ID: 904205021

View in Genome Browser
Species Human (GRCh38)
Location 1:28848676-28848698
Sequence CTGTGAGAGGTGGGGAAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1043
Summary {0: 1, 1: 0, 2: 12, 3: 109, 4: 921}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904205014_904205021 9 Left 904205014 1:28848644-28848666 CCCAGTTTATAGTAAGTTCACAT 0: 1
1: 0
2: 1
3: 18
4: 282
Right 904205021 1:28848676-28848698 CTGTGAGAGGTGGGGAAGGAAGG 0: 1
1: 0
2: 12
3: 109
4: 921
904205013_904205021 10 Left 904205013 1:28848643-28848665 CCCCAGTTTATAGTAAGTTCACA 0: 1
1: 0
2: 1
3: 12
4: 189
Right 904205021 1:28848676-28848698 CTGTGAGAGGTGGGGAAGGAAGG 0: 1
1: 0
2: 12
3: 109
4: 921
904205015_904205021 8 Left 904205015 1:28848645-28848667 CCAGTTTATAGTAAGTTCACATT 0: 1
1: 0
2: 0
3: 23
4: 191
Right 904205021 1:28848676-28848698 CTGTGAGAGGTGGGGAAGGAAGG 0: 1
1: 0
2: 12
3: 109
4: 921

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904205021 Original CRISPR CTGTGAGAGGTGGGGAAGGA AGG Intronic
900117533 1:1034911-1034933 CTGCGGGAGCTGGGGAGGGAGGG + Intronic
900139388 1:1133220-1133242 CTGAGAGTGGTGGGGAGGGCAGG + Intergenic
900327868 1:2118751-2118773 GTGTGAGATGAGGGGAGGGAGGG + Intronic
900479110 1:2889698-2889720 CTGAGGGAGGTGGGGAAGTCGGG + Intergenic
900520719 1:3104324-3104346 CTGGGAGGGGTGGGGTTGGAAGG + Intronic
901159065 1:7161278-7161300 CTGTGCAGGGTGGAGAAGGAGGG - Intronic
901652703 1:10752254-10752276 CAGGGAGAGGTGGGCAGGGATGG - Intronic
901665337 1:10823038-10823060 CGGGGAGGGGTGGGGCAGGATGG - Intergenic
901827876 1:11874392-11874414 CTGTGACATGTGGGAAATGAGGG + Intergenic
902129127 1:14243375-14243397 CTCTGGGAGGTGGAGGAGGAGGG + Intergenic
902264439 1:15251918-15251940 CTGTTAGAGAGGGAGAAGGAAGG - Intronic
902689627 1:18102173-18102195 GAGTGAGAGCAGGGGAAGGAGGG + Intergenic
902923119 1:19679096-19679118 CTGTGAGAGGTGCGCAGTGATGG - Exonic
902987022 1:20161092-20161114 CTGTGTGAGGAGGAGATGGAGGG + Intergenic
903099494 1:21016440-21016462 CTTTGAGAGGTGGAGGTGGAAGG + Intronic
903407078 1:23106813-23106835 CTGTGGAGGGTGGGGAAGGATGG - Intronic
904088845 1:27930411-27930433 ATGGGACTGGTGGGGAAGGAGGG - Intergenic
904205021 1:28848676-28848698 CTGTGAGAGGTGGGGAAGGAAGG + Intronic
904205336 1:28851052-28851074 CTAGGAGAGATGGGGAAGGAAGG + Intronic
904419998 1:30385250-30385272 CTGTAGGAGATGGGAAAGGAGGG - Intergenic
904513251 1:31032026-31032048 CTGTAAGAGGTAGGGCAGGAGGG - Intronic
904822427 1:33254956-33254978 GTGAGCGAGGTGGGGAAGAAAGG - Intergenic
905371719 1:37486031-37486053 CTGTGAAAGGAGGAGAGGGAGGG + Intergenic
905443042 1:38006421-38006443 CTGGAAGAGGTGGGGGAGGGAGG + Intergenic
905602769 1:39268538-39268560 CAGAGAGAGGCGGGGAGGGAGGG + Intronic
905949450 1:41936374-41936396 CCCTGAGAGGTGGAGATGGAGGG + Intronic
906069660 1:43007667-43007689 CGGGGAGGGGAGGGGAAGGAGGG - Intergenic
906635898 1:47410342-47410364 CGGTGAGAAATGAGGAAGGAGGG + Intergenic
906925380 1:50110355-50110377 CTAGGAGTGATGGGGAAGGATGG + Intronic
906943149 1:50273365-50273387 CAGTGAGAGATGGGCAAAGAAGG + Intergenic
907459018 1:54594224-54594246 CAGGGAGAGGTGGGGAAAGGAGG - Intronic
907523137 1:55038191-55038213 CTGAGGGAGGTGGGGGAGGAAGG - Intergenic
907615503 1:55920719-55920741 CTGTGAAAGGGGGGGTGGGAAGG + Intergenic
907797975 1:57736739-57736761 GTGAGAGAGGGAGGGAAGGATGG - Intronic
907918128 1:58889237-58889259 CTATCAGAGGTGGGGAAAAAAGG - Intergenic
907951837 1:59190776-59190798 GTGGGGGAGGTTGGGAAGGACGG - Intergenic
908044793 1:60157015-60157037 CTGTGGGAGGTGGTTAAGGGAGG + Intergenic
908262382 1:62349334-62349356 GTGAGAGAGGAGGGGAAGGGAGG + Intergenic
910237089 1:85047943-85047965 CTGTTAGAGGTGGGGGCGGCTGG - Intronic
912458298 1:109814247-109814269 CTGTTAGAGGAGGGGAAGTGGGG - Intergenic
912525634 1:110280809-110280831 GTGTGGGAGGTGGCCAAGGATGG - Intronic
913238644 1:116807816-116807838 CTGGAAGAGGAGGGAAAGGAGGG - Intergenic
913320219 1:117582721-117582743 CTGTGGGCAGTGGGGGAGGATGG + Intergenic
913412311 1:118565545-118565567 ATGTCTGAGGTGGGGAAGAATGG - Intergenic
914377798 1:147087887-147087909 CTTTGGGAGGTGAGGCAGGAGGG - Intergenic
914804569 1:150982880-150982902 TGGGGAGAGGTGGGGAAGGTGGG + Intronic
915322507 1:155063546-155063568 CTGCGAGGGGGCGGGAAGGAAGG - Intergenic
915324223 1:155072428-155072450 ATGGGAGAGGTGGGGTATGAAGG - Intergenic
915605531 1:156947896-156947918 CTCTAGGAGGTGGGGAAGGAGGG + Exonic
915661826 1:157411244-157411266 CTGTGCCTGGTGGGCAAGGAAGG + Intergenic
915937148 1:160096264-160096286 TTGGGAGAGGTGGGGAGGGGTGG - Intronic
915951398 1:160192003-160192025 CTCAGAGGGGTGGGGAAGGGAGG - Intronic
916063510 1:161118258-161118280 CTGGGAGAGGCGGGGAGGGACGG + Intronic
916448987 1:164901623-164901645 CAGTGGGAGGAGAGGAAGGATGG + Intergenic
916611797 1:166398700-166398722 CTGTGGGAGGTGGGATAGGAGGG - Intergenic
916793663 1:168146139-168146161 CGGGGAGGGGTGGGGAGGGACGG + Intergenic
916793674 1:168146159-168146181 CGGGGAGGGGTGGGGAGGGACGG + Intergenic
917081560 1:171261298-171261320 CTGTGTGTGTTGGGGAAGGAGGG - Intronic
917101545 1:171451152-171451174 CTGTCAGAGGTGGGGAAGGTGGG - Intergenic
917533100 1:175854745-175854767 CTCTGTGAGCTGGGGAGGGATGG - Intergenic
917740527 1:177958066-177958088 CGGTGAGTGGTGGAGAGGGATGG + Intronic
917854956 1:179092319-179092341 CTTTCAGAGCTGGGTAAGGAGGG + Intronic
918126979 1:181592768-181592790 ATGGGAGAGTTGGGGAAAGAAGG - Intronic
918194902 1:182212122-182212144 TTGTGGAAGGTGGGGAAGGAAGG + Intergenic
918239296 1:182607800-182607822 TTGGGAGAAGTGGGGAGGGAGGG - Intergenic
919567761 1:199210002-199210024 CTGTCAGAGGTGGGGAGCTAGGG - Intergenic
919725538 1:200880359-200880381 ATGAGAGAGCTGGGGAAAGACGG + Intergenic
919742312 1:200988545-200988567 CTGTGGGAGGGCGGGAGGGAGGG + Intronic
919975135 1:202605529-202605551 CTGGGAGAGGTGAAGAAGGGTGG - Intronic
920035118 1:203060521-203060543 CTTTGTGAGGATGGGAAGGAAGG - Intronic
920288064 1:204895947-204895969 CTGTAAGAGGTTGAGAATGAAGG + Intronic
920419331 1:205820465-205820487 CAGGGAGAGGAGGGGAGGGAAGG - Intergenic
920436182 1:205948454-205948476 CTGAGAGAGCTGGAGAAGCATGG + Intergenic
920707684 1:208266505-208266527 CTGGGAAAGGTGGGAGAGGAGGG - Intergenic
920835753 1:209509364-209509386 ATCTGTCAGGTGGGGAAGGAGGG - Intergenic
921065606 1:211620433-211620455 CTGTGAGCGTGGGGGAAGTAGGG + Intergenic
921130988 1:212219792-212219814 CAGTGAGAGGGTGGGAGGGATGG + Intergenic
921412239 1:214848096-214848118 GTGTGATGGGTGGGGGAGGAGGG - Intergenic
921475083 1:215596962-215596984 CTGTGACAGAAGGGTAAGGAAGG + Intronic
922515950 1:226208513-226208535 CTGAGAGAGGTTGGGAAGGAGGG + Intergenic
922516780 1:226213940-226213962 GTATGCGAGGTGAGGAAGGATGG + Intergenic
922545820 1:226456078-226456100 CTGTTGGAGGTGAGGAATGAGGG - Intergenic
922785407 1:228280079-228280101 CTGTGGAAGGTGGGGCATGAGGG + Exonic
923015877 1:230126382-230126404 CTCTGAGAGGGAGGGATGGAAGG + Intronic
923080743 1:230652169-230652191 CCGGGAGAGGAGGGGAAGAATGG - Intronic
923132576 1:231090052-231090074 CTTTGGGAGGTGGAGACGGATGG + Intergenic
923274761 1:232386406-232386428 CTGAGTGAGGAGAGGAAGGAAGG + Intergenic
923624292 1:235601610-235601632 CTGTGAGAGGAAGGGGAGCATGG - Intronic
923800904 1:237207320-237207342 CTTTGAGAGGTGGAGGTGGATGG + Intronic
923917486 1:238525429-238525451 CTGTAATTTGTGGGGAAGGAGGG + Intergenic
924009329 1:239647526-239647548 CTTTGGGAGGTGGGCAAGGAAGG - Intronic
924197299 1:241621614-241621636 CTGGGACAGGTGGGAAAGTAGGG + Intronic
924273889 1:242365216-242365238 CTGTATGAGGTGGTGCAGGAAGG + Intronic
924543900 1:245007248-245007270 TGGGGAGGGGTGGGGAAGGATGG + Intronic
924664618 1:246058318-246058340 GTGTTGGAGGTGGGGGAGGAGGG + Intronic
1063298270 10:4827465-4827487 CTGGGGGAGGTGAGGAAGGAGGG - Intronic
1063432862 10:6006195-6006217 CAGTGAGAGGAGATGAAGGAGGG + Intergenic
1063703152 10:8405173-8405195 CTTTGAGAGGCGGGAAAAGAGGG - Intergenic
1063869381 10:10401596-10401618 CTTTGGGAGGTGGGGGAGGGCGG - Intergenic
1064279516 10:13938837-13938859 CTGTTGGAGGTTGGGGAGGACGG - Intronic
1064283741 10:13973689-13973711 AAGTGAGGGGAGGGGAAGGAAGG + Intronic
1064418268 10:15168792-15168814 CGGTGAGGGGCGGGGATGGAGGG - Intergenic
1064538265 10:16380140-16380162 CTGTGAGACTTGGGGCAGGTGGG - Intergenic
1064640795 10:17414066-17414088 GGGTGTGAGTTGGGGAAGGAGGG - Intronic
1064886132 10:20114476-20114498 CTGTAAGAGGTGGTGAGAGAGGG + Intronic
1065581344 10:27174986-27175008 GTGTGAGAGGTGGGGTGGGGAGG - Intronic
1065820894 10:29524467-29524489 CTGGGAGAGGTGGAGCAGGTGGG - Exonic
1066292478 10:34027006-34027028 CCCCAAGAGGTGGGGAAGGAGGG - Intergenic
1066397587 10:35041249-35041271 CTGAGAGAGGTGAAGGAGGATGG + Intronic
1066456232 10:35574706-35574728 TTGGGAGAGCTGGGGAAGAAGGG - Intergenic
1066710824 10:38231460-38231482 CTGTATGAGGTGGTGCAGGAAGG - Intergenic
1067196684 10:44125960-44125982 CTGGAGGAGATGGGGAAGGAGGG + Intergenic
1067267263 10:44757084-44757106 ATGGGAGAGATGGGGATGGAGGG - Intergenic
1067792835 10:49300832-49300854 CTGTGTGCGGTGGGTAAGAAGGG + Intronic
1067979410 10:51067176-51067198 CTGTGGGAGGTGGGATAGGATGG + Intronic
1068080553 10:52313685-52313707 CGGGGGGAGGTGGGGGAGGAGGG + Intergenic
1068326013 10:55487488-55487510 CTATGAGAGGTAGAGAATGAAGG - Intronic
1069410261 10:68146195-68146217 CAGCCTGAGGTGGGGAAGGAAGG - Intronic
1069456729 10:68560192-68560214 TTGAGAGAGGTGGAGAACGAGGG + Intergenic
1069618746 10:69823358-69823380 TCTTTAGAGGTGGGGAAGGAAGG + Intronic
1069637184 10:69932041-69932063 CTGCGGGAGGTGGGGAGGGCAGG - Intronic
1069638881 10:69942374-69942396 GTTTGCTAGGTGGGGAAGGATGG - Intronic
1070711902 10:78689122-78689144 CTGTGTGGGGAGGGGCAGGAGGG - Intergenic
1070769819 10:79075712-79075734 CTAAGAGTGGTGGGGGAGGACGG - Intronic
1070956059 10:80464400-80464422 CTGGGATGGGTGGGGAAGGAGGG + Intronic
1071003061 10:80853036-80853058 CTGTGGGAATTGGGCAAGGATGG - Intergenic
1071268286 10:83983784-83983806 CTGTGGGAGGTGGGAAGAGAGGG - Intergenic
1071383495 10:85096368-85096390 CTCTGTGGGGTGGGGAAGGTAGG - Intergenic
1071971908 10:90916096-90916118 GTGGGAGAAGTGGAGAAGGATGG + Intronic
1073113700 10:101078830-101078852 CTGGGAGTGGAGTGGAAGGATGG - Intergenic
1073116123 10:101092995-101093017 CTGGGAGGGGTGGGACAGGAGGG + Intronic
1073173552 10:101534533-101534555 CTGGGAGAGTGGGAGAAGGAAGG - Intronic
1073248572 10:102108040-102108062 CTGTGAGGGGTGGGGCAGGTAGG + Exonic
1073300820 10:102470150-102470172 GTGTTTGGGGTGGGGAAGGAAGG + Intronic
1073468903 10:103710720-103710742 GGGTGAGAGGTGGGGATGGCAGG + Intronic
1073503521 10:103964564-103964586 CTATGAGTAGGGGGGAAGGAAGG + Intergenic
1073600110 10:104838396-104838418 CTGTGAGTGGTGGGAGAGGTCGG + Intronic
1074262069 10:111863978-111864000 CTGTAAGAGATATGGAAGGAAGG + Intergenic
1074882063 10:117667231-117667253 CAGAGAGAGGTTGGTAAGGAGGG + Intergenic
1075097779 10:119483957-119483979 CTGTTAGAGGCGGGCAAGTACGG - Intergenic
1075426947 10:122349410-122349432 CAGAGAGTGGTAGGGAAGGAGGG - Intergenic
1075627232 10:123972284-123972306 ATGGGAGAGGCGGGGATGGAGGG + Intergenic
1075849503 10:125575516-125575538 CAGTGAGAGGTGGGGGAAGCAGG - Intergenic
1076262139 10:129075644-129075666 GTGTGACAGCTGGGGAGGGATGG - Intergenic
1076595739 10:131623451-131623473 AGGTGAGAGGTGGGGGAGAAAGG + Intergenic
1076980923 11:204296-204318 CAGGGAGAGGTGGGTAGGGAGGG + Exonic
1077273092 11:1690956-1690978 CTGTGGGAGGTGGGGCTGGCAGG + Intergenic
1077295346 11:1823843-1823865 CTGTCAGAGGCGGGAAAGGCAGG + Intergenic
1077315105 11:1916163-1916185 CTGGGAGAGGAGGGACAGGAGGG - Intergenic
1077337558 11:2012187-2012209 ATGTGAGAGGGGGTGACGGAAGG + Intergenic
1077485864 11:2838175-2838197 CAGACAGAGGTGGGGATGGAAGG + Intronic
1077490876 11:2860393-2860415 CTGTGGCATGTGGGCAAGGAGGG - Intergenic
1077640784 11:3879585-3879607 CTCTGTGAGGTGGGACAGGAGGG + Intronic
1077760535 11:5091314-5091336 GTGTGAGAGGAGGGGAAGTTTGG + Intergenic
1078047566 11:7930439-7930461 CTGTGAGAGATGAGGAAGCCAGG + Intergenic
1078411173 11:11120089-11120111 CTGAGAGAGGGAGGGAGGGAAGG - Intergenic
1078857209 11:15215877-15215899 CTCTGAGAGGGGAGTAAGGAGGG + Intronic
1079064538 11:17277485-17277507 CTGGGAGAGGGAGGGAAAGAAGG + Intronic
1079711286 11:23685404-23685426 GGGTGGGAGGTGGGGAAGTAGGG + Intergenic
1080385858 11:31810736-31810758 CGGCGAGAGGGGAGGAAGGAAGG + Intronic
1081010608 11:37806674-37806696 CTATGTGTGTTGGGGAAGGAGGG + Intergenic
1081588824 11:44406860-44406882 CAGTGCGAGGTGGGGCTGGAAGG + Intergenic
1081612150 11:44569039-44569061 CTGTGAGAGGTGGGAAGGGAGGG + Intronic
1081770090 11:45644957-45644979 CTTTGGGAGGTGGAGAAGGGTGG - Intergenic
1083012233 11:59413629-59413651 CTGACAGAGCTGGGGAGGGATGG + Intergenic
1083228952 11:61303006-61303028 CTGGGAGTGGTGGGGAGGGCTGG - Intronic
1083234606 11:61343598-61343620 CAGTGAGAGCTGGAGAAGGCTGG - Intronic
1083399122 11:62411787-62411809 GTGTGAGAGGTGGGGGAGTGTGG - Intronic
1083619155 11:64040470-64040492 CTGAGAGAGCTGGGGATGGATGG - Intronic
1083732196 11:64658545-64658567 CTGAGAGAGGTGGGGACTGGAGG - Intronic
1083827617 11:65212177-65212199 CCCTGGGAGGTTGGGAAGGAGGG + Intergenic
1084153490 11:67301964-67301986 GTGTGAGGGGTGGGGAAGCAGGG + Intronic
1084192070 11:67503941-67503963 CTGTGGGAAGAGGGGCAGGAGGG - Intronic
1084341726 11:68508371-68508393 CTGTGAGAGGTGGAGGTGGGTGG - Intronic
1084402967 11:68955894-68955916 CTGTGTGTGGCTGGGAAGGAGGG - Intergenic
1084519027 11:69651530-69651552 CCCTGAGCGGTGGGGGAGGAGGG + Exonic
1084617543 11:70246471-70246493 GTGGGAAAGCTGGGGAAGGAGGG + Intergenic
1084722060 11:70913101-70913123 CTGTGAGAGGATGGGAGGGTAGG - Intronic
1084792598 11:71484059-71484081 CTGTCAGAGCTGGAGGAGGAGGG + Intronic
1084876484 11:72137346-72137368 CTGAGAGTGGTGGAGAACGAAGG - Intronic
1085809618 11:79668165-79668187 CGTGGAGAGGTGGTGAAGGAGGG + Intergenic
1085879059 11:80444128-80444150 ATGTCAAAAGTGGGGAAGGAAGG + Intergenic
1085942813 11:81225722-81225744 TTGACAGAGGTGGGGAAGCATGG - Intergenic
1086076961 11:82864974-82864996 GTGGGAGAGGTGGGGATGGGAGG + Intronic
1086098207 11:83071590-83071612 CTGTGAGCGGTGGGGAGGTGGGG - Intronic
1086250963 11:84813860-84813882 CAGTGAGAGGTGTAGAGGGAGGG - Intronic
1086521489 11:87673193-87673215 CTGTCAGAGGTTGTGATGGAGGG - Intergenic
1087508494 11:99059073-99059095 GGGAGAGAGGTGGGGAGGGAGGG - Intronic
1087829379 11:102802471-102802493 ATGTAAGAGCTGGGAAAGGACGG - Intergenic
1088960693 11:114661962-114661984 CTGTAGGAGGTGGGGTAAGATGG + Intergenic
1089167453 11:116488169-116488191 CTGGCAGAGCTGGGGAGGGATGG + Intergenic
1089254048 11:117184702-117184724 CTGTGATAGGAGGGGAAAGAAGG + Intronic
1089539501 11:119181488-119181510 CTGGGGGAGGTGGGGAGAGAGGG + Intronic
1089586981 11:119516043-119516065 CTTTGAGAAGTTGGGTAGGAGGG - Intergenic
1089676867 11:120096147-120096169 CTGGAAGGGGTGAGGAAGGAGGG + Intergenic
1090028168 11:123185245-123185267 TTGGGAGAGTTGGGGAGGGAGGG + Intronic
1090063065 11:123480373-123480395 GTGTGAGATGTGTGGGAGGAGGG - Intergenic
1090227141 11:125078533-125078555 ATGTGAGGGGTGGGGAGGAAAGG + Intronic
1090727852 11:129543867-129543889 CTGAGGGAGGGAGGGAAGGAGGG + Intergenic
1090888859 11:130904917-130904939 CTGTGAGATGTGTGAAGGGATGG + Intronic
1090926399 11:131254319-131254341 CTGCGCGTGGTGGGGAAGGGGGG - Intergenic
1091022901 11:132116774-132116796 CTGTTAGATGTGGTGAAGAAAGG - Intronic
1091206524 11:133824979-133825001 ATGTCAGAGGTGGAGATGGAAGG + Intergenic
1091238216 11:134035613-134035635 CTGTGTGATGTAGGGAAGGATGG - Intergenic
1202820542 11_KI270721v1_random:67369-67391 ATGTGAGAGGGGGTGACGGAAGG + Intergenic
1091482807 12:851539-851561 GTCTGAGAGTTGGGGAAGCATGG + Intronic
1091591451 12:1845315-1845337 CTCTGAGAGGGGGCGAGGGAAGG + Intronic
1091909889 12:4221084-4221106 CTGGGAGAAGTGGGGAACGGGGG - Intergenic
1091935994 12:4434921-4434943 CTGTGTGTGGTGGGGGAAGAAGG + Intronic
1092154272 12:6272330-6272352 CTGTGGGAGGTGGGGAAGGTGGG + Intergenic
1092783933 12:12011164-12011186 CTGAGAGAGGTGGGCAAAGAAGG - Intergenic
1092880174 12:12881974-12881996 CTTTGCGAGGTGGAGGAGGAAGG + Intergenic
1093057473 12:14568990-14569012 CAGTGGGAGAGGGGGAAGGAGGG + Intergenic
1093256373 12:16873167-16873189 CTCTGGGTGGTGGGGAAGGCTGG - Intergenic
1093844280 12:23949802-23949824 GAGAGAGAGGAGGGGAAGGAGGG - Intronic
1094523509 12:31217289-31217311 CAGTGAGGGGTGGGGAGGAAAGG - Intergenic
1095818076 12:46446713-46446735 AGGTGAAAGGAGGGGAAGGAGGG + Intergenic
1095959548 12:47825599-47825621 CTGGGAGAGGAGGGTAGGGAGGG - Intronic
1095970080 12:47895679-47895701 CTGTTGGTGTTGGGGAAGGACGG - Intronic
1095980734 12:47973274-47973296 CTGTGAGAGGGTGGGATGAATGG + Exonic
1095980819 12:47973770-47973792 CTGTGGGGAGTGGGGAAGGAGGG - Intronic
1096443300 12:51664879-51664901 CTGTCAGAGGTAGGGAATGGGGG - Intronic
1096670713 12:53196821-53196843 CTGGGAGAGGAGAGGAATGAAGG + Intronic
1096758167 12:53817302-53817324 CTCCAAGAGGTGGGGAAGGCAGG - Intergenic
1096977171 12:55706192-55706214 CTCTGACAGATGGAGAAGGAGGG + Intronic
1097008895 12:55938615-55938637 CTGGAAGAGTTGGGGCAGGAGGG - Intronic
1097053372 12:56236747-56236769 GTGTGAGGGGTGGGAACGGAGGG + Intronic
1097053891 12:56238918-56238940 GAGTGAGAGGTGGAGAAGGGAGG + Exonic
1097196226 12:57243698-57243720 CTGGGAGAGGAGGGGTAGGAAGG - Exonic
1097246868 12:57611756-57611778 CTGTGGGAGGGGGGGAGGGAGGG - Intronic
1097317057 12:58182927-58182949 CTGTGAGAGCTGGTGTAGAATGG + Intergenic
1097368480 12:58746240-58746262 AAGTGAGAGGAGGGGAAGGTGGG + Intronic
1097866174 12:64560847-64560869 CTGTGAGAGACGGGGAAGGAAGG + Intergenic
1098033625 12:66280149-66280171 CTTTGAGAGGTTGAGAAGGGAGG - Intergenic
1098080344 12:66777904-66777926 CTGAGAGAGGGAGGGAAGGAGGG - Intronic
1098095009 12:66945681-66945703 GTGTGAGAGGTGGGAACTGATGG - Intergenic
1098489567 12:71059697-71059719 CGGGGAGAGGTGGGGGATGAAGG + Intronic
1099524648 12:83704968-83704990 TGGGGAGAGGTGGGGAAGGGGGG - Intergenic
1100125786 12:91423093-91423115 CTGGGGTAGGTGGGGAATGAAGG + Intergenic
1100207925 12:92371254-92371276 CTGAGTGAGGTGGGGAAGGCAGG - Intergenic
1100363043 12:93895428-93895450 CTGTGGGAAGTGGGGAGGGGAGG - Intergenic
1100373806 12:93993877-93993899 CTGTGAGAGGTGAGGAGGGAAGG + Intergenic
1100562901 12:95767151-95767173 TGGTGAGGGGTGGGGAAGAAAGG - Intronic
1102164476 12:110795425-110795447 ATGTCAGAGATGGGGAATGATGG + Intergenic
1102658611 12:114505077-114505099 CATTGAGTGGTGGGGGAGGAAGG + Intergenic
1102938915 12:116921031-116921053 CTGGGTGTGGTGGTGAAGGAGGG - Intronic
1102955898 12:117058898-117058920 CTGTGAAAGGCAGGGGAGGAGGG - Intronic
1103126447 12:118426921-118426943 CTGTGTGAAGTGGGGAACTAGGG + Intergenic
1103175173 12:118857159-118857181 TTATTAGAGGTGGGGAAGGATGG - Intergenic
1103536724 12:121638584-121638606 AGGAGAGCGGTGGGGAAGGAAGG + Intronic
1103713006 12:122927098-122927120 CTGTGAGGGGTGGGGCATAAGGG + Intronic
1104163751 12:126206050-126206072 CTGTGAGAGAAGGGGTATGATGG + Intergenic
1104295304 12:127506471-127506493 TTGTGCGAGGTGCGGCAGGATGG - Intergenic
1104369192 12:128207950-128207972 CTGAGGGAGGTTGGGAAGAAAGG + Intergenic
1104476643 12:129075921-129075943 CTCTGAGAGGGAGGGAGGGAGGG - Intronic
1106652159 13:31703348-31703370 CTGTGAGCGGCGGGGGAGGTGGG + Intergenic
1106996865 13:35494764-35494786 CTTTGAGAGGCTGGGATGGATGG + Intronic
1107028683 13:35829181-35829203 CTGTGATAGGTGTAGGAGGAAGG + Intronic
1107133044 13:36916863-36916885 CTGTGGGAGGTGGGGAAGCTGGG + Intronic
1108518498 13:51223626-51223648 CTAGGAGTGGTGGGGCAGGAGGG - Intronic
1108633777 13:52312514-52312536 TTGAGAGAAGTGGGGATGGATGG + Intergenic
1108634192 13:52316214-52316236 TTGAGAGAAGTGGGGATGGATGG + Intergenic
1110074836 13:71227314-71227336 GTGTGAGAGGAGGGTAAGTATGG - Intergenic
1110689607 13:78416891-78416913 CTGTGGGAGGTGGGACAGAATGG + Intergenic
1110832794 13:80050918-80050940 CTTTGAGAGGTGAGAATGGAAGG - Intergenic
1111331592 13:86765423-86765445 GTGGAAGAGGTGGGGAGGGAAGG + Intergenic
1111730476 13:92070058-92070080 TTCTGAGAGATGGGGCAGGAGGG + Intronic
1112274869 13:98007204-98007226 CTGTGTGTGGTGGGGAAAGGAGG - Intronic
1113859982 13:113475641-113475663 CTTTGAGAGGTGGAGGAGGGAGG + Intronic
1114364331 14:22010917-22010939 CTCTGAGATGTGGGGTATGAGGG - Intergenic
1114593759 14:23893522-23893544 CTCTCAGAGGTGGCAAAGGATGG - Intergenic
1114633683 14:24175475-24175497 CTGTGAAAAGTGGGAAAGCAGGG + Intronic
1114650201 14:24279912-24279934 CTGTGGGTCCTGGGGAAGGATGG + Intergenic
1114673493 14:24427215-24427237 CTGTGGCTGGTGAGGAAGGAAGG - Exonic
1115307461 14:31947159-31947181 CTCTGAGAGGCATGGAAGGAGGG - Intronic
1115645133 14:35364043-35364065 TTGCGAGAGGTGGGGCAGGTGGG + Intergenic
1116413610 14:44653840-44653862 CTGGGGGAGGTGGGGAAGAAGGG + Intergenic
1117008526 14:51446927-51446949 CTGGGAGAGCTTGGGCAGGATGG + Intergenic
1117089527 14:52236134-52236156 CTGAAGGAGATGGGGAAGGAAGG + Intergenic
1117647284 14:57865679-57865701 CTGCGCGAGGCGGGGAAGGGAGG - Intronic
1117701672 14:58420031-58420053 CTGTGGGAGGTGGAGATGGGAGG - Intronic
1117803515 14:59467485-59467507 CTGAGAAAGATGAGGAAGGAAGG - Intronic
1117909588 14:60624308-60624330 CTGGGAGAGGTGGAGAAAGAGGG - Intergenic
1118860093 14:69656188-69656210 ATGTGAGAGGGAGGGAGGGAGGG - Intronic
1118880333 14:69820121-69820143 CTGTTAGAGGTGGGAAGAGAAGG + Intergenic
1119113468 14:71996767-71996789 GTGTGGGAGGTAGGGGAGGAAGG + Intronic
1119672205 14:76528277-76528299 CTGAGAGAGGGTGGGAGGGATGG + Intergenic
1119710316 14:76817400-76817422 CTGTGAGAGGTGGGAACGCAGGG - Intronic
1119759445 14:77140807-77140829 CTGTGAGGCGTGGGGTGGGATGG - Intronic
1120325741 14:83023442-83023464 CTGGCAGAGGTGGGAAAGAAAGG - Intergenic
1120491899 14:85188981-85189003 CATGGAGAGGTGAGGAAGGAAGG - Intergenic
1120501005 14:85297340-85297362 GTGTTAGAGGTGGGGACAGATGG - Intergenic
1120516815 14:85480826-85480848 CTTTGAGATGAGGGGCAGGATGG + Intergenic
1120911286 14:89669266-89669288 GTGTGGGAGGTGGTGCAGGAAGG + Intergenic
1121114672 14:91335348-91335370 CGGTGAGAGGTGAGGCTGGAGGG - Intronic
1121169762 14:91843899-91843921 CTGGGAGTGGTGGAGAAAGAGGG - Intronic
1121173616 14:91874211-91874233 GTGTGGGAGGTGGGGCTGGATGG - Intronic
1121443591 14:93964536-93964558 GGGTGAGAGGTGGAGGAGGATGG - Exonic
1121447691 14:93988689-93988711 TTGGGAGAGGGGCGGAAGGAGGG + Intergenic
1121447710 14:93988737-93988759 TTGGGAGAGGGGTGGAAGGAGGG + Intergenic
1122243539 14:100384544-100384566 GTGTCAGAGGTGGGGCAGCATGG + Intronic
1122258839 14:100500397-100500419 CTGTGGAGGGTGGAGAAGGAGGG + Intronic
1122278025 14:100605191-100605213 CTGTGGGTGTTGGGGAAGGGGGG + Intergenic
1122439321 14:101719164-101719186 CTGTGAGGGGAGGGGAGGGGAGG + Intergenic
1122458858 14:101879123-101879145 GTGGGAGAGGAGGGGAAGCAAGG + Intronic
1122553183 14:102561090-102561112 CTGAGTGAGGTGAGGCAGGATGG + Intergenic
1122870354 14:104635501-104635523 GTCTGGAAGGTGGGGAAGGAAGG + Intergenic
1124099904 15:26683400-26683422 CTGGGTGGGGTGGGGAATGAGGG + Intronic
1124114385 15:26827646-26827668 CAGTGTGAGCTGGGGCAGGAGGG - Intronic
1124490790 15:30153867-30153889 CTGGGAGAGGTGAAGAAGGGTGG - Intergenic
1124752742 15:32384462-32384484 CTGGGAGAGGTGAAGAAGGGTGG + Intergenic
1125968632 15:43894251-43894273 CTGGGAGAGGTTGGGGAGGGAGG + Intronic
1126930767 15:53648051-53648073 CTGTCAGAGGTGGGGAAGTTAGG - Intronic
1127055336 15:55125699-55125721 CTTTGGGAGGTGGAGAGGGAAGG - Intergenic
1127269870 15:57390796-57390818 CTGTGGGAGGAGCAGAAGGATGG + Intronic
1127609059 15:60619597-60619619 CTATGAGATGAGGGGAAGGAGGG - Intronic
1127619808 15:60722849-60722871 TTGTGAGACGTGGAGAGGGAAGG - Intronic
1128646221 15:69380634-69380656 CTGAGAAAGGTGGGGGATGAAGG + Intronic
1128870130 15:71148674-71148696 CTGTATGAGGTGGGGAAGCCTGG - Intronic
1128904177 15:71452455-71452477 CTTTGAGAGCTGAGGGAGGAGGG - Intronic
1129257694 15:74343455-74343477 GTGGGAGAGATGGGGAAGGTTGG - Intronic
1129706059 15:77795243-77795265 AAGTGGGAGATGGGGAAGGAGGG - Intronic
1129776018 15:78237047-78237069 ATCTGAGGGATGGGGAAGGAAGG - Intronic
1130204429 15:81863046-81863068 CTAGGAGAGGTGGGGGAGAAGGG + Intergenic
1130371960 15:83292547-83292569 CCGTGAGTGTTGGGAAAGGAAGG + Intergenic
1130631153 15:85570205-85570227 CTTTGGGAGGTAGAGAAGGATGG + Intronic
1130659375 15:85818142-85818164 GTGTGGGTGGTGGGGAAGGAGGG - Intergenic
1130810611 15:87374263-87374285 TTTTGAGGGGTGGGGAGGGATGG - Intergenic
1131325905 15:91444874-91444896 ATGTGAGAGGCAGGGAAAGAAGG + Intergenic
1131340906 15:91599691-91599713 GGGTGAGAGGAAGGGAAGGAGGG + Intergenic
1131538202 15:93254700-93254722 CTGTTGGAGGTGGGGGAGGCAGG + Intergenic
1131546154 15:93317113-93317135 CTGGGCCAGGTGGGGAAGGCTGG + Intergenic
1131908118 15:97166189-97166211 GGGAGGGAGGTGGGGAAGGAAGG - Intergenic
1132406528 15:101544628-101544650 CTGTTTTTGGTGGGGAAGGAGGG - Intergenic
1132531279 16:451285-451307 GGGTGAGGTGTGGGGAAGGAGGG - Intronic
1132758420 16:1497129-1497151 CTGTGAGGGTCGGGGCAGGATGG - Intronic
1132906228 16:2284129-2284151 CTGTGGGAGGTGGGGCAAGGCGG + Intronic
1132945916 16:2531472-2531494 GAGTGAGTGGTGGGGAATGATGG - Intergenic
1132957648 16:2603901-2603923 CTGGGAGGGGAGGGCAAGGATGG + Intergenic
1133006312 16:2883538-2883560 CTGGAGGGGGTGGGGAAGGAGGG - Intronic
1133753326 16:8742153-8742175 CTGGGAGAGGTGGTGAAGAAAGG - Intronic
1133829663 16:9310046-9310068 CTGTGACACGTGCTGAAGGAGGG - Intergenic
1134010236 16:10846653-10846675 GTGTGAGTGGTGGGGTGGGAGGG - Intergenic
1134178870 16:12031456-12031478 GGGTGAGAGCTGGGGAAGGAAGG - Intronic
1134253091 16:12588485-12588507 GTGTGTGAGGTGTGAAAGGAAGG - Intergenic
1135305612 16:21365211-21365233 GGGTGAGAGCTGGGGAAGGAAGG - Intergenic
1135381186 16:21997417-21997439 CTGTCAGAGGAGGGGGAGGCAGG + Intronic
1135540268 16:23324685-23324707 GTGTGTGGGGTGGGGTAGGATGG - Intronic
1135544943 16:23359372-23359394 TTGGGAGAGGTGGGTAGGGAGGG - Intronic
1136066349 16:27761472-27761494 CTGGAAGTGGTGGGCAAGGAGGG + Exonic
1136088513 16:27902459-27902481 CTTCAGGAGGTGGGGAAGGAGGG + Intronic
1136253962 16:29025773-29025795 TTGTCAGAGGTGGTGAAGGTTGG + Intergenic
1136302354 16:29344365-29344387 GGGTGAGAGCTGGGGAAGGAAGG - Intergenic
1137260972 16:46830381-46830403 CTGCGAGGGGTGGGGAAGTTAGG + Intronic
1137544959 16:49396358-49396380 ACGTGAGAGGTGGGGTAGGCAGG - Intronic
1137555121 16:49465395-49465417 CTGTGTGAGGTGGGGAGAGCTGG + Intergenic
1137887018 16:52116368-52116390 CTCTGAGAACTAGGGAAGGATGG - Intergenic
1137928263 16:52562423-52562445 GAGAGAGAGGTGGGGGAGGAGGG - Intergenic
1137986353 16:53111266-53111288 CTGGGAGAGCTGGGGAGGGTCGG + Intronic
1138493584 16:57393087-57393109 CTGGGAGAGGGTGAGAAGGATGG - Intergenic
1138895063 16:61194072-61194094 AACTGAGAGGTGGGGAAGAAAGG - Intergenic
1139328441 16:66169416-66169438 AAGAGAGAGGTGGGGAAAGAAGG + Intergenic
1139375820 16:66495627-66495649 AGGTGGGAGGTGGGGATGGATGG - Intronic
1139472212 16:67184347-67184369 CTGTGTGTGTTGGGGAAGGTGGG - Exonic
1139721890 16:68862836-68862858 TTGTGAGAGGAGCGGAAAGAAGG - Intronic
1140250105 16:73287982-73288004 CTGTGAGAGGGAGGAACGGAGGG - Intergenic
1140310496 16:73843652-73843674 CTGTGAGAAGCGGGGATTGAAGG - Intergenic
1141117101 16:81318417-81318439 CTGTGAGAGGTGGAGGCGGGAGG + Intronic
1141167275 16:81669049-81669071 GTGTGAGAGGTGGGTGTGGAAGG - Intronic
1141167347 16:81669374-81669396 GTGTGAGAGGTGGGTGTGGAAGG - Intronic
1141167434 16:81669756-81669778 GTGTGAGAGGTGGGTGTGGAAGG - Intronic
1142409010 16:89906972-89906994 GAGTGTGTGGTGGGGAAGGAAGG - Intronic
1203143369 16_KI270728v1_random:1783661-1783683 ATGAGAGAGGGAGGGAAGGAAGG - Intergenic
1142548180 17:720378-720400 GTGAGAGAGATGGGGGAGGAGGG + Intronic
1142548308 17:720935-720957 CTGAGGGAGTTGGGGGAGGATGG + Intronic
1142742930 17:1941411-1941433 CTCTCAGAGGAGGGGCAGGAGGG - Intronic
1142808887 17:2386136-2386158 CAGGCTGAGGTGGGGAAGGAGGG - Exonic
1143065082 17:4240814-4240836 CAGTGAGAGGTGGGAAAAGCAGG - Intronic
1143129947 17:4671869-4671891 CAGGGAGAGGTGGAGAGGGAAGG - Exonic
1143385093 17:6524331-6524353 GTATGTGGGGTGGGGAAGGAGGG + Intronic
1143491236 17:7286375-7286397 CGGAGTGAGGTGGGGAGGGAAGG - Intronic
1143514329 17:7411772-7411794 GTGTTAGAGGTGGGGTGGGAGGG - Intronic
1143659334 17:8315110-8315132 CTGTGGGGGGTGGGTGAGGATGG + Exonic
1143722505 17:8822708-8822730 CTCAGAGAGGTGGGGAAGTTAGG - Intronic
1143882465 17:10040185-10040207 CTGCGAGAGATTGGGCAGGATGG + Intronic
1144052439 17:11508570-11508592 AGGGGAGAGGTGGGAAAGGAAGG - Intronic
1144076393 17:11723314-11723336 CGATTAGAGGTAGGGAAGGAAGG - Intronic
1144350276 17:14388588-14388610 ATATGAGAGGTGGGGATAGAAGG + Intergenic
1144365674 17:14542009-14542031 GGGAGAGAGGAGGGGAAGGAAGG - Intergenic
1144379577 17:14681041-14681063 CTGAGAAACGTGGGGAGGGAGGG - Intergenic
1144705547 17:17365386-17365408 CTGTGTGAGGTGAGCCAGGAGGG - Intergenic
1144758512 17:17694433-17694455 CTCTGAGAGGTGGGCCAGGTTGG - Intronic
1145901958 17:28495341-28495363 CTGAGAGAGGTCAGGAAGGCAGG + Intronic
1146230883 17:31107892-31107914 CTTTGGGAGGTGGGGGAGGGAGG + Intronic
1146282611 17:31554784-31554806 CAGTGAGTGGTGGGGGAGGGGGG - Intergenic
1146533493 17:33630230-33630252 TTATGTGAGATGGGGAAGGAAGG - Intronic
1146573018 17:33968900-33968922 TTGTGACAGGTGGTGAAGGGTGG + Intronic
1146656877 17:34639722-34639744 CTCTGAGAGGTGGGCAGTGAAGG - Intergenic
1146953293 17:36921243-36921265 CAGTGGGAGATGGGGAAGGCTGG - Intergenic
1147020804 17:37531122-37531144 CTGTGGGAGGTTGAGATGGAAGG + Intronic
1147121280 17:38336632-38336654 CAGTGAGATGGGGGCAAGGATGG - Intronic
1147262732 17:39218017-39218039 CTGTGGGTGGTGGGGAGGGAGGG + Exonic
1148090706 17:45021050-45021072 CTGGGAGCGGAGGGGAAGGTGGG + Intergenic
1148152620 17:45405400-45405422 GGGTGAGGGGTGGGGCAGGATGG - Intronic
1148450954 17:47777611-47777633 ATGTGAGAGCTGGGAAAGGAGGG - Intergenic
1148462376 17:47846119-47846141 CTGTGAGATGAGGGGGAGGAAGG + Exonic
1148485572 17:47988664-47988686 GTGTGGGGGGAGGGGAAGGATGG - Intergenic
1148662339 17:49344926-49344948 AGGTGGGAGTTGGGGAAGGAGGG - Intronic
1148712002 17:49688754-49688776 CCGTGTGAGGTGGGTCAGGAGGG + Intergenic
1148723056 17:49768667-49768689 CTGAGAGGGATTGGGAAGGAGGG + Intronic
1149304882 17:55338093-55338115 CTACTAGAGGTGGGGAGGGAGGG - Intergenic
1149626266 17:58083090-58083112 CTGAGAGAGGAGGAGAGGGAAGG - Intergenic
1150097376 17:62389266-62389288 CTGTAAGAGGTGGAGAAGGCAGG + Intronic
1150236080 17:63593753-63593775 CTGGGTGGGGTGGGGAAGGAAGG - Exonic
1150473598 17:65457872-65457894 CTGGGACAGGTGGGGTGGGAGGG - Intergenic
1150718012 17:67588482-67588504 CTGGGTGGGGTGGGGCAGGACGG - Intronic
1151221392 17:72615502-72615524 CTGAAAGGGGAGGGGAAGGATGG + Intergenic
1151758502 17:76088016-76088038 CAGGGAGAGGGGAGGAAGGAGGG - Intronic
1152010361 17:77709363-77709385 CTGTGGGAGATGAGGAGGGAGGG + Intergenic
1152385261 17:79970263-79970285 CTGCCAGGGCTGGGGAAGGAAGG + Intronic
1152426547 17:80221275-80221297 CTGGGAGAGTTGAGGATGGAGGG + Intronic
1152577992 17:81151322-81151344 CTGGGGGATGTGGGGGAGGAGGG - Intronic
1152680420 17:81665122-81665144 CTGTGAGGGGGTGTGAAGGAAGG + Exonic
1153089138 18:1323975-1323997 CTTGGAGAGGTGAGGGAGGAAGG + Intergenic
1153198400 18:2625371-2625393 CTGTGGGAGGTGGGAGAGGCAGG + Intergenic
1153575070 18:6511957-6511979 CTGTGGGAGGTGGAGAAGCATGG - Intronic
1153957837 18:10113291-10113313 CAGTGAGAGAAGGGAAAGGAGGG - Intergenic
1154995298 18:21635038-21635060 CTGTGACAGGGAGTGAAGGAGGG - Intergenic
1155242901 18:23880227-23880249 CAGTGAGATTTGGGGAAGGAAGG + Intronic
1155510266 18:26569429-26569451 CTGTGAGTTGTCAGGAAGGAAGG - Intronic
1156034744 18:32753771-32753793 ATCTGGGAGGTGGAGAAGGAGGG - Intronic
1156280999 18:35638451-35638473 GTGTGTGGGGTGGGGAAGGGGGG - Intronic
1156536937 18:37873363-37873385 CTGTGAGAGGCACTGAAGGAAGG - Intergenic
1157339325 18:46765325-46765347 ATGTGAGAGGTGCTGTAGGATGG + Intergenic
1157525371 18:48376558-48376580 CTGAGAGAGGAGGGGTGGGAGGG - Intronic
1157527547 18:48396100-48396122 CTTTGAGAGGGGGGTAGGGATGG - Intronic
1157618719 18:49003180-49003202 CTGTGTGAGGAGGGAAAGGCAGG - Intergenic
1158241222 18:55380415-55380437 CTGTCAGCGGTGGGGGACGAGGG - Intronic
1158348627 18:56541212-56541234 ATGTGAGTGTTGGGGAAGGCCGG - Intergenic
1158392277 18:57053216-57053238 CTGAGAGAAGTGGGGATGGCTGG - Intergenic
1158594157 18:58801911-58801933 GGGTGAGAGGTGGGGAGGGGTGG - Intergenic
1160461960 18:79046290-79046312 CTGAGCCAGGTGGGGAAGGCAGG + Intergenic
1160583636 18:79901182-79901204 AGGTCAGAGGTGGGGAATGACGG + Intergenic
1160613155 18:80104681-80104703 CTGTGAGAGGCGGAGAAGAGAGG - Intergenic
1160698008 19:494032-494054 CGGCCAGAGGTGGGGAAGGCGGG - Intronic
1160762338 19:791861-791883 CTGGGTGGGGTGGGGAAAGAGGG + Intergenic
1160960671 19:1719226-1719248 CGCTGAGGGGTGGGGAGGGAGGG + Intergenic
1161094197 19:2379538-2379560 CTGTGAGAGGTGAGGCAGGAAGG - Intergenic
1161426919 19:4208750-4208772 CTGTGAGGGCTGGGGAGAGAGGG - Exonic
1161484848 19:4529924-4529946 CAGTGAGAGTTGTAGAAGGAGGG + Intronic
1161932509 19:7350132-7350154 CTGGGAGGGGTGGGGGAGGAAGG + Intronic
1161952948 19:7477731-7477753 CTTTGGGAGGTGTGGAGGGAAGG + Intronic
1164145946 19:22512684-22512706 CTGGGCCAGGTGTGGAAGGAGGG + Intronic
1164412666 19:28018915-28018937 CTGTCAGAGATGGGCAAGGATGG + Intergenic
1164449153 19:28345059-28345081 CTGAAAGAGGTGGGAATGGAGGG + Intergenic
1164517152 19:28946272-28946294 CTGTCAGAGATGGGCAAGGATGG + Intergenic
1164577005 19:29411375-29411397 CTCTGAGGAGTGGGGGAGGAGGG - Intergenic
1164644702 19:29849849-29849871 GAATGAGAGGTGGGGTAGGAAGG + Intergenic
1164893020 19:31840912-31840934 GGAGGAGAGGTGGGGAAGGAGGG + Intergenic
1164932876 19:32188740-32188762 CTTTGAGAGGTGGAGGAGGTAGG + Intergenic
1164972184 19:32542014-32542036 CAGTGGGAGGAGGGTAAGGATGG + Intergenic
1165073417 19:33268355-33268377 CGGTCAGAGGTGGGGACAGAGGG + Intergenic
1165146535 19:33734636-33734658 CAGGGAGAGGAGAGGAAGGAGGG + Intronic
1165165353 19:33849960-33849982 CTGTGACAGGTTGGGCAGGCTGG - Intergenic
1165258439 19:34593992-34594014 CTTGGAGAGGTGAGGCAGGAGGG + Intronic
1165306316 19:35005081-35005103 CTATGGGGGGCGGGGAAGGAGGG + Intronic
1165315928 19:35055477-35055499 CTGACAGAGATGGGGACGGAAGG - Intronic
1165327196 19:35121052-35121074 GTGGGAGAAGAGGGGAAGGAGGG - Intronic
1165377162 19:35450760-35450782 CTGGGAGAGGCGGAGCAGGAAGG + Exonic
1165462798 19:35953958-35953980 CTCGGAGAGGAGGGCAAGGATGG - Intergenic
1165838253 19:38772183-38772205 CTCTGGGAGGTGGAGAAGGGAGG + Intronic
1165841308 19:38790514-38790536 CTCTGGGAGGTGGAGAAGGGAGG - Intronic
1165894635 19:39134055-39134077 CTGTGGGCGGCAGGGAAGGAGGG - Intronic
1165927540 19:39336143-39336165 CTGGCAGATGAGGGGAAGGAAGG - Exonic
1166196284 19:41207743-41207765 CGGTGGGAAGTGGGCAAGGAGGG + Intergenic
1166299668 19:41906647-41906669 CTGAGTGGGCTGGGGAAGGAAGG + Intronic
1166382481 19:42362212-42362234 AGGTGAGTGGTGGGGAAGGCAGG + Exonic
1166584620 19:43934954-43934976 CTGTGGGAGGTGGGGGAAGGCGG + Exonic
1166716790 19:44973541-44973563 GTGTGAGAGGTGGGGAGGGCAGG + Intronic
1166767792 19:45262759-45262781 CTGGGAGAGGGGGCAAAGGAAGG + Intronic
1166853718 19:45772083-45772105 CTGAGGGAGGTAGGGAAGGGAGG - Intronic
1166913649 19:46179122-46179144 CTGTGAGAGGCAGGGATGCAGGG + Intergenic
1167234037 19:48303096-48303118 CTGGGAGAGTTGGGCAAGGCGGG + Intronic
1167339401 19:48905915-48905937 CAGGGAGGGGTGGGGAAGGGTGG + Intronic
1167413877 19:49360600-49360622 AAGTTAGTGGTGGGGAAGGAAGG + Intronic
1167455884 19:49596624-49596646 CCGTGGGAGGTGGGGGCGGAGGG - Exonic
1167473561 19:49688136-49688158 CAGGGAGAGGTGGGGCATGAGGG - Intronic
1167498207 19:49831310-49831332 CTGCCAGAGGGGAGGAAGGAGGG - Intronic
1167568562 19:50272408-50272430 CTGAGATAGATGGGGAAGGTGGG + Intronic
1167572964 19:50301638-50301660 CTGTAGCAGGAGGGGAAGGAAGG - Intronic
1167669024 19:50839066-50839088 CTGAGAGAGGTGGGGCTGGGGGG + Intergenic
1167792651 19:51690984-51691006 GTCTGGGAGGTTGGGAAGGAGGG + Intergenic
1168309893 19:55455107-55455129 CTGTGAGTGGGAGGGAGGGAGGG + Intronic
1168379528 19:55908191-55908213 CTAGGAGAGGTGGAGAGGGAAGG - Intronic
1168721348 19:58556481-58556503 ATGTGAGAGGCTGGGAGGGAGGG + Intronic
925190714 2:1881137-1881159 CTGTGAGAGGAGGAGGAGGCAGG + Intronic
925297220 2:2785541-2785563 CTGTTAGAGCTGAGGAAGCATGG + Intergenic
925739929 2:6996373-6996395 CAGTGGGAGGGAGGGAAGGATGG + Intronic
925870513 2:8265892-8265914 TGGTGAGAGGTGGGCATGGATGG + Intergenic
926145173 2:10392848-10392870 CTGGGGGAGGTGGGGTCGGAAGG + Intronic
926873021 2:17444243-17444265 AGGAGAGAGGAGGGGAAGGAGGG + Intergenic
927190374 2:20513087-20513109 GTGGGAGTGGTGGGGAGGGAAGG - Intergenic
927441588 2:23122315-23122337 CTGTGAGAGATGGGGGAGTCAGG - Intergenic
927811165 2:26180969-26180991 AAGGGGGAGGTGGGGAAGGAAGG - Intronic
927875897 2:26655101-26655123 CTGAGGGAGGGAGGGAAGGAGGG + Intergenic
927877880 2:26670819-26670841 CTGAGGGAGGGAGGGAAGGAGGG + Intergenic
927952161 2:27178775-27178797 CTTTGAGAGGTGGAGATGGGTGG - Intergenic
928091604 2:28378003-28378025 CCCTGAGAGGGAGGGAAGGAGGG + Intergenic
928126261 2:28618644-28618666 CTGTGAACAGTGGGGAAGGCGGG - Intronic
928638891 2:33277053-33277075 CTCTGTTAGGTGGGGCAGGATGG + Intronic
928746462 2:34421511-34421533 TGGTGTGGGGTGGGGAAGGATGG - Intergenic
928924724 2:36565874-36565896 CTGGGCAGGGTGGGGAAGGATGG - Intronic
929184103 2:39075202-39075224 CAGTGGGAGGTGGGAAAGAAGGG + Intronic
929336704 2:40756667-40756689 CTGAGAGAGGCAGGGAAGGAAGG - Intergenic
929433366 2:41907540-41907562 GTGTCAGGGGTGGGGTAGGATGG - Intergenic
929611887 2:43276923-43276945 CTGTGGGAGGTGGGAGAGAAGGG - Intronic
929960147 2:46490306-46490328 CTGGGAGAGGTGGGGAGGTCCGG + Intergenic
930288093 2:49459388-49459410 TTGTGAAAGGGAGGGAAGGAGGG + Intergenic
930624428 2:53680864-53680886 GGGTGAGAGGTGGGGATGGTTGG - Intronic
930683189 2:54279681-54279703 GTGTGTGAAGTGGGGAGGGAGGG - Intronic
930822598 2:55662264-55662286 CTAGGAGTGCTGGGGAAGGAAGG + Intronic
931743126 2:65266688-65266710 CACTGAGAGGAGGGGAGGGATGG + Intronic
932297464 2:70638919-70638941 CAGGTAGGGGTGGGGAAGGATGG + Intronic
932304523 2:70692515-70692537 CTGGGAGAGGTGGTGGAGAAGGG - Exonic
932326320 2:70864347-70864369 CTGTGTGAGGAGTGGATGGAAGG - Intergenic
932466476 2:71927398-71927420 CGCTGTGAGCTGGGGAAGGAAGG + Intergenic
933718004 2:85376343-85376365 CTGTGCCAGCAGGGGAAGGAGGG + Intronic
934211959 2:89988067-89988089 CTGTGGGAGTTTGGGTAGGAAGG - Intergenic
934500870 2:94858869-94858891 CTGTGCCAGGTGGGCAAGGTAGG + Intergenic
935251459 2:101265611-101265633 CTGGGAGAGGTGGGGTAGTGGGG + Intronic
935713099 2:105916606-105916628 CAGAGAGAGCTGGGGAAGGAAGG + Intergenic
936053011 2:109239813-109239835 CTGTGAGCTGTGGGGATGAAAGG - Intronic
936531641 2:113280100-113280122 CAGTGGGAGGGGGGCAAGGAAGG + Intergenic
936957529 2:118038000-118038022 CTGTGAGAGGTTGGAGAGGAAGG - Intergenic
937506627 2:122544838-122544860 TTGTGTGAGTTGGGGAAAGAAGG + Intergenic
937565375 2:123279765-123279787 CAGTGAGATGTGGGGCTGGAGGG - Intergenic
937955243 2:127418515-127418537 CTATGAGGGGTGTGGAGGGAGGG + Intronic
938122701 2:128644943-128644965 CTGGAAGAGGTGGGGAAGCCAGG - Intergenic
938452242 2:131431659-131431681 CTGTGGAAGGTGAGGGAGGAAGG + Intergenic
938539261 2:132273123-132273145 GGGTGAGGGGTGGGGACGGAGGG - Intergenic
938917817 2:135961047-135961069 CTGGGGGAGGGAGGGAAGGAGGG + Intronic
940830384 2:158458250-158458272 CGGCGAGAGCTGGGGAGGGAAGG - Intronic
940865183 2:158810721-158810743 CTTCAAGAGGTGGGGAAGGCTGG - Intronic
940975105 2:159934040-159934062 TTTTGAAAGGTGGGGAAAGAGGG + Intronic
941362736 2:164572472-164572494 AATTGAGAGGTGGGGAAGGAAGG + Intronic
941662098 2:168205569-168205591 CTGAGGAAGGTGGGGAGGGACGG + Intronic
941698920 2:168582850-168582872 CTGTGGGTGCTTGGGAAGGATGG - Intronic
942305839 2:174607005-174607027 CAATGAGAGGCAGGGAAGGAAGG + Intronic
943183348 2:184573551-184573573 CTGTCAGAGGTGGGGTAGAAGGG + Intergenic
944153896 2:196591639-196591661 CTATTAGAGGTGGGGTAGGGTGG - Intronic
944464051 2:199982696-199982718 CTGAGAGAGGGGGGGAAGAAAGG - Intronic
944627494 2:201586951-201586973 CAGGGAGAAGGGGGGAAGGAGGG - Intronic
944651740 2:201837396-201837418 GGGGGAGAGGTGGGGAGGGAGGG + Intronic
944665222 2:201954017-201954039 CTGGGAAGGGTGGGGAGGGAGGG - Intergenic
944675237 2:202029992-202030014 CTGAGAGAGGGAGGGAAAGAAGG - Intergenic
944868595 2:203886695-203886717 TTGTGTGGAGTGGGGAAGGAAGG - Intergenic
944930826 2:204517520-204517542 CTGTCAGAGGTGGGGGCTGAGGG + Intergenic
946195920 2:218033060-218033082 GTGTGGGAGGTGGGGAGGCAGGG + Intergenic
946200362 2:218067878-218067900 GTGTGGGAGGTGGGGAGGCAGGG + Intronic
946200609 2:218068821-218068843 CTGACTGAGGTGGAGAAGGAAGG + Intronic
946285179 2:218697388-218697410 CTGGGAGCTGTGGGGAAGCAGGG + Intronic
946409798 2:219510310-219510332 CGGAGAGAGCTGAGGAAGGAGGG - Intergenic
947411184 2:229841600-229841622 CTGTGAGGGTTGGGCAAGGGTGG - Intronic
947620958 2:231590756-231590778 CTGGGAGAGGTGGAGGAGGGAGG + Intergenic
947822731 2:233083275-233083297 CTGGGAGTGGTGGGGAAGGAGGG + Intronic
948590653 2:239047593-239047615 CTGTGACAGGGGAGGAGGGAAGG + Intergenic
948752835 2:240142403-240142425 CTGTGGGAGGTGGTGAAGAAGGG + Intronic
948759207 2:240180098-240180120 GTTGGAGAGGTGGGGAAGGGAGG - Intergenic
948862614 2:240760249-240760271 CTGGGAGAGGTGGTGGGGGATGG - Intronic
948893005 2:240916227-240916249 ATGGGAGAGGAGGGGAAGGAAGG - Intergenic
948981508 2:241497106-241497128 GGGTGAGAGGTGGTGAAGGCAGG - Intronic
1168903052 20:1381902-1381924 TTGTTAGAGGAGGGTAAGGAGGG + Intronic
1169222557 20:3833987-3834009 CTGACAGAGGGAGGGAAGGAGGG - Intergenic
1169338643 20:4778935-4778957 GAGAGAGAGATGGGGAAGGAGGG - Intergenic
1169344215 20:4817625-4817647 CCTGGAGAGGTGGGGAGGGAGGG - Intronic
1169698867 20:8424151-8424173 CTGTGTGTGGTGGGGGAGGAGGG - Intronic
1170329578 20:15193752-15193774 CTGTGAGAGTAGGAGAATGAAGG - Intronic
1170413493 20:16115712-16115734 TGGTGGGAGGTGGGGAAGTAAGG - Intergenic
1170427838 20:16253002-16253024 TTGTTTGAGATGGGGAAGGATGG - Intergenic
1171384792 20:24763028-24763050 CTGGCAGAGGAGGGGAAGGTGGG + Intergenic
1171391232 20:24802824-24802846 AGGTGAGAGGGGGAGAAGGAAGG + Intergenic
1171486752 20:25491117-25491139 GTGGGAGTGGTGGGGAAGGAGGG + Intronic
1171892093 20:30725591-30725613 CTGTGTCAGGTGGGCAAGGTAGG + Intergenic
1172018870 20:31898590-31898612 CTGTGAGACAAAGGGAAGGAGGG - Intronic
1172274564 20:33672687-33672709 GTGTGGGAGGTGGGGACGCAGGG - Intronic
1172423958 20:34842391-34842413 CTGTGAAAGGAGGGGAAGGAAGG + Intergenic
1172959569 20:38789017-38789039 CTGTTAGAGGAGGGCAGGGAAGG + Intergenic
1172969719 20:38864704-38864726 CTGTGAGAGGTGGGGGACTCCGG - Intronic
1173202232 20:40962483-40962505 CTGGTAGAGGGAGGGAAGGAAGG + Intergenic
1173458674 20:43224427-43224449 GGGTTAGAGGTGGGAAAGGATGG - Intergenic
1173558657 20:43985933-43985955 GAGAGAGAGATGGGGAAGGAGGG + Intronic
1173640521 20:44598593-44598615 CTGTGAGGGGACAGGAAGGAAGG - Intronic
1173737908 20:45374801-45374823 CTAGGAGATGTGTGGAAGGAGGG - Intronic
1173793038 20:45840559-45840581 GTGTGGGGGATGGGGAAGGATGG + Intronic
1173966529 20:47116685-47116707 GTGAGAGTGGAGGGGAAGGAAGG - Intronic
1174048016 20:47747720-47747742 TTGGGAGAGGTGGGGAAGGGGGG - Intronic
1174118220 20:48242588-48242610 TTGGGAGAGGTGGGGAAGGGTGG - Intergenic
1174503533 20:51002596-51002618 CTTTGAGAGGTGGTCAGGGAAGG + Intergenic
1174611468 20:51801646-51801668 CCCAGAGAGGTGGGGGAGGAGGG - Intronic
1174617093 20:51843964-51843986 CTGTGCAAGGGAGGGAAGGATGG - Intergenic
1175012179 20:55749151-55749173 CTGTCAGGGGTGGGGCAGGGGGG + Intergenic
1175321424 20:58090854-58090876 CTGAGACAGGAGGGGCAGGAGGG - Intergenic
1175370288 20:58483729-58483751 ATTTGAGGGCTGGGGAAGGAGGG + Intronic
1175427693 20:58879616-58879638 CTCAGAGGGGTGCGGAAGGAAGG + Intronic
1175844940 20:62053214-62053236 CTCTGAGAGTTGGGAAAGCACGG - Intronic
1175921104 20:62450986-62451008 AGGTGAGAGGAGGGGAGGGAGGG - Intergenic
1176222602 20:63977170-63977192 GTGAGAGTGGTGGAGAAGGAGGG + Intronic
1177790521 21:25717802-25717824 ATGTCAGAGGTGGGGATGGATGG + Intronic
1178506486 21:33167109-33167131 CTGGAAGAGGCTGGGAAGGATGG + Intronic
1178741545 21:35206612-35206634 CAGAGAGAGGAGGGGGAGGAGGG - Intronic
1179356183 21:40662662-40662684 CTATGGGAGGTGGGGCAGAATGG + Intronic
1179409874 21:41154220-41154242 CTGTGGCAGGTGAGGGAGGATGG + Intergenic
1179490388 21:41737327-41737349 CTGTGAGATGTGGAGATGGTAGG - Intergenic
1179643631 21:42762372-42762394 CTGGAGGAGGTGAGGAAGGAGGG - Intronic
1179708496 21:43195894-43195916 CGGTGGGAGGTGGGGAAGGAAGG + Intergenic
1179768514 21:43594705-43594727 CGGTGGGAGGAAGGGAAGGAGGG + Intronic
1181282244 22:21728236-21728258 CATGGAGAGGAGGGGAAGGAAGG - Intronic
1181481925 22:23205377-23205399 CCGTGAGAGGAGGAGAAGGAGGG - Intronic
1181542482 22:23580664-23580686 CTCGGGGAAGTGGGGAAGGAGGG - Intergenic
1182133217 22:27874423-27874445 CTGTCAAAGGAGGCGAAGGAGGG + Intronic
1182294070 22:29302911-29302933 CTGTCAGGAGTGGGGTAGGAGGG - Intergenic
1182321347 22:29480138-29480160 CAGTGAGAGGGTGGGGAGGAGGG - Intergenic
1182810069 22:33108533-33108555 CTGTGCACGGTGGGGCAGGAAGG + Intergenic
1183043575 22:35201899-35201921 CTGAGAGAGGTGAGCAGGGAAGG + Intergenic
1183106556 22:35619068-35619090 CTGTGAGAGGGATGGATGGATGG - Intronic
1183334215 22:37237382-37237404 CAGGGAGAGGTGGAGCAGGAGGG + Intronic
1183395853 22:37570406-37570428 CTGTGAACTGTGGGGAGGGAGGG + Exonic
1183642698 22:39101728-39101750 CTGTGGGAGGCCAGGAAGGAAGG + Intronic
1183688573 22:39375759-39375781 CAGTGAGAGGGGAGGATGGAGGG - Intronic
1183916271 22:41122407-41122429 CTTTGAGAGGTGGCGGTGGATGG - Intronic
1183952279 22:41358484-41358506 CTGTGTGAGGTGTGGGAGGTGGG + Exonic
1184048187 22:41985289-41985311 CTGTGAGAGGAGGAGGAGGCTGG - Intronic
1184071933 22:42152084-42152106 CTGTGAGAGATGTGGAGCGAGGG - Intergenic
1184096096 22:42317370-42317392 ATGTGTGTGGTGGGGAAGGAGGG + Intronic
1184173388 22:42772517-42772539 AGATGAGAGGAGGGGAAGGAAGG - Intergenic
1184254302 22:43278420-43278442 CTGTGAGTGCTGGGGCAGCACGG - Intronic
1184289991 22:43493486-43493508 CTGTGAGAGTTGGTGGAGGCTGG - Intronic
1184512256 22:44940585-44940607 CAGTGCTGGGTGGGGAAGGATGG + Intronic
1184522630 22:45004388-45004410 GTGTGAGAGGTGGGGGATGAAGG + Intronic
1184576758 22:45374839-45374861 CTGTGAAAATAGGGGAAGGAAGG - Intronic
1184817102 22:46880763-46880785 CCATGGCAGGTGGGGAAGGAGGG + Intronic
1185207133 22:49546372-49546394 GTGTGGGAGGTGGAGAAGAAGGG - Intronic
1185339313 22:50284476-50284498 CTGTGAGGGGAGGGGCAGCAGGG - Intronic
1185379946 22:50503700-50503722 CTGTGGGAGGGAGGGAGGGAGGG + Intronic
949503359 3:4703428-4703450 CTATGAGAGGCGGGACAGGAGGG - Intronic
949570386 3:5286417-5286439 GTGTGTGGGGTGGGGAATGAAGG + Intergenic
950882640 3:16335619-16335641 CTGTTGGAGGTGTGGGAGGAGGG + Intronic
951088250 3:18540013-18540035 CGGTTGGGGGTGGGGAAGGAGGG + Intergenic
951260734 3:20504495-20504517 CTGTGAGATGTAGTCAAGGATGG + Intergenic
951349827 3:21593265-21593287 CTAGGAGAGGTAGGGAATGATGG - Intronic
952212914 3:31247324-31247346 CTGGGAGGGGTTGGGAAGGAGGG - Intergenic
953084074 3:39650719-39650741 CTGAGACAGGTGGGGAGGCAGGG - Intergenic
953227184 3:41031350-41031372 TTGTGGAAAGTGGGGAAGGAAGG + Intergenic
953435547 3:42874647-42874669 CACTGAGAGGTAGGGAAAGAGGG + Exonic
953443529 3:42941519-42941541 CTGAGGCAGGTAGGGAAGGAGGG - Intronic
953740853 3:45537896-45537918 CTCTCAGAGGAGGGGAAGGAAGG + Intronic
954367302 3:50153441-50153463 CTGTGAGAGGATGGAAGGGATGG + Intergenic
954777773 3:53035386-53035408 ATGGGAGAGGTGGGGAAGGTAGG + Intronic
954949242 3:54454753-54454775 TTATTAGAGGTGGGGAAAGAGGG - Intronic
954974425 3:54679469-54679491 CTGGGAGAGCTGGGGCAGCAAGG + Intronic
954982638 3:54760357-54760379 ATGTGAGAGGCGGGGAAAGAAGG + Intronic
955166413 3:56518602-56518624 ATGTGGGAGGGAGGGAAGGAAGG + Intergenic
955722684 3:61900372-61900394 CATTGAGAGATTGGGAAGGAGGG - Intronic
956189929 3:66598700-66598722 CCGAGCAAGGTGGGGAAGGAGGG + Intergenic
956557139 3:70536410-70536432 CTATAAGAGGTGCGGAAAGAGGG + Intergenic
956699359 3:71945137-71945159 CTGTGAGGGGTGGGGTTGGCTGG + Intergenic
956853061 3:73248991-73249013 CTGGGAGAGGTGGGAAGAGAGGG + Intergenic
957535000 3:81490748-81490770 CTGTATTAGGTGGTGAAGGAAGG + Intronic
957577623 3:82029852-82029874 CTGTATGAGGTGGGGAGGGGTGG + Intergenic
959338661 3:105099233-105099255 CAGAGAGAGGTGGGGTAGGGCGG - Intergenic
959495311 3:107043407-107043429 CTGTGGGAGATGGGGAAGGTGGG - Intergenic
959661547 3:108874109-108874131 CTCTGAGAGAGAGGGAAGGAAGG + Intergenic
960079872 3:113530053-113530075 GTGGGAGAGCTGGGGGAGGAAGG + Intergenic
960209791 3:114949230-114949252 GTGTGAGATGGGGGCAAGGATGG - Intronic
960493068 3:118340934-118340956 CTGTGAGAAGTGGGGAAAAAAGG + Intergenic
960600987 3:119458200-119458222 CTGTGATAGGTGGGACTGGAAGG + Exonic
960993782 3:123328268-123328290 CTGGGAGGGGTGAGGAAGGTGGG - Intronic
961150335 3:124632372-124632394 ATGTCAGAGGTGGTGAAGGCAGG - Intronic
961236927 3:125375168-125375190 CCTTGAGAGGAGGGGAAGGGGGG + Exonic
961491891 3:127262252-127262274 CTGTGAGATCTGGGGAAAGATGG - Intergenic
961518058 3:127450778-127450800 CTGTGGGAGTTGGGGGAGGATGG + Intergenic
961809489 3:129513762-129513784 CTGGGAGAGATGCGGGAGGAAGG + Intronic
961815590 3:129548547-129548569 CTGTGAGCGGCAGGGAAGGGAGG - Intronic
962754455 3:138457354-138457376 CTGTGTGAGTAGGGGCAGGAAGG + Intronic
962969833 3:140389285-140389307 CTGTCAGGGGTGTGGGAGGAGGG - Intronic
963706427 3:148694029-148694051 CTGAGAGTGGAGGGGTAGGAGGG - Intergenic
964256691 3:154782658-154782680 GGGTGGGAGGTGGGGAAGAAAGG - Intergenic
964607309 3:158572210-158572232 GTGTGAGGTGAGGGGAAGGAGGG + Intronic
967109304 3:186279482-186279504 CTAAGAGAATTGGGGAAGGAAGG - Intronic
967133832 3:186496580-186496602 CTGAGAGAGCTGGGAAAAGAAGG - Intergenic
967385346 3:188905561-188905583 CTTTGGGAGGTGGAGGAGGATGG - Intergenic
968107893 3:196015303-196015325 GTGTGGGGGGTGGGGAAGGGAGG - Intergenic
968276235 3:197442417-197442439 CTGTGGGAGGTCGAGATGGAAGG + Intergenic
968883733 4:3316010-3316032 CAGTGAGTGGTGGAGAAAGATGG + Intronic
968914246 4:3490265-3490287 ATGAGCAAGGTGGGGAAGGAAGG - Intronic
968959796 4:3737703-3737725 GTGTGAGAGGAGGGGCTGGAGGG - Intergenic
969116317 4:4872695-4872717 CTGCGAGAGGCGGGGACGCAAGG + Intergenic
969175957 4:5399302-5399324 CCTGCAGAGGTGGGGAAGGAGGG - Intronic
969250784 4:5967328-5967350 CTGTGAGAGGTGGGCCAGAGGGG - Intronic
969308394 4:6338521-6338543 CTGTGTGAGGCTGGAAAGGAAGG - Intronic
969462121 4:7334384-7334406 CTGTGGAATCTGGGGAAGGAGGG - Intronic
969477509 4:7429907-7429929 CTGTGGGAGGTGGGCCATGAGGG + Intronic
969681475 4:8645639-8645661 CTGTGATATGAGGGGCAGGAAGG - Intergenic
969884907 4:10206697-10206719 CAGTGTGAGGTGGGGGATGACGG + Intergenic
969914543 4:10477124-10477146 CAGTGATAGTTGGGGAATGATGG - Intergenic
970550066 4:17171450-17171472 CTGTGAGAGGGGTAGAAGGTGGG - Intergenic
970664806 4:18324495-18324517 GTGGGGGAGGTGGGGAAAGAAGG + Intergenic
970914918 4:21321732-21321754 GTGGGAGAAGTGGGGAAGGAGGG + Intronic
971369291 4:26003007-26003029 CTGTGAGAGGTGGTGGTGCAGGG - Intergenic
971403305 4:26296268-26296290 TTGTTAGAGGTGGGGTAGGTAGG - Intronic
971747753 4:30606196-30606218 CGGTTAGAGTTGGGGAAGAAGGG - Intergenic
972198517 4:36683342-36683364 CTGCGGGAATTGGGGAAGGAAGG + Intergenic
972471568 4:39410781-39410803 ATCTGAGAAGTGGGGAATGAAGG - Intronic
972562258 4:40239033-40239055 CTGTGGGAGGAGGGGAGGTAGGG - Intronic
972670020 4:41206305-41206327 ATGGGAGTGGAGGGGAAGGAAGG - Intronic
972973104 4:44601855-44601877 GTGTGGGTGGTGGGGAGGGATGG - Intergenic
974095203 4:57356051-57356073 CTGTGGGAGGAAGGAAAGGAGGG - Intergenic
974518309 4:62945135-62945157 CTTTGAGGGGTGGGGGATGATGG + Intergenic
975410228 4:74039951-74039973 CTTTGAGACGTGGAGTAGGATGG + Intergenic
975846873 4:78534358-78534380 CTGTGGAGGGTGGGGAAGGGAGG + Intronic
976789516 4:88862306-88862328 CAGAGAGAGGTGAGGAGGGAAGG + Intronic
977167168 4:93714086-93714108 CTGTTGGGGGTGGGGGAGGAAGG - Intronic
977720907 4:100239194-100239216 TTATTAGAGGTGAGGAAGGATGG - Intergenic
977927445 4:102717320-102717342 CAGTGAGAGGTTGAGGAGGATGG + Intronic
977996964 4:103505806-103505828 CTGTGAATGGTGGTGATGGATGG - Intergenic
978092767 4:104738280-104738302 CTGTGAGAGGTGGGAATGAGGGG + Intergenic
978119869 4:105065518-105065540 CTGTGAAAGATGAAGAAGGAAGG + Intergenic
979689804 4:123548008-123548030 CTGTGAACTGTGGGGAAGTAAGG + Intergenic
979994353 4:127412543-127412565 CAGAGGGAGGTGGGGAAGGAGGG + Intergenic
980211570 4:129795192-129795214 CTATGCAAGGTGGGGAAGGGAGG + Intergenic
980454184 4:133017973-133017995 TTGCCGGAGGTGGGGAAGGATGG + Intergenic
981113916 4:140967874-140967896 CTGTGGTAAGAGGGGAAGGAAGG + Intronic
981747358 4:148064324-148064346 CAGTGAGATTTGGGGAAGGGGGG + Intronic
982290791 4:153780423-153780445 CTGTGAGATGTGGGGCATGGTGG + Intergenic
982316261 4:154034965-154034987 ATGTCTGAGGTGGGGAAAGAGGG + Intergenic
983021663 4:162684416-162684438 CTGAAAGAGGAGGGGAAGGAAGG + Intergenic
984253318 4:177360588-177360610 CTCCGAGTTGTGGGGAAGGATGG + Exonic
984573518 4:181421458-181421480 CTGGGTGGGGTAGGGAAGGAGGG + Intergenic
984691080 4:182726626-182726648 GCCTGAGAGGTGGGGAAGGCCGG + Intronic
984812566 4:183807700-183807722 CTGGGGGAGGTGGGGTAGGCAGG + Intergenic
984941307 4:184934762-184934784 CTATAAGTGGCGGGGAAGGAAGG + Intergenic
985469831 5:33370-33392 GTGTGGGGGGTGGGGAAGGGAGG - Intergenic
985628015 5:1000121-1000143 CTGAGAGACCTGGGGATGGAGGG + Intergenic
985651351 5:1109200-1109222 CTGGGAGGGGTGGGAAAGGAGGG - Intronic
985783979 5:1884822-1884844 GTGGGAGAGGGGAGGAAGGAGGG - Intronic
985998168 5:3609069-3609091 CTGTGAGAAAAGGGAAAGGAAGG - Intergenic
987278740 5:16390226-16390248 CAGTGAGAGGTGGAGACAGATGG + Intergenic
988050867 5:26029657-26029679 CTGTGGGAGGTTGAGAAGGGTGG - Intergenic
989003990 5:36789450-36789472 CTGTGAGAGCTGGAAAATGAAGG - Intergenic
989111925 5:37914774-37914796 GTGTGAGAGCTGGGAAAGGCTGG + Intergenic
989369579 5:40692092-40692114 CAGTGAGAGGTCTGGCAGGAGGG - Exonic
990181748 5:53168231-53168253 CTGTGGGAAGTGGAGAAGGAGGG + Intergenic
990247251 5:53875112-53875134 GTGTGAAAGGAGGGGAAGAAAGG - Intergenic
990438576 5:55821207-55821229 ATGTGAGAGTTGGGGAATAATGG + Intergenic
990450725 5:55929676-55929698 CTATGAAATGTGGGGAGGGAGGG - Intergenic
990662623 5:58034520-58034542 CTGTGGGAGGTGGGTTTGGAGGG - Intergenic
991544861 5:67770584-67770606 GAGTGAGAGGTGGAGAAGCAAGG + Intergenic
992386469 5:76289423-76289445 CAGTGAGGGGTGGGGAAAGATGG + Intronic
992614122 5:78533460-78533482 CTGTGAGAGTAGGGGATGGGCGG + Intronic
992691450 5:79244408-79244430 CTGAGAGAGATGGGGAGAGAAGG + Intronic
993471951 5:88317053-88317075 CTGTTAGAGGCTGGGAAAGATGG - Intergenic
994013560 5:94938038-94938060 CTGTCAGAGGTAGAGATGGAGGG - Intronic
994077943 5:95674321-95674343 CTGAGAGTGGTGTGGAATGAGGG - Intronic
994389939 5:99180480-99180502 CTGAGAAAGGTGGGGATGGGAGG - Intergenic
994653560 5:102560757-102560779 CTGTGGGTGGTGGGGGAAGAGGG + Intergenic
995436014 5:112136196-112136218 AAGAGAGAGGTGGGGAGGGAGGG + Intergenic
995490387 5:112684909-112684931 CTGAGAGGGGTGGGGAGGAATGG - Intergenic
995916693 5:117255126-117255148 ATATGAGAGGTGGAGAAGGAGGG - Intergenic
996374418 5:122789416-122789438 GTGTGTGTGGTGGGGAAGGTGGG - Intronic
997001013 5:129762008-129762030 CTGTGAGGGGTGGGGGACAAGGG + Intronic
997413570 5:133708176-133708198 GAGGGAGAGGTGGGGAGGGAAGG + Intergenic
997434628 5:133865440-133865462 CTGTGAGAGGTGGGGGAAGGTGG + Intergenic
997500698 5:134371377-134371399 GTGTGAGTGCTGGGGGAGGAGGG - Exonic
997843522 5:137264442-137264464 GAGGGAGAGGAGGGGAAGGAAGG - Intronic
997920961 5:137978984-137979006 CTGTGAGCCCTAGGGAAGGAAGG - Intronic
998050352 5:139027371-139027393 TTGTGAGAAGTGGAGAAGTAGGG - Intronic
998300696 5:141016890-141016912 CTGTGAAAAGTGTGAAAGGAAGG - Intergenic
998385526 5:141755017-141755039 CTGTGGGGGCTGGGGAAGGAGGG + Intergenic
998502326 5:142644419-142644441 ATGTGTGTGGTGGGGAATGAGGG - Intronic
998752679 5:145340284-145340306 CTGTGACAGGTTGGGCAGGCCGG - Intergenic
999264431 5:150257053-150257075 CTGGGTTAGGTGGGGAAGAAGGG - Intronic
999288331 5:150407325-150407347 CTGTGGGAGGTGGGGAGGATAGG + Intronic
999476063 5:151899855-151899877 CTGTGGGAGGTAGGACAGGAAGG - Intronic
999659097 5:153840208-153840230 ATGTGAGAGGTAGAGAAGGAGGG - Intergenic
999716572 5:154365741-154365763 CTGAGTGTGGTGTGGAAGGAAGG - Intronic
999888933 5:155956126-155956148 CTGTGACAGGTGGGAGAGGTGGG - Intronic
1001266263 5:170276605-170276627 CTGGGGGAGCTGGGGCAGGAGGG + Intronic
1001415183 5:171540652-171540674 CGGTGAGATGTGGGTAAAGATGG - Intergenic
1001482776 5:172099986-172100008 CTGTGATGGGTGGGTGAGGAGGG + Intronic
1001542876 5:172551423-172551445 CTCTGAGTGATGGGGAAGAAGGG - Intergenic
1001906250 5:175476020-175476042 ATGTGTGTGGTGGGGAAGGGAGG + Intergenic
1002458404 5:179359542-179359564 GTGTGTGAGGTGTGGAAGGTAGG - Intergenic
1002524023 5:179805984-179806006 CTGTGGGAGGGAGGGAGGGAGGG - Intronic
1002613470 5:180436212-180436234 CTGTGGGGTGTGGGGAAGGGAGG + Intergenic
1002627930 5:180545291-180545313 ACAGGAGAGGTGGGGAAGGAAGG - Intronic
1002712501 5:181203933-181203955 CTGGGAGAGTTGGAGCAGGATGG + Intronic
1002865113 6:1115052-1115074 CTGGTGGAGGTGGGAAAGGAAGG - Intergenic
1003071256 6:2947256-2947278 GTGGGAGAGCTGGGGAAAGAAGG - Intergenic
1003106005 6:3216607-3216629 CGGTGGGAGATGGGAAAGGAGGG + Intergenic
1003811495 6:9787933-9787955 CTGTGGGAGATGTGCAAGGAAGG - Intronic
1003954005 6:11145486-11145508 CTGTGAGGGGTAAGGAAGGAAGG + Intergenic
1004698212 6:18053994-18054016 CAGTGACATGTTGGGAAGGAAGG + Intergenic
1005002233 6:21253555-21253577 GTGTGAGATGTGAGGAAGGTAGG - Intergenic
1005207924 6:23426364-23426386 AGGTGAGGGCTGGGGAAGGAGGG - Intergenic
1005482436 6:26267512-26267534 CTGTGTGAGGTGGGAATTGAAGG + Intergenic
1005624602 6:27651587-27651609 CTGTAAGAGGCGGGGAGGGTGGG + Intergenic
1005849662 6:29812029-29812051 CGGGGAGATGTGGGGGAGGAGGG + Intergenic
1005940376 6:30555950-30555972 CTGGAAGGGGTGGGGAAGGATGG - Intronic
1005955638 6:30661577-30661599 CTGTGAGAGTTGAGGTAGAAAGG - Intronic
1006323268 6:33333589-33333611 CTGGGGGAGTGGGGGAAGGAAGG + Intergenic
1006389432 6:33749805-33749827 CTGTGAAATGAGGGGAATGATGG - Intergenic
1006389802 6:33751675-33751697 CTGTGAAATGAGGGGAATGATGG - Intergenic
1006431594 6:34000578-34000600 CTGGGAGAAGTGGGGATGGAAGG - Intergenic
1006711661 6:36078410-36078432 CTGTGATAGGTAGGAAAGGATGG + Intronic
1006797472 6:36741044-36741066 GTGGGAAAGGTGGGGAAGAAGGG - Exonic
1006823402 6:36916337-36916359 CTGTGGGCGGTGGGTAAAGAGGG - Intronic
1006922137 6:37634034-37634056 CTCTGAGAGGTAGGGGTGGAAGG + Exonic
1006988560 6:38193702-38193724 CTGTGAGAGCGGAGGAGGGATGG - Intronic
1007070720 6:39036244-39036266 CTCTGAGAGGTGGGGAAAGAGGG + Intergenic
1007308174 6:40923407-40923429 ATCTGTGAGGTGGGGAAGGCTGG + Intergenic
1007519268 6:42438914-42438936 ATGGGAGGGGAGGGGAAGGAGGG + Intronic
1007631745 6:43276697-43276719 CACTGAGAGCTGGGAAAGGAAGG - Intronic
1007801920 6:44401581-44401603 CTCTGAGCTGGGGGGAAGGAGGG + Intronic
1007910656 6:45510864-45510886 CTGTAAAAGGTGAGGAAGGAGGG - Intronic
1008057077 6:46956147-46956169 TGGAGAGAGGTGGGGAAGGAGGG - Intergenic
1008255153 6:49289829-49289851 GTGTGTGAGATGGGGAATGATGG + Intergenic
1008497956 6:52152131-52152153 GTGAGAGAGGGAGGGAAGGAAGG + Intergenic
1008559883 6:52713448-52713470 CTGTGTCAGCTGGGGAAGAAAGG + Intergenic
1008693255 6:54004776-54004798 CAGTGAGAGGGAGGGAAGGAGGG + Intronic
1008704197 6:54137902-54137924 TTGAAAGAGCTGGGGAAGGATGG - Exonic
1009644293 6:66377814-66377836 CTGTGGCAGGTGGGGAGGGTGGG + Intergenic
1009995757 6:70893444-70893466 CTGTGATAACTGTGGAAGGATGG - Intronic
1010089284 6:71961039-71961061 GTGCCAGAGGTGGGGAAGAAGGG - Intronic
1010378927 6:75205228-75205250 CTCTGAAAGGTAGGGGAGGAAGG + Intronic
1011125703 6:84005288-84005310 CTGAGAGAGGAGGGGAAACAGGG - Intergenic
1011218682 6:85032071-85032093 CTGTGAGTGTTAGGGGAGGAGGG - Intergenic
1011553161 6:88548269-88548291 CTGTGAGAGGAGGGGAACATAGG + Intergenic
1012249901 6:96968665-96968687 GTCTGAGAGGTGGGGAAGGGAGG - Intronic
1013430429 6:110050451-110050473 CAGTGTGAGGCAGGGAAGGATGG - Intergenic
1014437817 6:121439726-121439748 GGGTAAGAGCTGGGGAAGGAAGG + Intronic
1014911923 6:127104851-127104873 GTGTGTGTGGTGGGGAGGGAGGG - Intergenic
1015055961 6:128903818-128903840 CTGTGGAGGATGGGGAAGGACGG + Intronic
1015323166 6:131898668-131898690 CTGTTAGAGGAGGGGCCGGAGGG - Intergenic
1015591805 6:134829591-134829613 CTGTGAGAGGAGGAAAAGAAGGG + Intergenic
1015982950 6:138857441-138857463 GTGTGGGAGGTGAGGATGGAGGG - Intronic
1016395768 6:143621881-143621903 ATGTGAGAGGTGAGCAAGGCAGG - Intronic
1017212861 6:151876128-151876150 TGGTGGGAGGTGGGGAGGGAGGG + Intronic
1017340295 6:153313465-153313487 CTGTCAGTGGTGGGGAGGGGAGG - Intergenic
1018093323 6:160363600-160363622 CTGTGGGGAGTGGGCAAGGATGG - Intronic
1018225961 6:161629112-161629134 ATGGAAGAGGTGGGGAAGGCAGG + Intronic
1018228834 6:161656291-161656313 GTGTGAGAGGCGCGGATGGATGG - Intronic
1018271195 6:162079666-162079688 TGGAGAGAGGTGGGGAAGGAGGG - Intronic
1018426833 6:163690813-163690835 CAGGGAGAGGTGGGGAAGGCAGG + Intergenic
1018465247 6:164038125-164038147 CTGGGAGAGGTGGGCAGGGATGG + Intergenic
1019298345 7:290586-290608 CTGCGGGATGGGGGGAAGGACGG + Intergenic
1019362587 7:612594-612616 CTATTAGAGGAGAGGAAGGAAGG + Intronic
1020419484 7:7985234-7985256 ATGAGAGAGGGAGGGAAGGAAGG + Intronic
1020470380 7:8527844-8527866 GTGTGAGAGATGGGAAAAGAAGG + Intronic
1021439853 7:20665614-20665636 CTGAGAGAGGTGGGGAAGTGAGG + Intronic
1021668771 7:23014063-23014085 CAGTGAGAGGAGGGGGAAGATGG - Exonic
1022030857 7:26490898-26490920 CTCAGAGAGGTGGAGAAGGGAGG - Intergenic
1022060449 7:26787821-26787843 CTGTTAGAGGTGGGGCCTGATGG - Intronic
1022498732 7:30869295-30869317 CTGATAGAGGAGGAGAAGGATGG + Intronic
1022533375 7:31080775-31080797 CGGGGAGAGGGGAGGAAGGAAGG - Intronic
1022633380 7:32107268-32107290 GGGTGAGAGGGAGGGAAGGAGGG + Intronic
1022656083 7:32320354-32320376 CTGTGGGAGGAGTGGGAGGAGGG + Intergenic
1022776156 7:33529598-33529620 ATGGGAGAGGAGGGGAGGGAAGG - Intronic
1022905239 7:34849401-34849423 CTGTGAGTCATGGAGAAGGAAGG + Intronic
1022905296 7:34849871-34849893 CTGGGAATGGTGGGGAAGGAAGG - Intronic
1023315562 7:38932621-38932643 GGGGTAGAGGTGGGGAAGGAAGG - Intergenic
1023711633 7:42999674-42999696 CTGAGAGAGGTGAGGAAGAAGGG - Intergenic
1024210363 7:47198014-47198036 ATTTGGGAGTTGGGGAAGGAAGG - Intergenic
1024322613 7:48086029-48086051 CTCTGAGAGGTGGGGAGGGAAGG - Intergenic
1024342933 7:48285363-48285385 CAATGAGAGGTGGAGAAAGAGGG + Intronic
1024356187 7:48415937-48415959 AAGAGAGAGGTAGGGAAGGAAGG - Intronic
1024505284 7:50157326-50157348 GTGTTAGAGGTGGAGAAGAAGGG + Intronic
1024920930 7:54553965-54553987 CTGTGTGACGTTGGGAAGGTGGG - Intronic
1025072804 7:55915699-55915721 CTGTGGTTGGTGTGGAAGGAGGG + Intronic
1025855331 7:65271489-65271511 CTGTTAGAGGGGTGGAGGGAGGG - Intergenic
1026824463 7:73572830-73572852 CTGTGGCAGGTGGGCAAGGAGGG - Exonic
1026852887 7:73735870-73735892 CTGGGAGGTGTGGGGAAAGAGGG + Intergenic
1029117482 7:98244747-98244769 CTGGGGAAGGTGGGGAGGGAGGG + Intronic
1029173069 7:98644279-98644301 CCGTAAGAGGGAGGGAAGGATGG - Intergenic
1029180910 7:98701007-98701029 GGGAGAGAGGAGGGGAAGGAAGG + Intergenic
1029372670 7:100159176-100159198 CTGGGAGAAGTGGGGTTGGAAGG - Intergenic
1030105536 7:105983903-105983925 CTGTTTGAGGTGGGGGAAGAAGG - Intronic
1030131306 7:106203753-106203775 GTGTAAGAGGTGGAGAAGGTGGG + Intergenic
1030361202 7:108596984-108597006 TTGGGAGAGGTGGGGTAGAAAGG + Intergenic
1031006809 7:116482799-116482821 CTGAGCAAGGTAGGGAAGGATGG - Intronic
1031383209 7:121113643-121113665 GTGAGAGGGATGGGGAAGGAAGG + Intronic
1031552350 7:123130558-123130580 CTGTCAGGGGTGTGGAGGGAGGG + Intronic
1031560891 7:123236759-123236781 TAGGGAGAGGTGGGGGAGGAAGG - Intergenic
1031916027 7:127563896-127563918 CTTTTAGAGGTGGGCAGGGAAGG - Intergenic
1031950150 7:127883356-127883378 TTGTTAGAGGTAGGGAAGGCAGG - Intronic
1032155015 7:129460787-129460809 GTGTCAGAGGTAGTGAAGGAAGG + Intronic
1032163975 7:129531566-129531588 CTGAGAGAGGTGGCGGCGGAGGG + Intergenic
1032220121 7:129988150-129988172 CAGGGAGAGGCGAGGAAGGATGG + Intergenic
1032490370 7:132319838-132319860 ATAGGAGAGGTGGGGAAGCATGG - Intronic
1032490385 7:132319919-132319941 ATGGGAGAGGTGGGGAAGCATGG - Intronic
1032503467 7:132417699-132417721 GGGGGAGAGGTGGGGGAGGAGGG + Intronic
1033288495 7:140062221-140062243 CCGTGTGGGGTGGGGAGGGAGGG - Intronic
1033322003 7:140348190-140348212 CTGGGGAAGGTGGGGAAGGTGGG + Intronic
1033773409 7:144579685-144579707 CTGGGACAGGTGGGGCTGGAGGG - Intronic
1034271770 7:149806566-149806588 CTGTGAGGGTAGGGGCAGGAGGG + Intergenic
1034293478 7:149950341-149950363 CTGCGAGACGGGGGGAGGGAGGG + Intergenic
1034547524 7:151798893-151798915 TGGTGAGAGGTGAGGAGGGAGGG - Intronic
1034556958 7:151856258-151856280 CAATGAGAGGTGTGGCAGGAGGG + Intronic
1034812589 7:154146512-154146534 CTGCGAGAGGCAGGGAGGGAGGG - Intronic
1034946585 7:155266434-155266456 CAGTGACAGGAGGGGAAGGCAGG - Intergenic
1035216198 7:157369229-157369251 CTGTGAGGGTTGATGAAGGACGG - Intronic
1035226730 7:157438023-157438045 AGGGGAGAGGAGGGGAAGGATGG - Intergenic
1035226750 7:157438082-157438104 AGGGGAGAGGAGGGGAAGGATGG - Intergenic
1035734919 8:1881132-1881154 CTGTGGGAAGTGGGAAAGGAAGG + Intronic
1036095142 8:5715787-5715809 CTGTGAAAGCAAGGGAAGGAGGG + Intergenic
1036206059 8:6806376-6806398 GTGTGAAGGGTGGGGATGGAGGG + Intergenic
1036655843 8:10676762-10676784 CTGTGAGCAGTGGGGAGGCAGGG - Intronic
1036686651 8:10916079-10916101 CTGTGAGCCATGGAGAAGGAGGG + Intronic
1036783124 8:11663878-11663900 CTTTGGGAGGTGGAGATGGAGGG + Intergenic
1037636105 8:20702103-20702125 CTGGGAAAGCTGGGGAAGGAGGG + Intergenic
1037883933 8:22586446-22586468 CTGGGAGGGGAGGGGAAGGAAGG + Intronic
1038027236 8:23602615-23602637 CTTTGGGAGGTCGGGGAGGATGG - Intergenic
1038094005 8:24287245-24287267 GTGGGAGATGTGGGGAAAGACGG - Intergenic
1038336934 8:26653126-26653148 CTGTGAGATCTAGGGATGGAGGG - Intronic
1038461516 8:27721104-27721126 ATGAGGGAGGTGGGGAGGGAGGG - Intergenic
1038509285 8:28115854-28115876 CTGAGGGTGGTAGGGAAGGAGGG - Intronic
1038779261 8:30556701-30556723 CTGAGACAGGTGGGAAAGGACGG - Intronic
1039055697 8:33534619-33534641 TAGTGAGAGATGGGGAAGGGAGG - Intergenic
1039129210 8:34242578-34242600 GTGTGAGAGAGAGGGAAGGAGGG + Intergenic
1039242331 8:35570609-35570631 CTGGGAGAGTTGGGGACTGAGGG - Intronic
1039366579 8:36934364-36934386 CTCTGATGGATGGGGAAGGAAGG + Intronic
1039762893 8:40597061-40597083 ATGTGAGATATGGGGATGGATGG + Intronic
1040072669 8:43201176-43201198 CTTTAAGAAGTGGGGAACGAGGG - Exonic
1040515522 8:48131049-48131071 CTGGGAGAGGCGGGCAGGGAAGG - Intergenic
1040545156 8:48393277-48393299 CTGTGAGAAGTGGGCATGGTGGG + Intergenic
1041091910 8:54309933-54309955 CTGTGAGGGGAAGAGAAGGAAGG - Intergenic
1041737925 8:61131486-61131508 CACTGAAAGGTGAGGAAGGACGG + Intronic
1042384297 8:68154879-68154901 ATGGGAGAGGTGGGGAATGTAGG + Intronic
1042636580 8:70882669-70882691 GTGGGAGTAGTGGGGAAGGAAGG - Intergenic
1043449107 8:80349047-80349069 GTATGTGAGGTGGGCAAGGAGGG + Intergenic
1044279235 8:90337276-90337298 GTGAGAGAGGTTGGGACGGAGGG - Intergenic
1044619402 8:94173997-94174019 CTGTGAGAAGTAGGGGAGAAGGG + Intronic
1044727562 8:95205626-95205648 CTGGGGGATGTGGGTAAGGAGGG + Intergenic
1044730819 8:95227127-95227149 AGGTGGGAGGTGGGGAAGAAAGG + Intergenic
1044843890 8:96361322-96361344 CTGGGAGAGCTAGAGAAGGATGG - Intergenic
1044872233 8:96630760-96630782 CTGTGAGATGTTGGGCAGGTTGG + Intergenic
1044986602 8:97761509-97761531 GTGTCAAAGGTGGAGAAGGAAGG - Intergenic
1045459365 8:102412616-102412638 CTAGGGGAGGTGAGGAAGGAGGG + Exonic
1045507393 8:102788435-102788457 TGGGGAGAGGTGGGGAAAGATGG + Intergenic
1045727815 8:105196049-105196071 CTGTAAGAGGTGGAGTAGAATGG - Intronic
1047325869 8:123835303-123835325 CTGAGACAGGTGGAGAAGGGTGG - Intergenic
1047498727 8:125426833-125426855 CTGTGGGAAGAGGGGGAGGAAGG + Intergenic
1047908080 8:129494269-129494291 CTTTGGGAGGCGGAGAAGGAGGG + Intergenic
1048271896 8:133035998-133036020 CTGAGGGAGCTAGGGAAGGAGGG - Intronic
1048423257 8:134297901-134297923 CTGTGGGAGGTGGGGGTGGCAGG + Intergenic
1048512793 8:135077891-135077913 CTGTGAGTGTTGGGGAATGGGGG - Intergenic
1048605338 8:135962624-135962646 CTGTGGGAGGAGGGGGAGGCTGG - Intergenic
1048979006 8:139693081-139693103 TTGTCAGAGGTGTGGAAGGTGGG - Intronic
1048991018 8:139760183-139760205 CTCTGTGAGTAGGGGAAGGAGGG + Intronic
1049094556 8:140540737-140540759 GTGTGAGAGGTGTGGAGGCAGGG - Intronic
1049403272 8:142440350-142440372 CTGTGGCAGGTGGGGAGGCAGGG + Intergenic
1049414041 8:142487380-142487402 CAGTGAGCGGAGGGGCAGGAGGG - Intronic
1049454610 8:142680640-142680662 CACGGAGAGGAGGGGAAGGAAGG + Intronic
1049479855 8:142816727-142816749 CTCTGACAGTTGCGGAAGGAGGG - Intergenic
1049534787 8:143173886-143173908 CAGAGAGAGGGGGGGAGGGATGG + Intergenic
1049578711 8:143401172-143401194 CTGTGGGAGGTGGGAAAAGGGGG + Intergenic
1049612914 8:143563758-143563780 CTGACAGAAGTGGGGAAGGCTGG - Intergenic
1049684369 8:143933486-143933508 ATGTGTGAGGTGGGCAGGGAGGG - Intronic
1050150012 9:2609781-2609803 CTGGGGGAGGTGGGGAGGGAGGG + Intergenic
1050539331 9:6656700-6656722 AAGTGTGAAGTGGGGAAGGAGGG + Intergenic
1051156475 9:14152852-14152874 TTGTCAGAGGTGGGGGAGGGTGG + Intronic
1051256998 9:15224154-15224176 CAGTGGGAGGTGGGGAAGTAGGG - Intronic
1051311077 9:15773355-15773377 CTTGATGAGGTGGGGAAGGAAGG - Intronic
1051483126 9:17579787-17579809 CTGCGGGCGGCGGGGAAGGAGGG - Intronic
1051939325 9:22485951-22485973 CTGAGACAAGTGGGGATGGAAGG + Intergenic
1052557998 9:30044871-30044893 CTGTGAGTTGGGGAGAAGGAGGG + Intergenic
1053728280 9:41026377-41026399 ATGTGAGAGGTAGGCAAGGTGGG + Intergenic
1054700228 9:68405710-68405732 ATGTGAGAGGTAGGCAAGGTGGG - Intronic
1055299645 9:74869795-74869817 CGGAGAGCGGTGGGGAGGGAAGG + Intronic
1055608660 9:77998031-77998053 GTATGAGAAGTGGGGAAGAAAGG - Intronic
1056379093 9:86041272-86041294 GTCTTGGAGGTGGGGAAGGATGG + Intronic
1056433533 9:86552628-86552650 CAGTGGGAGCTGGGTAAGGATGG + Intergenic
1056438757 9:86598832-86598854 CTGTGTGGGGTGGGGTAGGAGGG - Intergenic
1056481071 9:87006954-87006976 TTCTGGGAGTTGGGGAAGGAAGG - Intergenic
1056517914 9:87372431-87372453 CTGTGGGAGGTGGGGTTGGAAGG - Intergenic
1057069047 9:92080179-92080201 CTGTTAGAGTTGGAGGAGGAAGG - Intronic
1057113290 9:92495099-92495121 CTTTGTGAAGTGGGGATGGAAGG + Intronic
1057221306 9:93259320-93259342 CCGTGTGATGGGGGGAAGGAGGG - Exonic
1057236688 9:93366838-93366860 CTGTGTGGGCTGGGGCAGGAGGG - Intergenic
1057397019 9:94689484-94689506 CAGTGAGAGATGGGAATGGAAGG + Intergenic
1057854903 9:98594481-98594503 CTGGGAGGGGAGGGGAAGGGAGG + Intronic
1058075459 9:100646028-100646050 CTGTGAGGGGTGGGGGGAGAGGG - Intergenic
1059326280 9:113505889-113505911 TTGTGAAAAGTAGGGAAGGATGG - Intronic
1059762698 9:117354126-117354148 CTATGTGTGGTGGGGAAGGGCGG + Intronic
1060401555 9:123352783-123352805 CTGTGAGAGCTGGGCTGGGAGGG + Intergenic
1060473108 9:123965111-123965133 CTTTGAGAAGTCGGGAAGCAAGG - Intergenic
1060807546 9:126587113-126587135 CTGTGAGGGATGGGAGAGGAGGG - Intergenic
1061096164 9:128457631-128457653 CTGTGACATCTGGGGAGGGAAGG - Intronic
1061420817 9:130472094-130472116 CTGTGGGAGGTGGGGGAGGCAGG + Intronic
1061442121 9:130612723-130612745 TGGGGAGAGGTGGGGAAGGGAGG - Intronic
1061566790 9:131446110-131446132 TTGTGAGACTTGGGGAAGGGTGG + Intronic
1061942726 9:133891886-133891908 TTGGGAGAGGTGGGGATAGAGGG + Intronic
1062067888 9:134538608-134538630 TTGGGAGACCTGGGGAAGGAAGG - Intergenic
1062188388 9:135230725-135230747 CTTTGTGGGGTGGGGTAGGAGGG - Intergenic
1062395554 9:136351256-136351278 ATGGGAGAGGTGTGGAGGGAAGG + Intronic
1185618153 X:1435759-1435781 CTGTGAGAGGAAGGGACAGAGGG + Intronic
1185824894 X:3240623-3240645 GAGTGAGAGGGAGGGAAGGAAGG - Intergenic
1186611346 X:11140646-11140668 CTGTGAGGGGTGAGGAGGGGCGG - Intronic
1187128419 X:16476294-16476316 CGGTGAGAAGTGGGGCAGGCAGG - Intergenic
1187915671 X:24150176-24150198 CGGTGAGGGGGGGGGAGGGACGG + Intronic
1189697270 X:43677108-43677130 CTGGGAGAGGTGGAGAAGGCAGG + Intronic
1190055765 X:47180189-47180211 CTGTGGGAGGAGGGGAGGCAGGG - Intronic
1190136900 X:47806247-47806269 CTGGGAAAAGTGGGGAGGGAGGG - Intergenic
1191885475 X:65883629-65883651 CAGTGAGAGGTGAGGAATGGAGG - Intergenic
1192269890 X:69569044-69569066 ATGTGAAAGGTGTGGAAGCAGGG + Intergenic
1192428537 X:71097357-71097379 GGGTGGGAGGTGGGGGAGGAGGG - Intronic
1192534298 X:71914067-71914089 GTGTGGGAGATGGGGATGGAAGG + Intergenic
1192718605 X:73668999-73669021 CAGGGAGAGGTGGGGAGGGGTGG + Intronic
1193275320 X:79579717-79579739 GTGTTAGAGGTGGGGAATGGTGG + Intergenic
1193661070 X:84259201-84259223 CTGTTAGTGGTGGGAGAGGAAGG - Intergenic
1194605745 X:95975848-95975870 CTGTGAGAGGTGGAGCAAGATGG + Intergenic
1194606971 X:95992710-95992732 CTTTGAGAGGTGGAGATGGGAGG + Intergenic
1194820209 X:98496641-98496663 TTGGGAGAGGGGGAGAAGGAAGG - Intergenic
1194899346 X:99489496-99489518 CTGCTAGAGGTTGGGAAGGGTGG - Intergenic
1194969179 X:100324055-100324077 CTGTGAGAGGTGTGACATGATGG + Intronic
1194982036 X:100450646-100450668 CTATGAGAGGTGGGGGTGGGTGG - Intergenic
1195129567 X:101839752-101839774 CGATGTGAGGTGGAGAAGGAGGG + Intronic
1195176672 X:102320077-102320099 CGATGTGAGGTGGAGAAGGAGGG - Intronic
1195182192 X:102367016-102367038 CGATGTGAGGTGGAGAAGGAGGG + Intronic
1195202538 X:102564768-102564790 CGATGTGAGGTGGGGAAGGAGGG - Intergenic
1195519790 X:105817978-105818000 CTGTGCCAGGTGAGGAAGAATGG + Intergenic
1196007646 X:110852913-110852935 CTGTAGGAGGTGGGGGAGCAGGG - Intergenic
1196067233 X:111477698-111477720 CTGTCAGAGGTGGGGAGCTAGGG + Intergenic
1196749980 X:119107342-119107364 CTTAGAGAGGAGGGGAAAGAAGG + Intronic
1197770838 X:130088265-130088287 CTGTGAGTGGAGGAGATGGAGGG + Intronic
1198074308 X:133180128-133180150 CTGTGTTAAGTGGGGAAAGAAGG - Intergenic
1199255410 X:145713751-145713773 ATGTGTCAGGTGGGAAAGGAGGG - Intergenic
1199503735 X:148538026-148538048 CCTTGAGGGGAGGGGAAGGATGG - Intronic
1199847633 X:151702491-151702513 CTGTGAGGTAGGGGGAAGGATGG - Exonic
1200102415 X:153694641-153694663 CTGGGGGAGGTGGGGCAGGGCGG + Intronic
1200256022 X:154583968-154583990 CTGGGAAAGGTGGGGAGGGTGGG - Intergenic
1200261747 X:154620435-154620457 CTGGGAAAGGTGGGGAGGGTGGG + Intergenic
1200366055 X:155665752-155665774 CAGTGAGAAGTGGGGGATGAAGG + Intronic
1200817461 Y:7548370-7548392 CAGAGAGAGGGAGGGAAGGAGGG + Intergenic