ID: 904204622

View in Genome Browser
Species Human (GRCh38)
Location 1:28845679-28845701
Sequence ATTTTCTTCTAGGAGTTTTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 24006
Summary {0: 9, 1: 140, 2: 1479, 3: 15880, 4: 6498}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904204618_904204622 9 Left 904204618 1:28845647-28845669 CCAAATCTGGTGTCATGAAGCTT 0: 1
1: 4
2: 36
3: 163
4: 571
Right 904204622 1:28845679-28845701 ATTTTCTTCTAGGAGTTTTATGG 0: 9
1: 140
2: 1479
3: 15880
4: 6498

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904204622 Original CRISPR ATTTTCTTCTAGGAGTTTTA TGG Intronic
Too many off-targets to display for this crispr