ID: 904208985

View in Genome Browser
Species Human (GRCh38)
Location 1:28873418-28873440
Sequence TTCCACACAAATAGGAACTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904208985_904208988 10 Left 904208985 1:28873418-28873440 CCATAGTTCCTATTTGTGTGGAA No data
Right 904208988 1:28873451-28873473 TCTCTCAGGCCCCTTTCTAATGG No data
904208985_904208989 13 Left 904208985 1:28873418-28873440 CCATAGTTCCTATTTGTGTGGAA No data
Right 904208989 1:28873454-28873476 CTCAGGCCCCTTTCTAATGGAGG No data
904208985_904208994 21 Left 904208985 1:28873418-28873440 CCATAGTTCCTATTTGTGTGGAA No data
Right 904208994 1:28873462-28873484 CCTTTCTAATGGAGGACCCTGGG No data
904208985_904208992 20 Left 904208985 1:28873418-28873440 CCATAGTTCCTATTTGTGTGGAA No data
Right 904208992 1:28873461-28873483 CCCTTTCTAATGGAGGACCCTGG No data
904208985_904208987 -4 Left 904208985 1:28873418-28873440 CCATAGTTCCTATTTGTGTGGAA No data
Right 904208987 1:28873437-28873459 GGAAAATCAGATGATCTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904208985 Original CRISPR TTCCACACAAATAGGAACTA TGG (reversed) Intergenic
No off target data available for this crispr