ID: 904199944

View in Genome Browser
Species Human (GRCh38)
Location 1:28812968-28812990
Sequence CGGAAACATGCCCATGGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 91}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904199944 Original CRISPR CGGAAACATGCCCATGGGGT GGG Intronic
902293298 1:15449006-15449028 CAGAAACAATCCCATGAGGTAGG + Intronic
903121559 1:21219800-21219822 CGGAACCGAGCCCATGGTGTTGG - Intronic
904199944 1:28812968-28812990 CGGAAACATGCCCATGGGGTGGG + Intronic
904328430 1:29742583-29742605 TGGAACCATGGCCATGGGGTGGG - Intergenic
908446622 1:64203728-64203750 CGGAGACAAGCCCATGTCGTCGG - Intronic
918130765 1:181626907-181626929 GGAAAACATGCCCAGGGCGTAGG + Intronic
919751202 1:201039420-201039442 AGGAACCCTGCCCATGGGCTTGG - Intergenic
923137845 1:231134079-231134101 AGAAAACATGCCCAAGGGGCTGG + Intergenic
1062911510 10:1215254-1215276 CAGACAGATGCCCATGGGGCAGG - Intronic
1064118038 10:12595649-12595671 TGGAAACATGGTCAAGGGGTAGG - Intronic
1067054519 10:43043121-43043143 CAGTCGCATGCCCATGGGGTGGG + Intergenic
1067211083 10:44260886-44260908 CAGAAAGAGGCTCATGGGGTGGG + Intergenic
1081774265 11:45666562-45666584 AGGAAACAGGCCACTGGGGTGGG - Intergenic
1083934232 11:65862071-65862093 CGGAACCATGGCAGTGGGGTGGG + Intronic
1087593156 11:100218499-100218521 GGGTTACATGCCCATGAGGTTGG - Intronic
1098032000 12:66264910-66264932 TGGACACATGCCCATGAGGCCGG - Intergenic
1100922787 12:99507907-99507929 TGGAAAGATGAACATGGGGTGGG - Intronic
1104431077 12:128716906-128716928 TAGAAAAATGCCCATGTGGTTGG + Intergenic
1105054145 12:133081476-133081498 CGGAAACAGGCCAAGTGGGTTGG - Intronic
1108186927 13:47897362-47897384 TGGAAAGAAGCCCATGGTGTAGG + Intergenic
1109606196 13:64700739-64700761 AGGAAACATGCTCATGGCATCGG + Intergenic
1114183148 14:20381936-20381958 GGCAAACGGGCCCATGGGGTAGG + Exonic
1114639762 14:24211650-24211672 GGGAAACAAGCCTATGGGGAGGG - Intronic
1120230269 14:81834167-81834189 CTGAAACATGTCCATGAGGATGG + Intergenic
1120515597 14:85465851-85465873 CTTAAGCATTCCCATGGGGTTGG - Intergenic
1121431589 14:93891874-93891896 AGGACACATGTCCATGGGCTGGG + Intergenic
1122405394 14:101497706-101497728 CGGAAACATGCCCATTAGCGGGG - Intergenic
1122757063 14:103990028-103990050 AGGAGACATGGCCATGAGGTTGG - Intronic
1125186058 15:36931630-36931652 CAGAAAAATGCATATGGGGTTGG + Intronic
1127540026 15:59928206-59928228 GGGAAACAGGGCCATGGGGTGGG - Intergenic
1132703189 16:1230611-1230633 CGGGAAGGTGCCCACGGGGTGGG + Intergenic
1132705133 16:1240258-1240280 CGGGAAGGTGCCCACGGGGTGGG - Intergenic
1132708259 16:1255620-1255642 CGGGAAGGTGCCCACGGGGTGGG - Intergenic
1133557419 16:6918662-6918684 CAGAGATATGCCCATTGGGTAGG - Intronic
1135953607 16:26937591-26937613 CAGAAACATGCCCGTGAAGTTGG - Intergenic
1137687005 16:50393248-50393270 AGGACAGATGCCCATGGGGCAGG - Intergenic
1138504760 16:57472665-57472687 TGGGAAGATGCCCCTGGGGTAGG - Exonic
1139370729 16:66467882-66467904 TAGAAACATGCCCTTGGGGCAGG - Intronic
1143491016 17:7285221-7285243 CAGGACCATTCCCATGGGGTGGG - Intronic
1150342450 17:64379448-64379470 CTGAACCATGCCCATGGGTCAGG + Intronic
1152371709 17:79892373-79892395 CGGGGTCATGCTCATGGGGTGGG - Intergenic
1152558696 17:81067282-81067304 CTGAAAGATCCCCATGGGGCGGG - Intronic
1152662216 17:81547821-81547843 GAGAAACATGCCCCTGGGGCGGG - Intronic
1157309383 18:46540751-46540773 CTGAAAGATGTGCATGGGGTTGG - Intronic
1159959082 18:74541562-74541584 AGGAAATATGCACATGCGGTTGG + Intronic
1166800484 19:45454001-45454023 CTGGAACATGCCCATGGTATAGG - Intronic
1168279725 19:55298629-55298651 CGGAAACCTGCACCTTGGGTGGG - Intronic
927701777 2:25273771-25273793 CTGAGACATGCCCATGGCGTTGG - Intronic
927870981 2:26623611-26623633 TGGAAACCTGCCCAAGGTGTAGG - Intronic
933608238 2:84406815-84406837 CAGACACATGTCCATGGGATAGG - Intergenic
934778988 2:96957182-96957204 CAGAAACATGGCCATGGAGGCGG - Intronic
935040071 2:99417557-99417579 CGGAGACATGCATATGGGGAAGG + Intronic
937122596 2:119451305-119451327 CTGAACCATACCCATGGGCTGGG + Intronic
943608604 2:190005693-190005715 AGGAGAAATGACCATGGGGTTGG + Intronic
946782582 2:223206172-223206194 AGATAACATGCACATGGGGTGGG - Intergenic
948889228 2:240898717-240898739 TGGAAACATGCCCCTGCTGTGGG - Intergenic
1171386257 20:24771069-24771091 GGGAAACATGGCCATGGTGAAGG + Intergenic
1177088816 21:16740590-16740612 AGGTTACATGCCCATGGAGTAGG + Intergenic
1177301573 21:19252142-19252164 CGGAAGAATGCCCATGGTATGGG + Intergenic
1182644691 22:31798692-31798714 CGGTAACATAGCCATGTGGTAGG - Intronic
1183611557 22:38910619-38910641 TGGAAACAAACCCATGGTGTTGG - Intergenic
1183710808 22:39502223-39502245 CGGAATCATGCGCAGGGGGCGGG + Intronic
954786662 3:53098446-53098468 CAGAAGCCTGGCCATGGGGTGGG - Intronic
962710422 3:138081331-138081353 AGGACACATTCACATGGGGTTGG + Intronic
964478666 3:157120513-157120535 CGGAAACAGGCGCATAGGGCGGG - Intergenic
974223254 4:59003531-59003553 TGGACACACGCCCATGGAGTGGG - Intergenic
982353694 4:154444096-154444118 AGGAAAGAGGCCCATGGGCTGGG - Intronic
984714641 4:182915064-182915086 AGGAAACATGCCCAAAGGCTTGG + Intronic
987562319 5:19540258-19540280 CTGATACAAGCCCATGGGCTTGG + Intronic
988983305 5:36593309-36593331 TGGAACACTGCCCATGGGGTTGG - Intergenic
990257950 5:53991045-53991067 TGGAATTATACCCATGGGGTGGG - Intronic
991444035 5:66680883-66680905 CGAAGACATGCCCAAGGGCTTGG + Intronic
992622262 5:78605523-78605545 TGGTAACATGGTCATGGGGTTGG - Intronic
997521219 5:134525669-134525691 CAGAAACATACACAGGGGGTTGG + Intronic
999304742 5:150512168-150512190 GGGCCACATGCACATGGGGTGGG - Intronic
999811623 5:155132738-155132760 GTTAAACATGGCCATGGGGTAGG + Intergenic
1000438439 5:161241201-161241223 CGGAAGCTTGCCCATAGGGAAGG - Intergenic
1004107067 6:12675794-12675816 CGGCAACAAGTCCATGTGGTGGG + Intergenic
1008323064 6:50141912-50141934 AGGCAACATGCCCATGTGGTGGG + Intergenic
1013166112 6:107593639-107593661 CTGAAACAACCCCATGAGGTAGG - Intronic
1013217361 6:108039998-108040020 AGGGAACATGAGCATGGGGTGGG + Intergenic
1018201965 6:161403462-161403484 CGGAAAAACGCTCATGGGGTCGG + Intronic
1019167136 6:170104887-170104909 CTGAAACATGCTCATGGTGGGGG - Intergenic
1030054216 7:105568156-105568178 CTCAAACATTCCCATGTGGTAGG + Intronic
1031148844 7:118029078-118029100 TGAAAACATCCCCATGAGGTAGG - Intergenic
1032344589 7:131106821-131106843 TGGAAACCTGCGCCTGGGGTGGG + Intergenic
1032460669 7:132108034-132108056 TGGAAACATGCCCCAGTGGTGGG - Intergenic
1034468112 7:151241747-151241769 AGGAAACATGCCCCTGGGGAAGG + Intronic
1034941835 7:155235758-155235780 CTGAAACGTGCCCCTGGGGCAGG - Intergenic
1045935990 8:107679512-107679534 CTGGAACATGCTCATGGAGTAGG - Intergenic
1047171817 8:122501002-122501024 TGAAAACATGCCCAGGGGCTGGG - Intergenic
1049597604 8:143491946-143491968 AGGCAACATGCCTGTGGGGTGGG - Intronic
1055436720 9:76298992-76299014 CTGATAGATGCTCATGGGGTTGG - Intronic
1058572788 9:106365658-106365680 CAGAGACATGCCCCAGGGGTGGG - Intergenic
1061992878 9:134169761-134169783 CAGAAACCTGGCCATGTGGTGGG + Intergenic
1203790904 EBV:151055-151077 AGGAAGCATGACCTTGGGGTGGG + Intergenic
1194708979 X:97211027-97211049 CTAAAATAGGCCCATGGGGTAGG + Intronic
1197600150 X:128518511-128518533 AGGAAACATGGGCATGGTGTTGG + Intergenic