ID: 904228075

View in Genome Browser
Species Human (GRCh38)
Location 1:29041305-29041327
Sequence TTGTACCTTTAGTAGAGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252156
Summary {0: 1, 1: 93, 2: 4540, 3: 76197, 4: 171325}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904228075_904228082 25 Left 904228075 1:29041305-29041327 CCCTGCCTCTACTAAAGGTACAA 0: 1
1: 93
2: 4540
3: 76197
4: 171325
Right 904228082 1:29041353-29041375 GCCTGTAATCCCAGCTACTCAGG 0: 72761
1: 205379
2: 228437
3: 173801
4: 346072
904228075_904228080 -6 Left 904228075 1:29041305-29041327 CCCTGCCTCTACTAAAGGTACAA 0: 1
1: 93
2: 4540
3: 76197
4: 171325
Right 904228080 1:29041322-29041344 GTACAAAAATTAGCTGGGCTTGG 0: 43
1: 2647
2: 45681
3: 82245
4: 118828
904228075_904228081 -3 Left 904228075 1:29041305-29041327 CCCTGCCTCTACTAAAGGTACAA 0: 1
1: 93
2: 4540
3: 76197
4: 171325
Right 904228081 1:29041325-29041347 CAAAAATTAGCTGGGCTTGGTGG 0: 1319
1: 42899
2: 108532
3: 179280
4: 198918
904228075_904228084 28 Left 904228075 1:29041305-29041327 CCCTGCCTCTACTAAAGGTACAA 0: 1
1: 93
2: 4540
3: 76197
4: 171325
Right 904228084 1:29041356-29041378 TGTAATCCCAGCTACTCAGGAGG 0: 53856
1: 140530
2: 227977
3: 201243
4: 144859

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904228075 Original CRISPR TTGTACCTTTAGTAGAGGCA GGG (reversed) Intronic
Too many off-targets to display for this crispr