ID: 904228075 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:29041305-29041327 |
Sequence | TTGTACCTTTAGTAGAGGCA GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 252156 | |||
Summary | {0: 1, 1: 93, 2: 4540, 3: 76197, 4: 171325} |
Found 4 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
904228075_904228082 | 25 | Left | 904228075 | 1:29041305-29041327 | CCCTGCCTCTACTAAAGGTACAA | 0: 1 1: 93 2: 4540 3: 76197 4: 171325 |
||
Right | 904228082 | 1:29041353-29041375 | GCCTGTAATCCCAGCTACTCAGG | 0: 72761 1: 205379 2: 228437 3: 173801 4: 346072 |
||||
904228075_904228080 | -6 | Left | 904228075 | 1:29041305-29041327 | CCCTGCCTCTACTAAAGGTACAA | 0: 1 1: 93 2: 4540 3: 76197 4: 171325 |
||
Right | 904228080 | 1:29041322-29041344 | GTACAAAAATTAGCTGGGCTTGG | 0: 43 1: 2647 2: 45681 3: 82245 4: 118828 |
||||
904228075_904228081 | -3 | Left | 904228075 | 1:29041305-29041327 | CCCTGCCTCTACTAAAGGTACAA | 0: 1 1: 93 2: 4540 3: 76197 4: 171325 |
||
Right | 904228081 | 1:29041325-29041347 | CAAAAATTAGCTGGGCTTGGTGG | 0: 1319 1: 42899 2: 108532 3: 179280 4: 198918 |
||||
904228075_904228084 | 28 | Left | 904228075 | 1:29041305-29041327 | CCCTGCCTCTACTAAAGGTACAA | 0: 1 1: 93 2: 4540 3: 76197 4: 171325 |
||
Right | 904228084 | 1:29041356-29041378 | TGTAATCCCAGCTACTCAGGAGG | 0: 53856 1: 140530 2: 227977 3: 201243 4: 144859 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
904228075 | Original CRISPR | TTGTACCTTTAGTAGAGGCA GGG (reversed) | Intronic | ||
Too many off-targets to display for this crispr |