ID: 904203571

View in Genome Browser
Species Human (GRCh38)
Location 1:28837701-28837723
Sequence GGTGAGACTCTCCATAAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 103}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904203571_904203577 7 Left 904203571 1:28837701-28837723 CCTCTTTTATGGAGAGTCTCACC 0: 1
1: 0
2: 0
3: 6
4: 103
Right 904203577 1:28837731-28837753 CCAGGCTGGTCTTGAACTCCTGG 0: 17571
1: 38040
2: 57987
3: 52841
4: 33963
904203571_904203573 -7 Left 904203571 1:28837701-28837723 CCTCTTTTATGGAGAGTCTCACC 0: 1
1: 0
2: 0
3: 6
4: 103
Right 904203573 1:28837717-28837739 TCTCACCGTATTGCCCAGGCTGG 0: 11
1: 706
2: 12119
3: 84254
4: 261938

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904203571 Original CRISPR GGTGAGACTCTCCATAAAAG AGG (reversed) Intronic
902548631 1:17206173-17206195 GGTGGGAGTCTCCCTCAAAGAGG + Intronic
904203571 1:28837701-28837723 GGTGAGACTCTCCATAAAAGAGG - Intronic
908910846 1:69071413-69071435 GGTGAGACCCCCCACAACAGGGG - Intergenic
910016074 1:82526124-82526146 GCAGTGACTCTCCATAAAAAAGG + Intergenic
911487623 1:98522114-98522136 GGGGAAACTCTCCAGAAAATTGG + Intergenic
913692434 1:121291908-121291930 GGTGAGAAACTCAATAAGAGAGG + Intronic
914145123 1:144988194-144988216 GGTGAGAAACTCAATAAGAGAGG - Intronic
917856357 1:179103740-179103762 TGTGAGACACTGCAAAAAAGTGG - Exonic
920479755 1:206310265-206310287 GGTGAGAAACTCAATAAGAGAGG + Intronic
922161908 1:223084360-223084382 GGTGAGCCTCTCCAAAACTGAGG - Intergenic
924089779 1:240490463-240490485 GGTGTGACGTGCCATAAAAGTGG - Exonic
1063071286 10:2668683-2668705 GGGGAGACTCTCCGTAACAGAGG - Intergenic
1063106984 10:3000731-3000753 GATGAGCCTCTCCAAAGAAGAGG + Intergenic
1067719065 10:48713150-48713172 GGTCAGACTCTGCATGGAAGCGG + Intronic
1073160635 10:101391568-101391590 GGAGAGACTCTTTATAAAAATGG + Intronic
1075788967 10:125069764-125069786 TGTGAGAACCTCCATTAAAGGGG - Intronic
1077806527 11:5596223-5596245 GGTCAAACTCTCCAGACAAGTGG - Intronic
1080103861 11:28491126-28491148 GCTGAGACTTGCCTTAAAAGGGG + Intergenic
1080300149 11:30775191-30775213 GGTTTGACTCTCCATAAAGCGGG - Intergenic
1086971288 11:93083852-93083874 GGTGAGACTATGCAGAATAGTGG - Intergenic
1088933889 11:114379417-114379439 TGTGAGACTCCCCAGAAAGGAGG - Intergenic
1097015454 12:55983327-55983349 AGTGAGACTCTCTCTAAAAATGG + Intronic
1097418059 12:59338362-59338384 GGTTAAACTCTACATATAAGAGG + Intergenic
1097421923 12:59390681-59390703 GGTGAGACTCTCTCAAACAGGGG + Intergenic
1098823098 12:75258553-75258575 GTTGAGACTCTACCTAAAACAGG - Intergenic
1100386233 12:94106597-94106619 GGTGAGGCTCTCTAAAAGAGGGG - Intergenic
1100419875 12:94422642-94422664 GGTGAGAATAACCACAAAAGTGG - Intronic
1109217238 13:59603597-59603619 GGTGAGCCTCACCAAAAATGGGG + Intergenic
1109993810 13:70095204-70095226 TTTGAGACCCTCTATAAAAGAGG + Intronic
1116937963 14:50761612-50761634 GGAGAAACTCTCCAGAAAAAAGG + Intronic
1124904868 15:33858842-33858864 TGTGAGCATCTCCATAAAAGAGG + Intronic
1125887436 15:43239141-43239163 GGTGAGGCTCTCCAGAAGAAAGG - Exonic
1131207329 15:90461441-90461463 TGTGGGACTCTTGATAAAAGTGG + Intronic
1133666506 16:7973351-7973373 GGTGAGACTGAGAATAAAAGTGG + Intergenic
1135173935 16:20211393-20211415 GGTCACTCACTCCATAAAAGTGG + Intergenic
1142335010 16:89482777-89482799 GCCGAGACTCTCCAAAAAAGCGG + Intronic
1149776864 17:59365181-59365203 GCTGAGACTCTCCAAAAACAAGG - Intronic
1155552881 18:26984694-26984716 GAAGAGAATCTTCATAAAAGAGG + Intronic
1160784997 19:896259-896281 TGTGAGACCCTCCATTACAGGGG + Intergenic
1167819280 19:51911231-51911253 GGTGAGACTCCCCATCTCAGGGG - Intronic
926991367 2:18684142-18684164 GCTAGGAATCTCCATAAAAGTGG + Intergenic
927865033 2:26582784-26582806 GGTGAGACTGTCCAGGAGAGTGG - Intronic
935265633 2:101391542-101391564 TGTGAGAGTCTCCTAAAAAGGGG - Intergenic
935586546 2:104804800-104804822 GATGAAACTCTCCACGAAAGAGG + Intergenic
940874968 2:158889232-158889254 GGACAGACTCTTCAGAAAAGAGG + Intergenic
941439184 2:165512259-165512281 GGTGAGACTGGCCCTAGAAGAGG - Intronic
1173456683 20:43208248-43208270 GGTGAAAGGCTCCATAAACGGGG - Intergenic
1173943528 20:46932256-46932278 GGTGAGCATGACCATAAAAGAGG - Intronic
1177498722 21:21922133-21922155 GGTGAAAGTATCCTTAAAAGTGG + Intergenic
1178774495 21:35536696-35536718 TATGAGACTATCCACAAAAGAGG - Intronic
1180614428 22:17118717-17118739 GGTGAGATTCTCCCTTCAAGGGG + Exonic
952504821 3:33998335-33998357 AGAGCAACTCTCCATAAAAGTGG - Intergenic
953267444 3:41405605-41405627 GGTGAGACTGTGGAGAAAAGAGG - Intronic
955273775 3:57527956-57527978 GGTGAAACTCTCCAGAATATTGG - Intronic
955656717 3:61251627-61251649 GGTGAGAATCCCCTTACAAGGGG + Intergenic
956600454 3:71015450-71015472 GGTGAAACTCTCCATCAAAAAGG + Intronic
961352502 3:126312940-126312962 GATGAGGATCTTCATAAAAGGGG - Intergenic
964406185 3:156351838-156351860 TGTGTGACTCTCCCCAAAAGAGG - Intronic
974254122 4:59427753-59427775 GGAGAAACACTCCATAAAATTGG - Intergenic
974461088 4:62188768-62188790 GGTAAGAGTGTCCCTAAAAGGGG + Intergenic
974699650 4:65424052-65424074 GGTGGGACTCACCATTAGAGTGG - Intronic
976768527 4:88624142-88624164 GGTGACTCTATCCATAAAATGGG - Intronic
977462049 4:97337555-97337577 GGTGAGACCCTCCCCAAAAGGGG + Intronic
979117598 4:116847271-116847293 AGGGAAACACTCCATAAAAGTGG - Intergenic
979793587 4:124816519-124816541 GGTGATATTCTACCTAAAAGTGG + Intergenic
981263314 4:142749326-142749348 GGTAAGACAATACATAAAAGTGG + Intronic
988844670 5:35115910-35115932 GGGGGGACCCTCCTTAAAAGAGG - Intronic
994899517 5:105753029-105753051 GGTGGTTCTCTCCATAACAGTGG - Intergenic
995404515 5:111779563-111779585 GGTCAAACTCTCCAAGAAAGGGG + Intronic
997439376 5:133898652-133898674 GGTGAGACTGTGCAGAAAGGGGG - Intergenic
998533088 5:142903109-142903131 GATGAGTCCCTCCTTAAAAGGGG - Intronic
998767595 5:145505394-145505416 GCTGAGAGTGTCCAGAAAAGTGG - Intronic
1001671464 5:173477621-173477643 AGTCAGACTCTCCATAAAGCAGG - Intergenic
1002469027 5:179423677-179423699 GGAGAGAGTCTCCAGAACAGAGG + Intergenic
1002917883 6:1543546-1543568 GGTGAGAGTCTCCATCCAAAAGG - Intergenic
1004030438 6:11863189-11863211 TGTGAGTCTCTCCAAAATAGAGG + Intergenic
1005490129 6:26340432-26340454 GATGAGACTTTCCAGAGAAGAGG + Intergenic
1008685582 6:53922780-53922802 GGTGAAACTCTACACAGAAGTGG - Exonic
1016246651 6:141989678-141989700 GGCAAGACTCTCAATGAAAGAGG + Intergenic
1019748622 7:2714779-2714801 CGTGAGACTCTCCATGGAGGAGG + Exonic
1021092883 7:16503782-16503804 GGTGAGAATCTTCATTTAAGGGG + Intronic
1022793060 7:33707870-33707892 TTTGAGACTCTCCATCAAAAAGG - Intergenic
1024256628 7:47544459-47544481 GGGGAGACTCTGCATGAATGGGG + Intronic
1028196396 7:87912569-87912591 TGTGTGACTCTCCATTAAAGAGG + Intergenic
1033200161 7:139360842-139360864 GGTCAGATTTTCCATAAAAATGG - Intronic
1034880965 7:154762280-154762302 CGTGAGACTCCCCAAAGAAGAGG - Intronic
1035264184 7:157681506-157681528 GGTGACCCTCTCCAGAAAACTGG + Intronic
1037584667 8:20268381-20268403 GGGGAGAATCATCATAAAAGGGG - Intronic
1039876057 8:41587167-41587189 AATGAGACTCTCCAGAAAACAGG - Intronic
1040841888 8:51793028-51793050 GGTGAGACCCCCCACAACAGGGG + Intronic
1041962622 8:63636327-63636349 GCTGAGAATCTCAAGAAAAGAGG - Intergenic
1042527911 8:69783957-69783979 GGTGGGACTCTTCATAATGGAGG + Intronic
1043575064 8:81647143-81647165 TGTGAGAATCACCATAAATGGGG - Intergenic
1048884909 8:138902135-138902157 GGTGAGGCGCTCCATGAGAGAGG + Intronic
1050480414 9:6081920-6081942 GGTGGGACTCAAAATAAAAGAGG - Intergenic
1052053888 9:23882225-23882247 GGAGAGACTGGCCAAAAAAGGGG + Intergenic
1187194543 X:17070487-17070509 GGTCTGACTCTCCAAAAAACTGG - Intronic
1188406569 X:29818057-29818079 GATCAGGCCCTCCATAAAAGTGG + Intronic
1189182641 X:39018292-39018314 GGGCAGCCTCTCCATAAAGGTGG + Intergenic
1190635365 X:52427403-52427425 AGTGAGACTCACCATAAGGGTGG - Intergenic
1192682088 X:73262877-73262899 GGTGGGACTCAAAATAAAAGAGG + Intergenic
1193283544 X:79684590-79684612 GGTGAAACTCTCCAAAACATTGG - Intergenic
1193292895 X:79797390-79797412 GGTAAAACTTTCCCTAAAAGTGG + Intergenic
1193801973 X:85946959-85946981 GGAGAGATTGTCCAAAAAAGGGG - Intronic
1199465788 X:148135129-148135151 GGTGAGACTCTAGATCAAATGGG - Intergenic
1199602065 X:149547071-149547093 GGTGGGACTCTCCAAAGCAGTGG - Exonic
1199648322 X:149932413-149932435 GGTGGGACTCTCCAAAGCAGTGG + Exonic
1201972720 Y:19814823-19814845 GGTGGGACTCAAAATAAAAGCGG + Intergenic
1202339871 Y:23852374-23852396 TATCAGACTCTCCATCAAAGTGG - Intergenic
1202530895 Y:25817708-25817730 TATCAGACTCTCCATCAAAGTGG + Intergenic