ID: 904218819

View in Genome Browser
Species Human (GRCh38)
Location 1:28947483-28947505
Sequence CTTTTTATTAGATGCAACCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 166}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904218816_904218819 7 Left 904218816 1:28947453-28947475 CCTTTTAATCTCTTGAGGGCAAA 0: 1
1: 0
2: 1
3: 13
4: 181
Right 904218819 1:28947483-28947505 CTTTTTATTAGATGCAACCAGGG 0: 1
1: 0
2: 0
3: 11
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904218819 Original CRISPR CTTTTTATTAGATGCAACCA GGG Intronic
901976815 1:12951655-12951677 CTTTTTATTAGGTGACAACATGG - Intronic
902008355 1:13250115-13250137 CTTTTTATTAGGTGACAACATGG + Intergenic
903198788 1:21715446-21715468 CTTTTGATTAGATGAATCAAAGG - Exonic
903467007 1:23558788-23558810 CCATTCATTTGATGCAACCATGG + Intronic
904218819 1:28947483-28947505 CTTTTTATTAGATGCAACCAGGG + Intronic
905626684 1:39494022-39494044 CCTTTTATAAGGAGCAACCAAGG - Intronic
907547796 1:55277323-55277345 CTTTTGTTGAGAGGCAACCATGG + Intergenic
907586643 1:55623966-55623988 TTTGTTTTTAGAAGCAACCAGGG + Intergenic
908073386 1:60488872-60488894 ATGTTTATTTGATGCATCCATGG - Intergenic
908966071 1:69765152-69765174 ATTTTTATTAGAAGCAACCCTGG + Intronic
909917202 1:81335080-81335102 CTTTTTCATAGATACAACCTTGG - Intronic
910368823 1:86494482-86494504 CTTTTTCCAAGAAGCAACCAGGG + Intronic
910562464 1:88606144-88606166 CTTTTTATCAAATGCCATCAGGG + Intergenic
915805278 1:158842011-158842033 CTTTTTCTTATACGCATCCAAGG + Intronic
916922029 1:169478743-169478765 CTTCTTAGGAGATGCAGCCATGG - Intronic
918184788 1:182117137-182117159 CTTTTTTTGAGAAGCAACTATGG - Intergenic
918704219 1:187640968-187640990 CTTTTTACAAGATTAAACCAAGG - Intergenic
919981631 1:202645562-202645584 CATTTTATCAGAAGGAACCATGG - Intronic
924895326 1:248332553-248332575 TTTTTCATTATATGCAACAAGGG + Intergenic
1063281496 10:4634050-4634072 CTTTGTTTTAGAGGCTACCATGG - Intergenic
1063993500 10:11593487-11593509 GTTTTTCTCAGATGGAACCAAGG - Intronic
1066484246 10:35828199-35828221 CTTTATAATAAATGCCACCATGG + Intergenic
1066990326 10:42507029-42507051 GTTATTATTATATGGAACCATGG - Intergenic
1068082508 10:52337225-52337247 CGTTTTATTAGCTGCAAAGAAGG + Intergenic
1068166279 10:53336555-53336577 GTTTTTATTATTTGGAACCATGG - Intergenic
1068225044 10:54097395-54097417 CTTTTCCTCAGATACAACCATGG + Intronic
1071153787 10:82666507-82666529 ATTTTTTTTAGATGCAAATAAGG - Intronic
1072043705 10:91633689-91633711 CTTTTAATTAAATGCCACCTTGG - Intergenic
1072185216 10:93031291-93031313 CTTTTTATTAATTGAAACCAGGG + Intronic
1079376700 11:19899356-19899378 CTGGTGATTAGATGTAACCATGG + Intronic
1080371629 11:31652973-31652995 CTTTTTACTAGCAGCTACCAAGG + Intronic
1082209478 11:49480699-49480721 CTTTTGATTAGACCCAACTAGGG - Intergenic
1086569973 11:88271399-88271421 CATTTTATTATCTGCAAACAAGG - Intergenic
1086640201 11:89144841-89144863 CTTTTGATTAGACTCAACTAGGG + Intergenic
1087476053 11:98636816-98636838 ATTTTTATTAGAAGCAACTTTGG + Intergenic
1087660236 11:100979065-100979087 CTTTTTTTTAGATGCATTTAAGG - Intronic
1087938377 11:104062391-104062413 CTTTTTATTAGACGGAGTCAAGG - Intronic
1088085683 11:105976710-105976732 CTTTTTAGTAGAATCTACCATGG - Intronic
1089999293 11:122940492-122940514 CTTTTTATTACATTATACCAGGG + Intronic
1095731337 12:45509855-45509877 CTTTTTAGCAGAGGAAACCAAGG - Intergenic
1096743573 12:53711613-53711635 CTGTGTATCAGAAGCAACCAGGG + Intronic
1097711926 12:62926361-62926383 ATTTCTATGAGTTGCAACCAAGG + Intronic
1100736133 12:97534516-97534538 CTTTTTATTAGAGAAAATCATGG + Intergenic
1101433257 12:104644476-104644498 CTTTTTGGCAGATGCAAGCAGGG - Intronic
1102725702 12:115062735-115062757 CTCTTTTTCAGGTGCAACCATGG + Intergenic
1102851086 12:116246007-116246029 CTTTTTATTATATGGAAACTTGG - Intronic
1106005270 13:25763869-25763891 CTATTTATTAAATGCCTCCATGG - Intronic
1107697712 13:43016731-43016753 ATTTTTATTAGATGTCACAATGG + Intergenic
1107871854 13:44754145-44754167 ATTTTTATTACAGCCAACCAGGG - Intergenic
1108554610 13:51580932-51580954 GTTTTTGTTACCTGCAACCAAGG + Intergenic
1111216985 13:85156808-85156830 CTTTTGTTAAGATGAAACCACGG + Intergenic
1111326085 13:86697650-86697672 CTTTTACTTAGATTGAACCAAGG - Intergenic
1115666724 14:35558454-35558476 TTTTTTATTAGATGAAAATAAGG - Intronic
1116526662 14:45915057-45915079 CTTTTTACTAGATCAAAACATGG - Intergenic
1118628739 14:67683591-67683613 CTTTTGATTAGAGGCAAACAGGG - Intronic
1119514593 14:75238095-75238117 CTTTTCATTTGATGGAACCCAGG + Intergenic
1120330514 14:83087285-83087307 CTTTTTGTTAGCTGAAACTATGG - Intergenic
1120927048 14:89808219-89808241 CTTTTAATTAGATGGAGCAATGG - Intronic
1121790777 14:96698074-96698096 GTTTTTATGAGATGCTGCCAAGG - Intergenic
1121854838 14:97258447-97258469 CATTTTTTTAGATTCATCCATGG - Intergenic
1122117142 14:99533490-99533512 CTTGTTGTTACATACAACCAGGG - Intronic
1122727368 14:103766505-103766527 CTGTTGATTAGGAGCAACCACGG - Intronic
1124400046 15:29340120-29340142 CTGTCAATTAGATGCAACCATGG + Intronic
1124497319 15:30194298-30194320 CATTTTATCAGAAGGAACCATGG - Intergenic
1124746255 15:32344349-32344371 CATTTTATCAGAAGGAACCATGG + Intergenic
1125221309 15:37338912-37338934 ATATTTATTAGCTGCAAACATGG + Intergenic
1127143175 15:55997571-55997593 CTTTTTACTAAAAGAAACCAGGG + Intergenic
1127943303 15:63723462-63723484 ATTTTAAGTAGATGCTACCAAGG + Intronic
1131686657 15:94775066-94775088 CTATTTCTTAGATGCCTCCATGG + Intergenic
1134855001 16:17511122-17511144 GTTTTTAGTAGAGACAACCAGGG - Intergenic
1135118079 16:19740592-19740614 CTTTTTATTCGATTGAACAAAGG + Intronic
1138297774 16:55901419-55901441 CTTTTAATAAGATGCCTCCAAGG - Intronic
1145053733 17:19684399-19684421 AAATTTATTAGATGCAACTAAGG + Intronic
1148645332 17:49216989-49217011 CTTGTATTTAGATGCAAACAGGG - Intronic
1150039015 17:61838201-61838223 CTTTTTATTATATGATACTAGGG - Intronic
1150514302 17:65791401-65791423 CTGATTATCAGAAGCAACCAGGG - Intronic
1153131778 18:1861793-1861815 TTCTTGATTAGATGCAAACAAGG - Intergenic
1154505518 18:15036767-15036789 CTTTTTATAAGTGGCATCCAAGG - Intergenic
1155689429 18:28600390-28600412 CTTTTTATTAAGTGCTAACATGG - Intergenic
1158348671 18:56541701-56541723 GTTGTTATAACATGCAACCAGGG - Intergenic
1158887912 18:61846298-61846320 GTTTTTATTACATGACACCATGG - Intronic
926030178 2:9579670-9579692 CTTTTAGTTAGAAGGAACCAAGG - Intergenic
930457309 2:51621757-51621779 GTTTTTCTTAACTGCAACCATGG - Intergenic
930603605 2:53469764-53469786 CTTTTTATTTGATCCATCAAGGG - Intergenic
930664105 2:54084926-54084948 CTTTTTATTAGATGTGATGATGG + Intronic
930926841 2:56828978-56829000 CTTGATATTTGGTGCAACCAAGG - Intergenic
932364329 2:71138673-71138695 CTTTGTATGAAATGGAACCATGG - Intronic
932932617 2:76060571-76060593 CTTCTTTTTAGTTGCAAGCAGGG + Intergenic
938138108 2:128775522-128775544 CTTTTTATGAGGTGCACACAGGG - Intergenic
939674653 2:145057215-145057237 ACTTTTATGAGATGCAGCCAAGG - Intergenic
940533886 2:154913815-154913837 ATTTTTATTTGGTGCAAGCAGGG + Intergenic
947763059 2:232617769-232617791 ATTTTTAGTAGAGACAACCATGG - Intronic
1169413721 20:5397147-5397169 CTTTTCATTTTATGCAGCCATGG + Intergenic
1169741462 20:8899420-8899442 CTGTGTCATAGATGCAACCACGG - Intronic
1171099060 20:22365273-22365295 CTTTTTCTTAGAAGGAAACATGG - Intergenic
1173872563 20:46351076-46351098 CCTTTTGTGAGATGCAACAAAGG + Intronic
1173982420 20:47234965-47234987 CTTTTTAAAAAATGCAAACAGGG - Intronic
1176378187 21:6097152-6097174 CCTTTTATTAGGTGCAGCCACGG + Intergenic
1177395702 21:20533203-20533225 CTTTCTAATAAATGAAACCACGG + Intergenic
1177490815 21:21823810-21823832 CAGTTTATTGGATGCAAACAAGG + Intergenic
1178240415 21:30893467-30893489 CTTTTAATTACATGCAAATAAGG - Intergenic
1179745286 21:43441094-43441116 CCTTTTATTAGGTGCAGCCACGG - Intergenic
953380579 3:42468880-42468902 CTTTTTTTTACATGCAGCCCAGG - Intergenic
955498953 3:59564994-59565016 CTTTTAATAAGTTGCAAACAAGG - Intergenic
955500253 3:59576021-59576043 CTATTTATTAAATGCCACTATGG + Intergenic
959206005 3:103307776-103307798 CTTTTTATGACATGTAACTATGG - Intergenic
960191679 3:114714205-114714227 CTTTTTCTTCCATGAAACCATGG + Intronic
962124503 3:132601547-132601569 TTTATTATAAGTTGCAACCACGG - Exonic
965219583 3:165911184-165911206 ATTTTTTTTAGAGGTAACCATGG + Intergenic
970938186 4:21599628-21599650 CTTTGTAGTAGAAGCAACAAAGG - Intronic
977763375 4:100767469-100767491 TTATTTATAAGAGGCAACCAAGG + Intronic
978107455 4:104920564-104920586 CTTATTAATAGATGCAAGAAAGG - Intergenic
978473969 4:109104927-109104949 CTATTTATTAGATGCAATAATGG + Intronic
978571282 4:110140725-110140747 CTATTTGTTAATTGCAACCAAGG + Intronic
978949899 4:114545445-114545467 ATTTTTCTAAAATGCAACCACGG - Intergenic
979353655 4:119675801-119675823 TTTTTTATTAGATGAAGACAAGG + Intergenic
979712021 4:123790958-123790980 CTTTTTATTAGTAGGAAACATGG - Intergenic
979911743 4:126375884-126375906 CTTTGCACTAGATTCAACCATGG + Intergenic
980197374 4:129607813-129607835 CTATTTGTCAGTTGCAACCAAGG - Intergenic
980322752 4:131300823-131300845 CTTTTTAACAGATGCAACTATGG - Intergenic
980764357 4:137280576-137280598 CTCTTTAGTAGATTCAACCAAGG + Intergenic
984230252 4:177089076-177089098 GTTTTTAATAGATGAAAACATGG + Intergenic
986914301 5:12598241-12598263 CCTTTTATTAAATGCAATAAGGG + Intergenic
987183577 5:15390975-15390997 CTTTTTATGAAGTGCTACCAAGG - Intergenic
987369677 5:17181704-17181726 CTTTCAATCAGATGCAAACATGG + Intronic
988533715 5:32047822-32047844 TTGTTTATGAGATTCAACCACGG - Intronic
990261203 5:54024216-54024238 GGTTTTATAAAATGCAACCATGG + Intronic
991349999 5:65711266-65711288 CTTATAATTAAATGCAATCAGGG + Intronic
993446388 5:88017320-88017342 CCTTTTAGAACATGCAACCATGG - Intergenic
993765679 5:91854699-91854721 CCTTTTATTAGATTGTACCATGG - Intergenic
994923808 5:106087390-106087412 CTTTAAATTAGATGGAAACAAGG - Intergenic
995470345 5:112495131-112495153 CTTTTTCTTAGCTGCAAATAGGG - Intergenic
995470347 5:112495209-112495231 CTTTTTCTTAGCTGCAAATAGGG - Intergenic
996738712 5:126779388-126779410 CATTTTAAAAGATGAAACCAAGG - Intronic
998905180 5:146897341-146897363 CTTTTTATTGTATCCACCCAGGG - Intronic
1006728368 6:36216464-36216486 CTTTTTGTGAGATTCAACTAAGG - Intronic
1006761930 6:36470529-36470551 CTGCTTATTAGTTGTAACCATGG + Intronic
1013402659 6:109814093-109814115 CTTTTTATTGCATCCTACCATGG + Intronic
1013639377 6:112058390-112058412 ATGTTTATTTGATGGAACCAGGG - Intronic
1013785321 6:113772966-113772988 TTTTTTACTATATTCAACCATGG + Intergenic
1015458285 6:133455821-133455843 ATCATTATTAGATGCAACAAGGG - Intronic
1015979412 6:138823896-138823918 TTTATTATAAGTTGCAACCACGG - Intronic
1016113482 6:140254994-140255016 ATTTTTTTTAGATTAAACCATGG + Intergenic
1020906718 7:14072444-14072466 CATTTTTTTAAATGTAACCATGG - Intergenic
1022148858 7:27577574-27577596 GTTTTTATTACTTGCAACCCAGG + Intronic
1022597951 7:31730731-31730753 CTCTGTAATAAATGCAACCATGG + Intergenic
1025925347 7:65954942-65954964 CCTATTATTTGCTGCAACCACGG - Exonic
1027803729 7:82788586-82788608 CTTTTTATTTTATGCATCTATGG - Intronic
1028386701 7:90262310-90262332 CTAAATATTAGATGTAACCAAGG + Intronic
1031560464 7:123231879-123231901 CTGTATATTATATGCAACTAAGG - Intergenic
1031799812 7:126228395-126228417 CTTTTTATTATATACAGCCATGG + Intergenic
1033144647 7:138861029-138861051 ATTCTTATCAAATGCAACCACGG + Intronic
1039274117 8:35915916-35915938 CTTTTGCTTAGATGAATCCAAGG - Intergenic
1043120897 8:76322346-76322368 CTTTTTATTAGAGGCATAAAAGG + Intergenic
1043276170 8:78396371-78396393 CTTTTCAATACATGCAACAAAGG + Intergenic
1049034898 8:140067562-140067584 TCTTTGCTTAGATGCAACCAGGG - Intronic
1050008762 9:1163518-1163540 TTTTTTATTAGTTTCACCCATGG - Intergenic
1050083718 9:1942056-1942078 CTTTTTACTAGATTCATACACGG - Intergenic
1050695179 9:8271145-8271167 CTTTTCATTATATGTCACCAGGG - Intergenic
1058314815 9:103552761-103552783 ATTTTTATTAGATGCAAAGAAGG + Intergenic
1058370776 9:104264605-104264627 ATTTTTATTGTATGCAACCTTGG + Intergenic
1059396462 9:114037075-114037097 CTTTTTATTACATTTCACCACGG + Intronic
1061348833 9:130047827-130047849 ATGTTTATTAGTTGCAAGCAGGG - Intergenic
1062172046 9:135140273-135140295 CTTTTTTGGAGATGCCACCAGGG - Intergenic
1186807769 X:13156929-13156951 CTTTTTACTAACTACAACCATGG + Intergenic
1187459320 X:19471755-19471777 CTTTTCATTAGAAACAACGAAGG + Intronic
1187506667 X:19883893-19883915 CTTTGGATTGGATGCTACCAGGG - Intronic
1189707676 X:43775548-43775570 CTTTTTAATAGGTAAAACCAAGG - Intronic
1191568558 X:62574543-62574565 CTTTTTGTTAGAATCTACCAGGG + Intergenic
1193110518 X:77725012-77725034 CTTTTTATTAAATCCAGACATGG + Intronic
1194081765 X:89475819-89475841 CTGATTATTGGATGCAAACATGG - Intergenic
1194971453 X:100348564-100348586 CTTTTTTTTAAATAAAACCAGGG - Intronic
1195097773 X:101522244-101522266 ATTTTTATTAGAGGCAAAGAAGG - Intronic
1196714371 X:118797425-118797447 ATATTTGTTAGATGCAATCATGG - Intergenic
1197718829 X:129730842-129730864 CTTTTTTTCAGATGCCAACATGG - Intergenic
1199203541 X:145121697-145121719 GATTTTATTAGCTGCAAACAAGG + Intergenic
1200434434 Y:3132009-3132031 CTGATTATTGGATGCAAACATGG - Intergenic
1200742151 Y:6865168-6865190 GTTTATATTACATGCACCCATGG - Intergenic