339887-2339909 TGCAAGAATGGAGGAGGCGCTGG + Intergenic
926057018 2:9779754-9779776 AGCAGGAAACACGGAGGCTCTGG + Intergenic
927056144 2:19367273-19367295 TGCTGGAAATGCAGAAGCCCAGG + Intergenic
927811834 2:26184776-26184798 AGCAGGAAGTGCAGCGGCGCCGG - Exonic
929929574 2:46242288-46242310 TGCATGAACTGGGGAGGCGAAGG - Intergenic
931643051 2:64398209-64398231 TGCAGGAAGTGCAAAGGCGAAGG + Intergenic
931681237 2:64751262-64751284 TGGAGGGAAGGAGGAGGCGCCGG + Intergenic
931683143 2:64769206-64769228 TGCAGGAAAAGCGGCGGTGGGGG + Intergenic
931753519 2:65351326-65351348 TGAAAGAAATGGGGAGGGGCAGG - Intronic
934578129 2:95416024-95416046 TGGAGGAAATGGCGAGGTGCAGG + Exonic
934601311 2:95660680-95660702 TGGAGGAAATGGCGAGGTGCAGG - Intergenic
935530029 2:104220964-104220986 TGAAGGAAATTCAGAGGCGACGG - Intergenic
935686076 2:105684301-105684323 TGCAGGAAATGGGGAGATGTTGG + Intergenic
940720008 2:157271671-157271693 TGAGGGAAATGCAGAGGAGCTGG + Intronic
942163525 2:173217343-173217365 GGCAGGAAATGAGGAGGGGGCGG - Intronic
943649466 2:190441464-190441486 TACAGGAAAGGAGGAGGGGCGGG + Intronic
947218168 2:227768082-227768104 GGCAGGAAACGAGGAGGCCCTGG + Intergenic
948868691 2:240787668-240787690 TGCAGCAAATGAGGAGCTGCTGG + Intronic
949064495 2:241981418-241981440 TGCTGGAAATGCAGAGTCTCAGG - Intergenic
1168923229 20:1558351-1558373 TGCAGGGAAGGCGGAGCTGCGGG + Exonic
1169213297 20:3779220-3779242 TGGAGGAGAGGCAGAGGCGCAGG - Exonic
1169214815 20:3786736-3786758 GGCAGGAAGTGCCGCGGCGCGGG + Intergenic
1169727234 20:8748667-8748689 TGCAGGAAATGGGGAGGTGTGGG + Intronic
1172916520 20:38447541-38447563 TGCAGGAAAAATGGGGGCGCTGG - Intergenic
1174334511 20:49849402-49849424 TGCAGTAAGTGCGGGGGTGCAGG + Intronic
1175160029 20:57001524-57001546 TGCTAGAAATGCAGAGGCCCAGG + Intergenic
1175206384 20:57314970-57314992 TTCAGGAAAAGCTGAGGCCCTGG - Intergenic
1175243811 20:57569041-57569063 TGCACGAAATGCTGAGCCTCAGG + Intergenic
1175911443 20:62407157-62407179 CGCAGGCGCTGCGGAGGCGCGGG - Exonic
1176184459 20:63770806-63770828 TGCAGGAAATGGGGACACGGCGG - Intronic
1177863113 21:26478587-26478609 TGCGGGAAATGGGGAACCGCTGG + Intronic
1179100452 21:38351492-38351514 TGCTGGAAATGCTGAAGCTCAGG + Intergenic
1180101815 21:45590970-45590992 TGCGGGAGAGGCGGAGGCGGGGG + Intergenic
1181602967 22:23963279-23963301 TGTTGGAAATGCAGAGGCTCAGG + Intergenic
1181605547 22:23978028-23978050 TGTTGGAAATGCAGAGGCTCAGG - Intronic
1181641493 22:24202471-24202493 TGCAGAAAAGGCAGAGGGGCTGG - Intergenic
1182016302 22:27042771-27042793 TCCAGGAAATGCGGAAGCTCAGG - Intergenic
1182211221 22:28679309-28679331 TGGGGGAAAAGGGGAGGCGCTGG + Intronic
1182623500 22:31630427-31630449 TGCAGGAAGTGAGGGGGTGCCGG - Intronic
1183581804 22:38730817-38730839 TGGGGGCAATGCGGAGGCTCCGG - Exonic
1184059662 22:42074268-42074290 TGCAGCCCAGGCGGAGGCGCGGG + Exonic
1184551102 22:45204552-45204574 TGCAGGAAAATCGCAGGCTCAGG - Intronic
1185005597 22:48274951-48274973 TGCAGGAAAAGGGGAGGCCAAGG - Intergenic
950536663 3:13582813-13582835 TGCAGGAACTGGGGTGGCGGGGG + Intronic
950581411 3:13864609-13864631 TGCAGTAAATGCTGGGGTGCAGG - Intronic
951471695 3:23063465-23063487 TGCAGGAAATGCAGAATCTCAGG + Intergenic
953234578 3:41094982-41095004 TGCAGGAAATGGGGTGGAGATGG - Intergenic
956172263 3:66442431-66442453 TGCAGGAAGTGAGGAGGGGGAGG + Intronic
956414640 3:69013414-69013436 CGCAGGGAATGGGAAGGCGCGGG + Intronic
960055397 3:113273205-113273227 TGCGGGAGAGCCGGAGGCGCTGG - Exonic
961051964 3:123754475-123754497 TGGAGGAAATGCTGAGACTCTGG + Intronic
961688253 3:128650426-128650448 CTCAGGAAATGCGGAGACCCGGG - Intronic
967170397 3:186818543-186818565 TGTAGGCAATGCGGAGCCCCTGG + Intergenic
971886033 4:32449396-32449418 TGAAGGAAATGTGGGGGCACTGG - Intergenic
975397509 4:73894136-73894158 TGCAGGAATTGCTGAGTAGCAGG - Intergenic
985041641 4:185896990-185897012 TGCAGCAATTGCGGAGGCTCAGG + Intronic
988183906 5:27835452-27835474 TGCAGGAAATTGGGAGGGGAGGG + Intergenic
990427799 5:55705789-55705811 TGCTTGAAATGGGGAGGCGGAGG - Intronic
995088355 5:108141640-108141662 TGAAGGCAATGCGGAGCCTCTGG + Intronic
998328493 5:141303503-141303525 TGCAGCAAATGCAGAGGCGAAGG + Exonic
998992527 5:147833661-147833683 TGCAGGAAATGCAGAAACCCAGG - Intergenic
1002204669 5:177554311-177554333 TGCAGGCCCTCCGGAGGCGCCGG - Exonic
1006014663 6:31070718-31070740 TGTAGGAAAGGAGGAGGCACTGG + Intergenic
1006442620 6:34061673-34061695 TGCAGGAAATGGAGAGGGGAGGG + Intronic
1008269009 6:49467408-49467430 TGCAGGGAATGGGGAAGGGCAGG + Intronic
1015259068 6:131213754-131213776 TGCAGGAAATGAGAAGGAGGAGG + Intronic
1015958650 6:138624274-138624296 TGTTAGAAATGCGGAGGCTCAGG - Intronic
1018650176 6:165986402-165986424 GGCAGGAAAGGCAGAGGGGCAGG + Intronic
1019117744 6:169778951-169778973 AGCAAGAAATGCGGACGTGCAGG + Intronic
1022379338 7:29844977-29844999 TGGAGGAAATGTGGAAGCTCTGG - Intronic
1022531697 7:31070826-31070848 TGCTGGAAATGCAGATGCTCAGG - Intronic
1032926112 7:136607094-136607116 TGAAGGAAACGTGGAGGCACAGG - Intergenic
1034348590 7:150402383-150402405 TGCAAGGAATGAGGAGGTGCAGG - Intronic
1034475077 7:151276990-151277012 GGCAGGGAAGGCGGGGGCGCCGG + Intronic
1035421048 7:158729411-158729433 TGGAGCAAATGTGGAGGTGCTGG + Intergenic
1035451077 7:158977247-158977269 TGTTGGAAATGCAGAGGCTCTGG + Intergenic
1035654959 8:1298594-1298616 TGCAGGACATGTGGACGGGCAGG - Intergenic
1036215678 8:6877884-6877906 TTCAGGAACTGGGGAGACGCTGG + Exonic
1036484821 8:9170238-9170260 TGTAGGAAATGCGGAGCCATAGG + Intergenic
1039462068 8:37753375-37753397 TGCAGGAAGTGCAGAGGCTATGG - Intronic
1040040244 8:42909334-42909356 TGCAAGAAATGTGGAAGTGCAGG - Intronic
1040072084 8:43196568-43196590 TGCAGGGAATGCAGAAGCCCAGG - Intronic
1040665870 8:49632539-49632561 TGCTGGAAATGAAGAGGCACTGG + Intergenic
1041076468 8:54174558-54174580 TGCAAGAAATGCGGCAGCCCAGG - Intergenic
1041179933 8:55236687-55236709 CTCAGGAAATGGGGAGGAGCTGG - Intronic
1044224625 8:89704806-89704828 TGCAGGAAATGTGGAGTAGCAGG + Intergenic
1045060675 8:98408081-98408103 AGCAGGAAATGTGGAAGCTCAGG - Intronic
1049460829 8:142726997-142727019 TGCTGGGAAGGCGGAGACGCCGG + Intergenic
1049794758 8:144492054-144492076 GGCAGGCAATGTGGGGGCGCTGG + Intronic
1051385171 9:16500066-16500088 TGCAGGAATTGAGGAGGAGTTGG - Intronic
1057563705 9:96149713-96149735 TGCAGGAAATGCAGCAGCCCCGG - Intergenic
1060933381 9:127502869-127502891 TGTGGTAGATGCGGAGGCGCTGG - Exonic
1188990115 X:36808696-36808718 TGCTGGAAATGGGGAGGCAGAGG - Intergenic
1189336264 X:40172502-40172524 GGAAGGAAAAGCGGAGGCCCGGG + Intronic
1191616655 X:63176803-63176825 TGCAGGAAGTGGGGAGTAGCAGG - Intergenic
1191619642 X:63202120-63202142 TGCAGGAAGTGGGGAGTAGCAGG + Intergenic
1193535191 X:82706709-82706731 AGCAGGAAAGGAGGAGGTGCTGG + Intergenic
1197571425 X:128155679-128155701 TGCAGAAAATGTGGAGCAGCTGG - Intergenic
1198237880 X:134752997-134753019 TGCAAGAAAGGCGGATGTGCTGG - Intronic
1199242853 X:145568714-145568736 TGCAGTAAATACGGAGGTGCGGG + Intergenic
1199411493 X:147528674-147528696 TTCAGGAAATTCAGAGGCGCAGG + Intergenic