ID: 904208982

View in Genome Browser
Species Human (GRCh38)
Location 1:28873407-28873429
Sequence TAGGAACTATGGAAGGTTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904208982_904208987 7 Left 904208982 1:28873407-28873429 CCTTAAACCTTCCATAGTTCCTA No data
Right 904208987 1:28873437-28873459 GGAAAATCAGATGATCTCTCAGG No data
904208982_904208988 21 Left 904208982 1:28873407-28873429 CCTTAAACCTTCCATAGTTCCTA No data
Right 904208988 1:28873451-28873473 TCTCTCAGGCCCCTTTCTAATGG No data
904208982_904208989 24 Left 904208982 1:28873407-28873429 CCTTAAACCTTCCATAGTTCCTA No data
Right 904208989 1:28873454-28873476 CTCAGGCCCCTTTCTAATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904208982 Original CRISPR TAGGAACTATGGAAGGTTTA AGG (reversed) Intergenic
No off target data available for this crispr