ID: 904203677

View in Genome Browser
Species Human (GRCh38)
Location 1:28838510-28838532
Sequence AGCACTGAAGTTCCAACACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 3, 3: 10, 4: 176}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904203672_904203677 -5 Left 904203672 1:28838492-28838514 CCCATCAGAGCCTCTTCCAGCAC 0: 1
1: 0
2: 0
3: 18
4: 274
Right 904203677 1:28838510-28838532 AGCACTGAAGTTCCAACACAGGG 0: 1
1: 0
2: 3
3: 10
4: 176
904203671_904203677 4 Left 904203671 1:28838483-28838505 CCATTGTTACCCATCAGAGCCTC 0: 1
1: 0
2: 0
3: 6
4: 127
Right 904203677 1:28838510-28838532 AGCACTGAAGTTCCAACACAGGG 0: 1
1: 0
2: 3
3: 10
4: 176
904203673_904203677 -6 Left 904203673 1:28838493-28838515 CCATCAGAGCCTCTTCCAGCACT 0: 1
1: 0
2: 2
3: 25
4: 315
Right 904203677 1:28838510-28838532 AGCACTGAAGTTCCAACACAGGG 0: 1
1: 0
2: 3
3: 10
4: 176
904203670_904203677 5 Left 904203670 1:28838482-28838504 CCCATTGTTACCCATCAGAGCCT 0: 1
1: 0
2: 0
3: 7
4: 104
Right 904203677 1:28838510-28838532 AGCACTGAAGTTCCAACACAGGG 0: 1
1: 0
2: 3
3: 10
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904203677 Original CRISPR AGCACTGAAGTTCCAACACA GGG Intronic
901829908 1:11886029-11886051 AGCACTGGAGTTACAACAGCAGG + Intergenic
904203677 1:28838510-28838532 AGCACTGAAGTTCCAACACAGGG + Intronic
904850500 1:33455609-33455631 AGCACTGAAGTCCCAGAAGATGG - Intergenic
907365550 1:53956283-53956305 ATCACTGGGGTTTCAACACAAGG - Intronic
911866591 1:103033158-103033180 AGGAATGAAGTACTAACACATGG - Intronic
913476067 1:119239292-119239314 AGCACTGGAGTTGGACCACAGGG - Intergenic
915713856 1:157925824-157925846 CGCAGTGAAGCTCCACCACATGG - Intergenic
921456558 1:215379205-215379227 AGCACTGAGAGTCCAACACTTGG + Intergenic
922609416 1:226913471-226913493 AGCTCTGAAGTCACAACACAAGG + Intronic
923779221 1:237007337-237007359 AGAACTGAGGTTCCAAAATAGGG + Intergenic
924833963 1:247629225-247629247 AGAACTCAAGTTCCAACAGCTGG + Intergenic
1062801330 10:383040-383062 AGTACAGAAGTTCCAAGACAGGG + Intronic
1063280210 10:4620377-4620399 AGCCTTGAAGCTCCAGCACATGG + Intergenic
1064382559 10:14859294-14859316 AGCACAGAAGTGAAAACACAAGG - Intronic
1065341132 10:24706961-24706983 AGCAAACAAATTCCAACACAAGG + Intronic
1066154691 10:32662026-32662048 AGAACTCAAGTTCCAACAGCAGG + Intronic
1066440461 10:35433976-35433998 AGCACTTAAGTTCGCATACAAGG - Intronic
1067917113 10:50412019-50412041 AGCACAGCAGTTCCAGCATAAGG - Intronic
1072110210 10:92312429-92312451 TGCACTGAAGACCCATCACATGG - Intronic
1077584783 11:3442910-3442932 AGTTCTGAATTTCAAACACAGGG - Intergenic
1078707701 11:13760875-13760897 AGCACTGAAATTCCTAGAGAAGG + Intergenic
1079531531 11:21460396-21460418 AGCACTCAAATTGCAAAACATGG + Intronic
1080058199 11:27929239-27929261 AACTCTTAAGTTCCAACAAAAGG + Intergenic
1080623953 11:34011703-34011725 AGCACTGCAGCTCAAACAGAGGG + Intergenic
1082099877 11:48163767-48163789 AGCCCTGAGCTTCCAAAACAGGG + Intronic
1084375168 11:68772049-68772071 AGCACTCAAGTTTTAATACAAGG + Intronic
1086382719 11:86274583-86274605 AGTAATGAAGCACCAACACAAGG - Intronic
1089833697 11:121351200-121351222 TGCTCTGAACTTCCAGCACATGG + Intergenic
1091858028 12:3754560-3754582 AGCACTGAGATTCAAACCCAGGG - Intronic
1092961541 12:13601219-13601241 AGGCCAGAAGTTCCAAAACAAGG + Intronic
1093654693 12:21681335-21681357 AGCACTCAACTTCCAACATGAGG + Intronic
1094395378 12:29999744-29999766 AGAACTGCAATTCCAACCCAGGG + Intergenic
1097117144 12:56705875-56705897 AACTCTGGAGTTCCAACAAAAGG + Intergenic
1101384414 12:104243800-104243822 AAAACTCAAGTTCTAACACATGG + Intronic
1104184240 12:126413653-126413675 TGCACTAAAGTTGCATCACAGGG - Intergenic
1106199386 13:27523806-27523828 AGCACTGCAATTTGAACACATGG - Intergenic
1106440506 13:29762832-29762854 AGCACTTTATTTCCAACATAAGG + Intergenic
1107028090 13:35824083-35824105 ACCCCTGGAGTTCCACCACAGGG + Intronic
1107754963 13:43611180-43611202 ACCACTGATGTTCCAATGCAAGG + Intronic
1107896477 13:44969715-44969737 AGCACTACAGAGCCAACACATGG + Intronic
1109924359 13:69115733-69115755 AACAGTGAATTTCCAAGACATGG + Intergenic
1111058450 13:82980697-82980719 AGCACTTAACTGCCAAGACAAGG + Intergenic
1113081127 13:106521294-106521316 AGCACAGAAATTCAAACACACGG + Intronic
1113640039 13:111950880-111950902 AGCAGAGAAGATACAACACATGG + Intergenic
1113845800 13:113390555-113390577 AACTCTTAAGTTCCAACAAAAGG - Intergenic
1115378147 14:32701982-32702004 AACACTGAAATTCCAATATAAGG - Intronic
1115515690 14:34182774-34182796 CCTACTGAAGTGCCAACACAGGG - Intronic
1116876567 14:50118118-50118140 AGCACTGAGGATCCAAGACAAGG + Exonic
1119374126 14:74175304-74175326 AGCACTTAACTTAAAACACAAGG + Intronic
1124637705 15:31375488-31375510 AGAACTGAAGTCCCAAAATAAGG - Exonic
1128881549 15:71247726-71247748 AGCAGTGAAGGGGCAACACAGGG + Intronic
1129249631 15:74301772-74301794 AGCACAGAAATTCAAGCACAGGG + Intronic
1132102798 15:99037689-99037711 AGAACAGAAGTTACAAGACATGG + Intergenic
1132780713 16:1623419-1623441 AGCACTGGTGATCCAAGACAAGG - Intronic
1134865786 16:17605500-17605522 AACACTTATATTCCAACACAAGG - Intergenic
1135045523 16:19151964-19151986 ACCCCTGAAGTCTCAACACAGGG - Intronic
1136606433 16:31337385-31337407 ATCACGGAAGGTCCTACACATGG - Intergenic
1137583650 16:49650799-49650821 AGGCCTGAACTTCCAACCCAGGG + Intronic
1141015380 16:80444194-80444216 AGCACAGAAGTTCAAAATCAAGG - Intergenic
1141229949 16:82157330-82157352 ATTACTGATGTTCCAAAACAAGG + Intronic
1141352223 16:83308732-83308754 AGCTCTGAACTTCCCACATATGG - Intronic
1144020865 17:11239827-11239849 AGCACAGAGATTTCAACACAGGG + Intergenic
1144418393 17:15072914-15072936 AGAAATGAAGACCCAACACATGG - Intergenic
1148584484 17:48767747-48767769 AGCACTGAAGTTCAGACGGAGGG + Intronic
1151330561 17:73404402-73404424 AGCACTGAAGTTCCATCCCACGG - Intronic
1153014939 18:575097-575119 AGCACTGGAATTCCACAACAGGG - Intergenic
1153908809 18:9688253-9688275 AGAACAGAAGTGCCAACACCTGG - Intergenic
1153917130 18:9756004-9756026 ATCAATGAATTTCCAACTCAAGG - Intronic
1155107892 18:22685942-22685964 AGTACAGAAGTCCAAACACATGG + Intergenic
1157179032 18:45479068-45479090 AGCAGTAAAGTTCCAACCTAGGG - Intronic
1157485006 18:48080613-48080635 AGCTCTGAAGTGCCCTCACATGG + Intronic
1157954463 18:52081560-52081582 TGCACTTAAGTTCCAACCCCTGG - Intergenic
1158232524 18:55274026-55274048 AGAACTGAAATTCCAACATGCGG + Intronic
1158512751 18:58106150-58106172 AGCACGGATGTCCCTACACAGGG - Intronic
1158574962 18:58629063-58629085 AGCCCTCAAGTTTCATCACAGGG - Intergenic
1158984132 18:62796394-62796416 AGCACAGTAGTTCCAAAACATGG - Intronic
1159220962 18:65462654-65462676 AGCACTGAAAATCAGACACAAGG - Intergenic
1160250520 18:77199879-77199901 AGCCTTGTAGTTTCAACACATGG - Intergenic
1164774554 19:30842729-30842751 AGCACTCAAGGACCCACACAGGG - Intergenic
1168419535 19:56192334-56192356 AGCCCCTAAGTTCTAACACAAGG - Intronic
925314094 2:2908070-2908092 AGCTCTGAAGCTCCCACACTGGG - Intergenic
925639057 2:5969943-5969965 AGCTCTGATGTTCCAAGACAAGG - Intergenic
926875647 2:17475088-17475110 AGCACTAAAGAGCCAAAACATGG - Intergenic
927044379 2:19262484-19262506 AGCACTGAAGTTCAAAGCCATGG - Intergenic
927601818 2:24449473-24449495 AGCAGAGAAGATCCAACATATGG - Intergenic
930900730 2:56504879-56504901 AGCCCTGAAGTTCAATGACAAGG - Intergenic
932143736 2:69301069-69301091 AGCAATGAAGTTCTGACACATGG - Intergenic
935413043 2:102786157-102786179 AGCACTGGAATTCCGGCACATGG + Intronic
938619156 2:133031437-133031459 GGCACTCAAGTTCCAACAGCTGG - Intronic
939750862 2:146044592-146044614 CTCACTGAAGTTTCAACACCTGG - Intergenic
939986356 2:148833260-148833282 AGCACTGGACTTCAAACCCAGGG - Intergenic
940927999 2:159389211-159389233 AGCAGTGAATTTCCAACTCTAGG - Intronic
944542507 2:200767186-200767208 AGGCCTGAAGTTCAAACTCAAGG + Intergenic
944677314 2:202044451-202044473 AAAACTGAATTTCCAACAAAGGG + Intergenic
945352159 2:208793709-208793731 AACACTGATGTTCCACCTCAAGG + Intronic
945491263 2:210458111-210458133 AGCACAGAGCTTCCAACTCATGG - Intronic
946877241 2:224141481-224141503 TGCTCAGCAGTTCCAACACACGG - Intergenic
1169028411 20:2388894-2388916 ACCACTGAAGTTACATCACCAGG - Intronic
1169614814 20:7429006-7429028 AGCACTGCAGTTCCAACATAAGG + Intergenic
1171490232 20:25511660-25511682 ACCAATGAAGATCCACCACAAGG + Intronic
1171779320 20:29405058-29405080 AACACTGAAGTTCCAACCACTGG - Intergenic
1172569457 20:35957896-35957918 ATCACTTAGCTTCCAACACAAGG + Intronic
1173946271 20:46953317-46953339 AGCACTGAGGTTCCATAACCAGG - Intronic
1177017442 21:15809826-15809848 AGCACAGAAGTTCTGACATATGG + Intronic
1181896209 22:26110090-26110112 AGCAGTGAATTTCCAGCAAATGG - Intergenic
1181908015 22:26215074-26215096 AGCCCTGAACTTTCATCACATGG + Intronic
1184940075 22:47757687-47757709 AGCATGGCAGTTCCAAAACAAGG + Intergenic
950243198 3:11390495-11390517 AGGACTGCAGTCCCAACAAATGG + Intronic
950525462 3:13520392-13520414 AGGACAGAAGTTCCAACGGAAGG - Intergenic
951244089 3:20320085-20320107 AGCACTGAATTTCACACAGAGGG - Intergenic
953973557 3:47365600-47365622 AGGAATGAAGTACTAACACACGG - Intergenic
955631787 3:60982374-60982396 TGCACTTCAGTTCCTACACATGG + Intronic
956588767 3:70891194-70891216 AAGAATGAAGTTCCAACACCAGG - Intergenic
957085833 3:75675596-75675618 AACACTGAAGTTCCAACCACTGG + Intergenic
959867958 3:111292601-111292623 AGCACAGAAGTTGCAGCAGATGG - Intergenic
960363044 3:116736920-116736942 AGAGCTCAAGGTCCAACACAGGG - Intronic
961296308 3:125887269-125887291 AGTTCTGAATTTCAAACACAGGG + Intergenic
965746791 3:171934665-171934687 ATCCCTGAAGTTCCATGACAGGG - Intronic
965975412 3:174614354-174614376 AGAACTGAAGTTCCAACCACTGG + Intronic
966549396 3:181187558-181187580 ATCACTGAATTTGCAACACTTGG + Intergenic
967436525 3:189453496-189453518 AGCACTGGTTTTCCATCACAAGG - Intergenic
969606829 4:8206038-8206060 AGCCCTGGAGTCCCAAGACAGGG - Intronic
970832422 4:20357217-20357239 AGCATTGAAATTCCAAATCAAGG - Intronic
971655774 4:29342585-29342607 AGAACTTAGGTTCCAATACATGG + Intergenic
971921895 4:32951411-32951433 ACCACTAAAGTTCTAACTCAAGG - Intergenic
972527597 4:39931093-39931115 AGCCCAGCAGTTCCAAGACAAGG + Intronic
977999887 4:103545169-103545191 AGCTCAGAAGTTCCATAACAAGG - Intergenic
978089356 4:104695186-104695208 ATCACTGAACTTCCAAATCATGG + Intergenic
978843789 4:113247906-113247928 TGCTCTGTAGTTCCACCACAGGG + Intronic
979098047 4:116575780-116575802 AGCATTTAAGTGCCACCACATGG + Intergenic
979504536 4:121480419-121480441 AGAACTGAAGTTCCAACTGCTGG + Intergenic
981659793 4:147152806-147152828 ATCAGTGAAGTTCCAAAATAGGG - Intergenic
982736796 4:159014997-159015019 ATCACTGTAGTTATAACACATGG - Intronic
984226505 4:177041830-177041852 AGCACTGAAGTATGAGCACATGG - Intergenic
984392036 4:179148391-179148413 ATCACTGATTTACCAACACAGGG - Intergenic
985444183 4:190011931-190011953 AACACTGAAGTTCCAACCACTGG - Intergenic
985955976 5:3266741-3266763 AGCACTGAAGTTTCAAGAGATGG - Intergenic
987206550 5:15633557-15633579 CAAACTGAAGTTCCAACACAAGG + Intronic
987881913 5:23758805-23758827 AGCAGTGAATTTGCAACATATGG - Intergenic
988032520 5:25782189-25782211 GGCAATTAAGTTTCAACACATGG - Intergenic
988941022 5:36147733-36147755 ACCTCTGAAGTTCCATCAAAGGG - Intronic
990236867 5:53778181-53778203 AGCACTAAGGGTTCAACACAAGG - Intergenic
990278578 5:54225970-54225992 AGCAGTGAGGTTCCAGCAGAGGG + Intronic
993600542 5:89918329-89918351 AACTCTTAAGTTCCAACAAAAGG + Intergenic
994191717 5:96876142-96876164 AGCACTGAGGATGCAGCACAAGG + Exonic
998622153 5:143806742-143806764 AGCATTGAAGTTCCGGTACATGG - Intergenic
998893893 5:146777296-146777318 AGGAATGAAGTTCTAATACATGG + Intronic
1000640019 5:163690674-163690696 ATCACTGAAGTTCAAAACCAAGG + Intergenic
1002313324 5:178327888-178327910 AGCACTCAGTTTCCCACACAGGG - Intronic
1007173460 6:39880317-39880339 CTCACTGAAGCTCAAACACATGG - Intronic
1008162695 6:48098203-48098225 AGAACTGAAGTTCCGATGCAAGG + Intergenic
1008182965 6:48355991-48356013 AGCACTGAACTCCCAACTCCTGG - Intergenic
1012198484 6:96375155-96375177 AACATTGAAATTGCAACACAGGG + Intergenic
1012968083 6:105697144-105697166 AGAGCTGAAATTCCAACTCAGGG - Intergenic
1014394931 6:120915712-120915734 AGTATTGAATTTCTAACACATGG - Intergenic
1016643918 6:146381286-146381308 GGCACTTAAGTTCAAACCCATGG + Intronic
1017042452 6:150318283-150318305 AGCTCAGAAGTATCAACACACGG - Intergenic
1017065436 6:150524463-150524485 AGCCCTCAAGTCCCCACACAAGG + Intergenic
1019184515 6:170213319-170213341 AGCGCTGAAGTCTCCACACAAGG + Intergenic
1022340478 7:29463066-29463088 AGCCCTAGAATTCCAACACAAGG + Intronic
1023488427 7:40711648-40711670 AGCGCTGAAGTTTCAAAAGATGG - Intronic
1023747489 7:43334905-43334927 AGAACAGAAGTTCCAAGAAAAGG - Intronic
1023913842 7:44573859-44573881 AGCACTGGGCTTCGAACACATGG - Exonic
1026498295 7:70921994-70922016 AGCACTGCGGTTCCAACACACGG - Intergenic
1026620430 7:71945372-71945394 CGCAGTTAAGTACCAACACAAGG + Intronic
1030376330 7:108756598-108756620 AGCACTGAGCTTCCAACTCCTGG - Intergenic
1031177854 7:118375208-118375230 ATCACTCAAGGTTCAACACATGG - Intergenic
1031773445 7:125875711-125875733 AGCAGTGTAGTTGCAACTCAAGG - Intergenic
1033251269 7:139762190-139762212 AGCAATGAAGTTCCAACTTGGGG - Intronic
1038480884 8:27901254-27901276 AGACCTGAAGTTCCAGCAGATGG - Intronic
1042916981 8:73885051-73885073 AGAACAAAATTTCCAACACATGG + Intergenic
1045174454 8:99706807-99706829 AGCACTGTAGCCCCAACCCAAGG + Intronic
1050929432 9:11305100-11305122 AGCACTGAAATAAAAACACAAGG + Intergenic
1051225580 9:14895721-14895743 AACTCTGGAGTTCCAACAAAAGG - Intronic
1054844682 9:69781619-69781641 AACTCTGGAGTTCAAACACAAGG - Intergenic
1058793024 9:108470086-108470108 AGCAGTGAGGGTGCAACACAAGG + Intergenic
1059376738 9:113887809-113887831 AAAGCTGAATTTCCAACACATGG - Intronic
1060271673 9:122147326-122147348 AGCTCTGATGTTTCAACAGATGG + Intronic
1061011137 9:127955313-127955335 GGCACTGAAGCTCCAAAAGAAGG + Intronic
1061434949 9:130555220-130555242 ATGACTGAAGTGCCCACACATGG + Intergenic
1186847531 X:13545304-13545326 AGCACTGCAGTTCTGTCACATGG + Intergenic
1188220362 X:27533916-27533938 AGCACTGTAATCCCAGCACATGG + Intergenic
1191197416 X:57739915-57739937 AGTACTGGAATTCCTACACAAGG - Intergenic
1195053071 X:101115971-101115993 AGGAATGAAGTTCCGATACATGG - Intronic
1195093294 X:101484051-101484073 TGCAGTGAAGTTGTAACACAAGG + Intronic
1195115653 X:101695847-101695869 AGAACTGAAGTTCCAACTACTGG - Intergenic
1195606490 X:106811215-106811237 AGAACTGAAGTTTTAAAACAAGG + Intronic
1196694361 X:118595320-118595342 AGCAATGAAGTTTCAAAACTGGG + Intronic
1201800345 Y:17948228-17948250 AGGACAGAACTTCCAACACTAGG - Intergenic
1201801208 Y:17957728-17957750 AGGACAGAACTTCCAACACTAGG + Intergenic