ID: 904208989

View in Genome Browser
Species Human (GRCh38)
Location 1:28873454-28873476
Sequence CTCAGGCCCCTTTCTAATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904208982_904208989 24 Left 904208982 1:28873407-28873429 CCTTAAACCTTCCATAGTTCCTA No data
Right 904208989 1:28873454-28873476 CTCAGGCCCCTTTCTAATGGAGG No data
904208986_904208989 5 Left 904208986 1:28873426-28873448 CCTATTTGTGTGGAAAATCAGAT No data
Right 904208989 1:28873454-28873476 CTCAGGCCCCTTTCTAATGGAGG No data
904208985_904208989 13 Left 904208985 1:28873418-28873440 CCATAGTTCCTATTTGTGTGGAA No data
Right 904208989 1:28873454-28873476 CTCAGGCCCCTTTCTAATGGAGG No data
904208983_904208989 17 Left 904208983 1:28873414-28873436 CCTTCCATAGTTCCTATTTGTGT No data
Right 904208989 1:28873454-28873476 CTCAGGCCCCTTTCTAATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904208989 Original CRISPR CTCAGGCCCCTTTCTAATGG AGG Intergenic
No off target data available for this crispr