ID: 904209016

View in Genome Browser
Species Human (GRCh38)
Location 1:28873562-28873584
Sequence GCTGAAGTCCAGCTCAGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904209013_904209016 -4 Left 904209013 1:28873543-28873565 CCACTACAGGAAGAGGACTGCTG No data
Right 904209016 1:28873562-28873584 GCTGAAGTCCAGCTCAGGGCAGG No data
904209006_904209016 25 Left 904209006 1:28873514-28873536 CCTCAAAGTCTCTTGAGGGGGAA No data
Right 904209016 1:28873562-28873584 GCTGAAGTCCAGCTCAGGGCAGG No data
904209012_904209016 -3 Left 904209012 1:28873542-28873564 CCCACTACAGGAAGAGGACTGCT No data
Right 904209016 1:28873562-28873584 GCTGAAGTCCAGCTCAGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904209016 Original CRISPR GCTGAAGTCCAGCTCAGGGC AGG Intergenic
No off target data available for this crispr