ID: 904209493

View in Genome Browser
Species Human (GRCh38)
Location 1:28877321-28877343
Sequence TAGGCAAGGCTGCCCGAGAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904209487_904209493 28 Left 904209487 1:28877270-28877292 CCTGTGTTCATACACGTGCACAC No data
Right 904209493 1:28877321-28877343 TAGGCAAGGCTGCCCGAGACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904209493 Original CRISPR TAGGCAAGGCTGCCCGAGAC CGG Intergenic
No off target data available for this crispr