ID: 904206051

View in Genome Browser
Species Human (GRCh38)
Location 1:28855932-28855954
Sequence GACTCACTCATTGTCCTCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 3, 3: 12, 4: 152}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904206051_904206054 17 Left 904206051 1:28855932-28855954 CCCTGGAGGACAATGAGTGAGTC 0: 1
1: 0
2: 3
3: 12
4: 152
Right 904206054 1:28855972-28855994 AAATACCAGTCACTTCATGCAGG 0: 1
1: 0
2: 1
3: 11
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904206051 Original CRISPR GACTCACTCATTGTCCTCCA GGG (reversed) Intronic
901746087 1:11374692-11374714 GACTGACTCATTGTCCCCCCGGG + Intergenic
904206051 1:28855932-28855954 GACTCACTCATTGTCCTCCAGGG - Intronic
906188594 1:43880973-43880995 GCCTCACCCATTATCCACCAAGG + Intronic
907784925 1:57602422-57602444 CACTGACTCATTTTCCTCCTAGG + Intronic
908788239 1:67756064-67756086 GACGAACCCATTGTCCTCAAGGG + Intronic
909585099 1:77281150-77281172 TACTCACTCATATTCCCCCAGGG + Intergenic
914909764 1:151775482-151775504 GACTCACTCATTGTGCTGACTGG - Exonic
915130793 1:153694062-153694084 GACTCACTTCTTGTTCTACAAGG + Intergenic
915316988 1:155034284-155034306 GGCTCCCTCATCCTCCTCCAGGG + Intronic
918281916 1:183015033-183015055 GAGTCTCTCTCTGTCCTCCAGGG - Intergenic
918731654 1:188005258-188005280 GACTCCCTAATTTTCCTGCATGG - Intergenic
919497648 1:198295368-198295390 GACTTACTCCCTGACCTCCAGGG - Intronic
921345668 1:214182447-214182469 GACTCAGTCATTCTCTTCCTAGG - Intergenic
921858955 1:220020391-220020413 AACTGACTCATTGTTCTCAAAGG - Intronic
1065769511 10:29064431-29064453 GACTCACTATCTGTCCTCCTTGG + Intergenic
1070029587 10:72664107-72664129 GACTCACTCCCTCTCCTCCCTGG + Intergenic
1070288487 10:75100119-75100141 GACACACCCATTGGCCACCAGGG - Intronic
1073067166 10:100769065-100769087 GACTGACTCATTCTACTCAATGG + Intronic
1073572410 10:104591704-104591726 GACTCACTGCTTCTCCACCATGG - Intergenic
1079158051 11:17967252-17967274 CCCTCAGTCATTGTCCTGCAGGG + Intronic
1079716066 11:23747034-23747056 GACTCAGACCTTGTCCTCAAAGG - Intergenic
1079775648 11:24522510-24522532 GACTCACACCCTGTCCTCAAAGG - Intronic
1080640551 11:34155912-34155934 CACTCACTCAGTGCCCTGCATGG - Intronic
1082072290 11:47948825-47948847 TCCTCACTCTTTGTTCTCCAAGG - Intergenic
1083176435 11:60952717-60952739 GACTCACTTGTGGTCCTCTATGG - Intergenic
1083410975 11:62492128-62492150 GACCCAGTCATTCTCCTCAAGGG + Intronic
1085341444 11:75734127-75734149 GGCTCAGTCTCTGTCCTCCAAGG - Intergenic
1087318455 11:96632143-96632165 GTCTCACTGATAGCCCTCCATGG - Intergenic
1088548997 11:110991418-110991440 ATCTCACTCAATGACCTCCAAGG + Intergenic
1089524681 11:119089257-119089279 TACTTACTCATTCTTCTCCAGGG - Exonic
1090625636 11:128606116-128606138 GACCCACACCTTGTCCTCCATGG + Intergenic
1096017162 12:48287058-48287080 GACTCACTCCTTGAGCTCCTGGG + Intergenic
1098864640 12:75747804-75747826 GGCTCAGTAATTGTACTCCAGGG - Intergenic
1099153078 12:79139824-79139846 GACTCACTCATTCTGCTCAGTGG - Intronic
1100376355 12:94019474-94019496 AACTCACTCATTCCCCTCCCAGG + Intergenic
1101181531 12:102223854-102223876 GACTCACTGAATGACCTCTAAGG + Intergenic
1103943596 12:124513969-124513991 GCCTGACTCAGTGTCTTCCACGG - Intronic
1104117998 12:125768761-125768783 GACTCACTGATTTTCAACCAAGG - Intergenic
1106756814 13:32829954-32829976 GACTCACTGTGTGTCCTGCAGGG - Intergenic
1113593666 13:111517438-111517460 CACCCACTCCTCGTCCTCCATGG - Intergenic
1113798145 13:113070775-113070797 GGCTCACTCATTGTGTTCCCCGG + Intronic
1115510146 14:34130651-34130673 GCCTCACTCTCTGTCATCCAGGG + Intronic
1117371505 14:55082639-55082661 GACCCACTCATTCTACTCCCAGG + Intergenic
1117476483 14:56100533-56100555 GATTTACTCATTGTCCTACTGGG + Intergenic
1118183845 14:63520648-63520670 GGCTAACTCAGTCTCCTCCAAGG - Intronic
1118471528 14:66079312-66079334 GACTCACTTATTTTCCTCATCGG - Intergenic
1120973250 14:90227082-90227104 GACTCACTCATTCTACTTCTAGG + Intergenic
1122072451 14:99213538-99213560 GAAACACTCATTTTACTCCACGG + Intronic
1123759985 15:23424595-23424617 GTCTTCCTCCTTGTCCTCCAGGG + Intergenic
1124824449 15:33080173-33080195 GACTCTTTCATTGGCTTCCATGG + Intronic
1125419766 15:39492870-39492892 GACACACTCATTTTTGTCCATGG - Intergenic
1128303273 15:66580812-66580834 GAGTCACCCATTGTCCCCCTGGG + Intergenic
1129171925 15:73813118-73813140 GACTCACACAGTGTCCTCTCTGG - Intergenic
1129196223 15:73968480-73968502 GCCTCACTCTCTGACCTCCAGGG - Intergenic
1131287682 15:91075192-91075214 GACTCACTGGCTGGCCTCCATGG - Intergenic
1133580902 16:7143622-7143644 GACTCACTCACTCCCCTTCAAGG - Intronic
1134456358 16:14398285-14398307 GTCTTCCTCCTTGTCCTCCAGGG - Intergenic
1137893395 16:52185430-52185452 GAGTCACTCATAGGCCACCATGG - Intergenic
1138578376 16:57923266-57923288 GTCTCACTCAGTGTCCTTCGGGG + Exonic
1140241678 16:73207121-73207143 GACTCAGTCCCTGTACTCCAAGG + Intergenic
1140299733 16:73745392-73745414 GAGTCACTCATGGTCCTACAAGG + Intergenic
1141578026 16:84977357-84977379 GGCACATTCATTGTTCTCCAAGG + Intronic
1143565657 17:7718978-7719000 CACTCACTCATGGTCCTGGAGGG + Intronic
1146545657 17:33735733-33735755 GGATCACTCACTGTGCTCCAGGG + Intronic
1146835697 17:36108786-36108808 GACACAGGCATTTTCCTCCAAGG + Intergenic
1147469508 17:40646840-40646862 GACTCATTCCTTATGCTCCAGGG - Intronic
1152430356 17:80245391-80245413 GGGTCACCCACTGTCCTCCAGGG + Intronic
1153363911 18:4231752-4231774 GAATCATTCATTGTCCTGGAAGG - Intronic
1154256809 18:12788755-12788777 GAAAGACTCATTGTCCTTCAGGG - Intronic
1155084104 18:22439858-22439880 GACTCTCTCTTTTTCTTCCATGG - Intergenic
1155224595 18:23718384-23718406 GCCTGACTCATTGTGTTCCAGGG + Intronic
1156880655 18:42073843-42073865 GACTCACTCACTGACCTAGAAGG - Intronic
1159405556 18:67998045-67998067 GACTTACTTATTGTCATCCATGG - Intergenic
1164788585 19:30957296-30957318 GCCCCACTCTTTGCCCTCCAAGG - Intergenic
1165668950 19:37658373-37658395 CACTAACTCACTGTCCTCAAAGG - Intronic
1167856381 19:52244750-52244772 GAGACAGTGATTGTCCTCCACGG - Intergenic
925515310 2:4674802-4674824 GGCCCACTCATGGTCATCCATGG + Intergenic
925746814 2:7050756-7050778 GGCTCCCTCACTGGCCTCCATGG + Intronic
926974064 2:18495590-18495612 GACTCACTCCCTGTCCCCAAGGG + Intergenic
928033379 2:27799945-27799967 AAGTCATTCTTTGTCCTCCAAGG + Intronic
929052342 2:37848622-37848644 GACTCACTCCCTGCCCTCAAAGG - Intergenic
933464079 2:82627984-82628006 GACTCTCTCATTCTCCTGCAAGG - Intergenic
935682221 2:105647886-105647908 CACTTCCTCATCGTCCTCCAGGG - Intergenic
936842211 2:116784866-116784888 GTCTCACTCACTTTCCTCCATGG + Intergenic
938601772 2:132849782-132849804 GACTAAATCATTGAACTCCAAGG - Intronic
939526094 2:143296153-143296175 AACTCACTCGCTGTCCTCCAGGG - Intronic
941594364 2:167456948-167456970 GCCCCACTCTTTGACCTCCAAGG - Intergenic
946486558 2:220106064-220106086 GGCCAACTCAGTGTCCTCCATGG - Intergenic
948257485 2:236578547-236578569 ACCTGACTCAGTGTCCTCCACGG - Intronic
1170826978 20:19805207-19805229 TACTCCCTCATTGTGCTTCAGGG - Intergenic
1171382733 20:24745794-24745816 GACTCACTCCAGGACCTCCAGGG + Intergenic
1171387254 20:24778763-24778785 GGCTCCCAGATTGTCCTCCAGGG + Intergenic
1177008838 21:15707047-15707069 GACTGACTCATTCACTTCCAGGG + Intergenic
1178136937 21:29638187-29638209 GACTCACTCACAGTTCTGCATGG + Intronic
1179093850 21:38293645-38293667 GAATCACTCATTCTCCTCCAGGG - Intronic
1179604985 21:42509348-42509370 GACTCAGTCATTGTTGTTCATGG + Intronic
1182941720 22:34283352-34283374 GATTAAGTCATTCTCCTCCAAGG - Intergenic
1184554239 22:45224768-45224790 GCCTCACTCATCTTCCCCCAAGG - Intronic
949891695 3:8738091-8738113 GACTCACACATAGGCCCCCAGGG + Intronic
950193714 3:10994528-10994550 GACTCACTGTTTGTCCTCCAAGG - Intronic
951525198 3:23646703-23646725 GAATCACTCTTTTTCCCCCAGGG - Intergenic
952133790 3:30394607-30394629 TACTCACTCCTTGTCATTCAGGG + Intergenic
956050586 3:65244141-65244163 GACACAGTTCTTGTCCTCCATGG + Intergenic
956459912 3:69461595-69461617 GAGTCTCACTTTGTCCTCCAGGG - Intronic
956708037 3:72016187-72016209 GACCCACTCCTTAACCTCCAGGG + Intergenic
960130484 3:114050863-114050885 GACTGACTCATCTTACTCCAGGG - Intronic
965470576 3:169085300-169085322 GACTGACTCATTTTTCTCAATGG - Intronic
966294424 3:178402344-178402366 AACTCACAAATTGTTCTCCATGG - Intergenic
966469790 3:180276285-180276307 GACTCACTCATTTCCATGCAAGG + Intergenic
967637519 3:191820753-191820775 GATTCACTCATTCTCCTCTTTGG + Intergenic
974097108 4:57375378-57375400 GAATCACTCACTTTGCTCCAGGG - Intergenic
976151040 4:82092092-82092114 AACACAGTCATTGTCCTCTACGG - Intergenic
980707489 4:136519258-136519280 GACTCAATCATTTCCCACCATGG + Intergenic
986488718 5:8267416-8267438 GACTCAGTATTTGTCCTCCAGGG - Intergenic
987183824 5:15394378-15394400 GACTCAGTCATTCTACTCCCTGG - Intergenic
987276097 5:16364345-16364367 GACTCAATCCTTAACCTCCAGGG - Intergenic
987982309 5:25101846-25101868 GACTCATTCAAGGTCATCCATGG + Intergenic
988102467 5:26699189-26699211 GACTCACACATGGACATCCATGG - Intergenic
989490587 5:42048123-42048145 CACTCACTCACTGTTTTCCAGGG - Intergenic
990020973 5:51127417-51127439 GACTGACTCATAGTCCCACATGG - Intergenic
994404198 5:99323024-99323046 GACTCACTAACTGTACTTCAAGG - Intergenic
999312057 5:150557879-150557901 TCCTCCCTCATTCTCCTCCAGGG - Exonic
1003418578 6:5935705-5935727 CACTCACCCTTTGGCCTCCATGG + Intergenic
1005781736 6:29200583-29200605 GACTCAGTGACTGTCTTCCAAGG + Intergenic
1006423625 6:33950429-33950451 GCCTCTGTCATTGTCCTCTAGGG + Intergenic
1007009372 6:38400419-38400441 AAATCACTCAATGTCCTCTAAGG + Intronic
1007174191 6:39885063-39885085 GACCCACTCATTGGCACCCAGGG - Intronic
1007282450 6:40722556-40722578 GACTGCCTCATTGCCTTCCAAGG - Intergenic
1010041389 6:71388965-71388987 AACTGACTCATTGTTCTCCTGGG + Intergenic
1016734270 6:147459403-147459425 TACTAAATCATTGTTCTCCAAGG - Intergenic
1018261311 6:161973694-161973716 GACTCACTTATTATCATCGAGGG - Intronic
1018329249 6:162709997-162710019 TGCTCACTCATTCTCCTCCACGG + Intronic
1018640058 6:165897444-165897466 GACCCTCTCATTCTCCTCCCTGG - Intronic
1022515814 7:30974474-30974496 GACTCACGCGATGTCCTCGAAGG - Exonic
1024686100 7:51747048-51747070 GACTGTGTTATTGTCCTCCAGGG + Intergenic
1027252169 7:76405834-76405856 GACTCAGAGATTATCCTCCAGGG + Intronic
1027454062 7:78365322-78365344 GAATCCCTCATTCTTCTCCAGGG + Intronic
1028103369 7:86848522-86848544 AACTCACTCAAGGTCCTGCAGGG - Intronic
1028194711 7:87892782-87892804 GACTTACTCATTGTCCTGTGGGG + Intronic
1032246561 7:130218446-130218468 GACTCCCTCATTGCCTCCCAAGG - Intergenic
1033301093 7:140186411-140186433 GACACATTCTCTGTCCTCCAAGG + Intergenic
1035616372 8:1005024-1005046 TCTTCACTCATTGCCCTCCATGG - Intergenic
1037723749 8:21466590-21466612 AAATCACTCATTGTCATACAAGG - Intergenic
1037819360 8:22128312-22128334 GACTCACCCATTGTCTGCCTAGG - Intronic
1037943697 8:22973563-22973585 GACCCACTGCTTGCCCTCCAGGG - Intronic
1039135782 8:34321336-34321358 AACTCACTCATTGTGATCCCAGG - Intergenic
1039431604 8:37529321-37529343 CACTCACTCATTGTCCTGCTTGG - Intergenic
1039678163 8:39695248-39695270 GACTCAGTAATTGTGCTCCTTGG - Intronic
1043977585 8:86600304-86600326 GAAACAATCACTGTCCTCCAGGG - Intronic
1045483578 8:102612500-102612522 CACTCACCCACTCTCCTCCAGGG + Intergenic
1046613946 8:116455548-116455570 GACTGTCTCCTTGTCCTTCAAGG - Intergenic
1047152554 8:122280724-122280746 AAGGCACTCATTATCCTCCAGGG - Intergenic
1047155464 8:122312804-122312826 GACTCACTCAAGGTCAGCCATGG + Intergenic
1048174753 8:132141405-132141427 GACTCACACATTCTCCTCCAAGG + Intronic
1049278561 8:141732255-141732277 GACTCCCCCATTGTCCTTCTGGG + Intergenic
1053010786 9:34631769-34631791 TTCTGACTCATTGTCCTCTAAGG + Intergenic
1053289032 9:36867990-36868012 GTCACTCTCATTGTCCTCCCGGG - Intronic
1054957099 9:70924556-70924578 GACTCAGTCATTGTACTTCTAGG - Intronic
1055068290 9:72141059-72141081 GAATCACTCATTCTCCCCCATGG - Intronic
1058309892 9:103486519-103486541 GACTCACTCATAGTTCTGCATGG - Intergenic
1060457781 9:123816663-123816685 GACTTACTCATTGGCCCTCAAGG - Intronic
1187014303 X:15310316-15310338 GACTCAATCATTCTCTTCTAAGG + Intronic
1187968641 X:24637858-24637880 GTCTCACTCCTTTTTCTCCATGG - Intronic
1189730729 X:44017789-44017811 TCCTCACTCATTTTCCTTCAGGG + Intergenic
1192312609 X:70029213-70029235 TGCTCTCTCATTGTTCTCCATGG + Intronic
1193201866 X:78701001-78701023 GACTAACTCATTTTCCTAAATGG - Intergenic
1195212369 X:102661794-102661816 GCCTCACCCCTTGACCTCCAAGG - Intergenic
1195218410 X:102722543-102722565 GCCTCACCCCTTGACCTCCAAGG - Intronic