ID: 904208986

View in Genome Browser
Species Human (GRCh38)
Location 1:28873426-28873448
Sequence ATCTGATTTTCCACACAAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904208986_904208988 2 Left 904208986 1:28873426-28873448 CCTATTTGTGTGGAAAATCAGAT No data
Right 904208988 1:28873451-28873473 TCTCTCAGGCCCCTTTCTAATGG No data
904208986_904208989 5 Left 904208986 1:28873426-28873448 CCTATTTGTGTGGAAAATCAGAT No data
Right 904208989 1:28873454-28873476 CTCAGGCCCCTTTCTAATGGAGG No data
904208986_904208992 12 Left 904208986 1:28873426-28873448 CCTATTTGTGTGGAAAATCAGAT No data
Right 904208992 1:28873461-28873483 CCCTTTCTAATGGAGGACCCTGG No data
904208986_904208994 13 Left 904208986 1:28873426-28873448 CCTATTTGTGTGGAAAATCAGAT No data
Right 904208994 1:28873462-28873484 CCTTTCTAATGGAGGACCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904208986 Original CRISPR ATCTGATTTTCCACACAAAT AGG (reversed) Intergenic
No off target data available for this crispr