ID: 904231502

View in Genome Browser
Species Human (GRCh38)
Location 1:29077928-29077950
Sequence AAAAATAAGGAGAGGGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 971
Summary {0: 1, 1: 0, 2: 11, 3: 81, 4: 878}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904231496_904231502 19 Left 904231496 1:29077886-29077908 CCATTTTAAAATGTAAATACCAT 0: 1
1: 6
2: 80
3: 377
4: 1565
Right 904231502 1:29077928-29077950 AAAAATAAGGAGAGGGTGGCTGG 0: 1
1: 0
2: 11
3: 81
4: 878
904231497_904231502 0 Left 904231497 1:29077905-29077927 CCATTCTTAGCTCATAGCAATAG 0: 1
1: 0
2: 0
3: 9
4: 140
Right 904231502 1:29077928-29077950 AAAAATAAGGAGAGGGTGGCTGG 0: 1
1: 0
2: 11
3: 81
4: 878
904231495_904231502 24 Left 904231495 1:29077881-29077903 CCTAACCATTTTAAAATGTAAAT 0: 1
1: 4
2: 28
3: 211
4: 1086
Right 904231502 1:29077928-29077950 AAAAATAAGGAGAGGGTGGCTGG 0: 1
1: 0
2: 11
3: 81
4: 878

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904231502 Original CRISPR AAAAATAAGGAGAGGGTGGC TGG Intronic
900253832 1:1686297-1686319 AAAAAAAAGAAAAGGGAGGCTGG - Intronic
900262831 1:1741077-1741099 AAAAAAAAGAAAAGGGAGGCTGG - Intronic
902089870 1:13894405-13894427 AAAAAAAAGGTGAGGATGGATGG + Intergenic
902142028 1:14365036-14365058 AAAAAAAAAGAGAGGGGGCCGGG - Intergenic
902582358 1:17416071-17416093 AAAAAAAAGGGGGGGGGGGCGGG + Intronic
902692022 1:18115896-18115918 AGAAAGAAGGAGAGGGAGGGAGG + Intronic
902701948 1:18178672-18178694 AAAAGGAAGGAGAAGCTGGCAGG - Intronic
903064431 1:20690981-20691003 AAAAATTAGCTGATGGTGGCCGG - Intronic
903437792 1:23365095-23365117 AAAAATAAAAAGAGGCAGGCCGG + Intronic
903479442 1:23642515-23642537 AGAAATAATGATAGGATGGCTGG + Intergenic
903870219 1:26428687-26428709 AAAAATTAGCTGAGTGTGGCGGG - Exonic
903966281 1:27092151-27092173 AAAAATCAGGAGATTATGGCTGG + Intergenic
904136376 1:28315811-28315833 AAAAAAAAGGGGGGGGGGGCGGG - Intergenic
904144429 1:28378566-28378588 AAAAAAAAGGGGGGGGGGGCTGG - Intronic
904231502 1:29077928-29077950 AAAAATAAGGAGAGGGTGGCTGG + Intronic
904530534 1:31165758-31165780 AAAAAAAAGGTGGGAGTGGCCGG + Intergenic
905140933 1:35843737-35843759 ACAGTTAAGGAGAAGGTGGCAGG - Intronic
905262337 1:36728798-36728820 AGAAAGGAGGAGAGGGAGGCAGG - Intergenic
905365699 1:37450164-37450186 AAAAAAAGGAAGTGGGTGGCGGG - Intergenic
905657460 1:39693958-39693980 AAAAATAAGGAGGCTGAGGCAGG + Intronic
906100114 1:43254867-43254889 AAAAATTAGCTGAGTGTGGCTGG - Intronic
906335647 1:44927865-44927887 ACAAAGAAAGAGAGAGTGGCTGG + Intronic
906434390 1:45782500-45782522 AAAAATAAGCTGGGGGTGGGGGG + Intergenic
906648881 1:47496268-47496290 AAAAAAAAGGAGGGGGTGCCAGG - Intergenic
906925463 1:50110967-50110989 AAAAAAAAGGGGAGGGGGACAGG + Intronic
907119222 1:51993818-51993840 AAAAAAAAGGTGGGGGTGGGAGG + Intergenic
907167383 1:52425856-52425878 CAAAATAGGGAGGGGGTGGGGGG + Intronic
907348501 1:53804771-53804793 AAAAAAAAAAATAGGGTGGCCGG - Intronic
907403576 1:54240465-54240487 AAAAAAAAGGGGGGGGGGGCGGG + Intronic
907997508 1:59647730-59647752 AAAAAAAAAAAGATGGTGGCAGG - Intronic
908017513 1:59858894-59858916 AAAAACAAAGAGAGGGAGGGGGG + Intronic
908225334 1:62050603-62050625 AAATATAAGGAGAGGTTTGCTGG - Intronic
908403159 1:63789660-63789682 AAAAAAAAGGAGAGGAAGGATGG - Intronic
908767744 1:67569690-67569712 AAAAAAAAGGAGAGGGAGTGGGG + Intergenic
910672101 1:89783820-89783842 AGAAGTAAGGACAGGGTGGTTGG + Intronic
910799421 1:91130946-91130968 AAAATTAAAAAAAGGGTGGCTGG + Intergenic
910835826 1:91509062-91509084 GAAAACAAGGAGGGTGTGGCAGG - Intronic
910980111 1:92951926-92951948 ACAGAGAAGGAGAGGGTGGGGGG - Intronic
912519386 1:110234775-110234797 AAGAATAAGGAGAGGCAAGCAGG - Intronic
912626883 1:111212834-111212856 AAAAAAAAGGGGGGGGGGGCGGG - Intronic
913037998 1:114992349-114992371 AAAAATAAGGATAGAGTTGGAGG + Intronic
913177302 1:116286541-116286563 AAAGATAAGGTGTGGGGGGCTGG + Intergenic
913291775 1:117280128-117280150 AAAAATAAGCAGAGAGTGACCGG + Intergenic
913537978 1:119792606-119792628 ATAAATTAGGAGAGGGAGGTGGG + Intergenic
913565116 1:120065787-120065809 GAAAATCAGGAAAGGGTGGAAGG + Intronic
913963596 1:143357042-143357064 AAAAATAAGGAAAGGGAGGCTGG - Intergenic
913999321 1:143679402-143679424 AAAAAAAAGGAGCGGGGGGTCGG + Intergenic
914057956 1:144182631-144182653 AAAAATAAGGAAAGGGAGGCTGG - Intergenic
914121190 1:144783734-144783756 AAAAATAAGGAAAGGGAGGCTGG + Intergenic
914225230 1:145714515-145714537 TAAAATATGGAGAGGGAGTCAGG - Intergenic
914285708 1:146225143-146225165 GAAAATCAGGAAAGGGTGGAAGG + Intronic
914546739 1:148675895-148675917 GAAAATCAGGAAAGGGTGGAAGG + Intronic
914619825 1:149394772-149394794 GAAAATCAGGAAAGGGTGGAAGG - Intergenic
914718878 1:150272928-150272950 AAAAATGAGGAGTGGGTGAGAGG + Intronic
915001761 1:152600648-152600670 AAAAATAAGGAGATGGTCTGAGG + Exonic
915177668 1:154030159-154030181 AAAAGTCAGGAAAGGGTGGGAGG + Intronic
915701508 1:157801487-157801509 AATAATAAGGCCACGGTGGCTGG + Exonic
916077686 1:161211876-161211898 GAAAATAAGGAGAGGGTTTGGGG + Intronic
916197310 1:162236640-162236662 AAAAAGAGGGAAAGGGGGGCTGG - Intronic
916392398 1:164344784-164344806 GAAGATAAAGAGAGGGTGGATGG - Intergenic
916416853 1:164600398-164600420 AAAAATCAGCCGATGGTGGCGGG - Intronic
916620501 1:166491100-166491122 AAAAAAAAAAAGAGGATGGCTGG + Intergenic
916692389 1:167202887-167202909 GAAAAAAATGAGAGGGTGGGAGG - Intergenic
916712268 1:167422158-167422180 AATCATTAGGAGAGGTTGGCAGG - Exonic
917009873 1:170458531-170458553 AAACAAAGAGAGAGGGTGGCTGG - Intergenic
917360466 1:174169844-174169866 AAAAATTAGCAGAGTGTGGTGGG - Intronic
917753246 1:178073829-178073851 AAAAACAAGTAGTGGGTGGAGGG - Intergenic
917769588 1:178262781-178262803 AAAAAAAATGAGTGGGGGGCAGG - Intronic
918445610 1:184614014-184614036 AAAAATAAAGAGATGGGAGCAGG + Intronic
918739559 1:188110745-188110767 AAAGATAAGGAGAGGGATGAAGG + Intergenic
919831209 1:201541355-201541377 AAAAAGAAGTAGAGGGGGTCTGG - Intergenic
920164347 1:204025142-204025164 AAAAAAAAAGAGAGGCTGGAGGG + Intergenic
920165098 1:204030135-204030157 AAAAATAGCAAAAGGGTGGCTGG - Intergenic
921214186 1:212923430-212923452 AAAAGGAAAGAGGGGGTGGCTGG - Intergenic
921458055 1:215395410-215395432 AAAAATGAGGAGGAGTTGGCTGG - Intergenic
921639242 1:217532608-217532630 ATAAATAAGGAGAAGGTGGTAGG + Intronic
921717887 1:218437029-218437051 AGATATAAGCAGAGAGTGGCTGG - Intronic
921788919 1:219267253-219267275 ATAAATAAGGAGTGTGTTGCTGG - Intergenic
921818110 1:219586854-219586876 AACATTAAGTAGAGGGTGGGTGG - Intergenic
922293886 1:224232050-224232072 AAAAATACAGACAGGGAGGCCGG + Intronic
922508576 1:226142640-226142662 AAAAATTAGGGCGGGGTGGCCGG + Intergenic
922985480 1:229863057-229863079 AAAAAGAAGGAGATTCTGGCTGG - Intergenic
923123113 1:231012507-231012529 AGAAAGAAGCAGAGGGAGGCTGG - Intergenic
923353440 1:233130776-233130798 AAAAAAAAGGGGGGGGTGCCGGG - Intronic
923616339 1:235541250-235541272 AAAATTAATGAGAGGTTGGATGG + Intergenic
924111468 1:240703792-240703814 GAAAATAAAGAGATGTTGGCTGG - Intergenic
924661487 1:246022787-246022809 AAAAATTAGGAGTGGCTGGGAGG + Intronic
924811670 1:247408252-247408274 AAAAAAAAACAGAGGGTGGGGGG - Intergenic
1063294144 10:4785111-4785133 CAAAATAAGGAAGGGCTGGCTGG + Intergenic
1063693071 10:8305702-8305724 AATAAGAAGGAGAGGATGGAGGG - Intergenic
1063847246 10:10144336-10144358 AAGATGAAGGAGATGGTGGCTGG - Intergenic
1064262445 10:13797014-13797036 AGTAATAAGGTGAAGGTGGCCGG - Intronic
1064517466 10:16166949-16166971 AAAAAAATGGCCAGGGTGGCAGG - Intergenic
1064662408 10:17618753-17618775 AAAAAAAAGGAAAGGAAGGCTGG + Intergenic
1065062933 10:21926246-21926268 AAAAAAAAGGAAAGGCTGGCTGG - Intronic
1065064694 10:21949394-21949416 AAAAAGAAGAAGGGGGTGGGGGG - Intronic
1065305448 10:24364273-24364295 AAAAAATAAGAGCGGGTGGCTGG - Intronic
1065504325 10:26414301-26414323 ATGAAGAAGGAGAGGGTGGGAGG + Intergenic
1065964911 10:30763179-30763201 AAAAAAAAAGAGGGAGTGGCTGG - Intergenic
1066757935 10:38729665-38729687 AAAAATTAGCAGGCGGTGGCGGG + Intergenic
1067479644 10:46586548-46586570 AAAAAAAAAAAGAGGTTGGCTGG + Intronic
1067615092 10:47755249-47755271 AAAAAAAAAAAGAGGTTGGCTGG - Intergenic
1068837828 10:61573624-61573646 AAAAATAATGAAAAGGTGGGGGG + Intergenic
1069555769 10:69396979-69397001 AAAAATAAGGAAATTATGGCCGG - Intronic
1069819715 10:71219976-71219998 AAGAGTAAGGAGAGGTCGGCTGG - Intronic
1070131399 10:73657915-73657937 AAAAAAAAAAAGGGGGTGGCCGG - Intronic
1070180622 10:74009902-74009924 AAAAAAAAGAAAAAGGTGGCTGG - Intronic
1070729338 10:78814480-78814502 AAAAAAAATGAGAGTGTGGAGGG - Intergenic
1071144335 10:82549981-82550003 AAAAATAAGGATTGTGTTGCTGG + Intronic
1071424877 10:85539509-85539531 AAAAATTACTAGAGGTTGGCTGG + Intergenic
1071630493 10:87215209-87215231 AAAAAAAAAAAGAGGTTGGCTGG - Intergenic
1072083210 10:92053834-92053856 AAAAATAAGTCGAGTGTGCCAGG - Intronic
1072129776 10:92483074-92483096 AAAGAAAAGGAGAGGTTGGCCGG - Intronic
1072145653 10:92634277-92634299 AAAGAAAAGGAGAGGCTGGCTGG - Intronic
1072239741 10:93484457-93484479 AAAAATCAGGAGAGTGGGCCAGG - Intergenic
1072413060 10:95222859-95222881 AATAATAATAAGAGGGTGGGAGG + Intronic
1072616135 10:97049849-97049871 ATAAATACGGGGATGGTGGCGGG + Intronic
1072976509 10:100063415-100063437 AAAACTAAGGTGGGGATGGCTGG - Intronic
1073049500 10:100658386-100658408 TAAAATAAAGAGGGGGTGGAGGG + Intergenic
1073463303 10:103678836-103678858 AACAATAAGGAAAAGGTGGGAGG + Intronic
1073777662 10:106804166-106804188 AAAAATGAGGAGAGTGTGCTTGG + Intronic
1074211967 10:111343486-111343508 AAACACAAGGAGAGGGAGTCTGG - Intergenic
1074478379 10:113794366-113794388 AACAATAATGACAGGCTGGCTGG + Intergenic
1074672363 10:115806448-115806470 AAAATGAAAGAGGGGGTGGCCGG + Intronic
1074758803 10:116648504-116648526 AAAAAGAAGGAAGGGCTGGCTGG + Intergenic
1075043308 10:119125811-119125833 AAAAATAACTAGAAGTTGGCTGG - Intronic
1075055483 10:119215391-119215413 TAAAAGAAGCAGAGGGAGGCAGG + Intronic
1075126612 10:119705414-119705436 AAAAATATTAAGAAGGTGGCTGG - Intergenic
1075366439 10:121894602-121894624 AAAAATGAGCAAAGGGTGCCGGG + Intronic
1075493318 10:122893804-122893826 AAAAAAAAGGAGTGGGGGGGTGG + Intergenic
1075568287 10:123520410-123520432 AAAAAAAAGGGGGGGGGGGCAGG - Intergenic
1075910596 10:126122463-126122485 AAAAATAGGCAAAGGGAGGCAGG + Intronic
1077136674 11:1002993-1003015 AAAAGAGAGGAGAGGGAGGCGGG - Intronic
1077620051 11:3713419-3713441 AAAAATAAAGAGAATTTGGCTGG + Intronic
1077656631 11:4025569-4025591 TAACATGAGGACAGGGTGGCTGG + Intronic
1077808835 11:5616886-5616908 AAAAATTAGCCGAAGGTGGCAGG - Intronic
1078108206 11:8371862-8371884 AAAAATAAAGAGAAGGAGGGAGG - Intergenic
1078294714 11:10056724-10056746 AAACCTCAGGCGAGGGTGGCTGG - Intronic
1078372375 11:10759640-10759662 AAAAAATAGGGGAGGGTTGCTGG + Intronic
1078973964 11:16449586-16449608 AAAAATAAAGAAGGGGCGGCCGG - Intronic
1078984127 11:16574191-16574213 AAAAATAAGAATAAGGTGGCAGG + Intronic
1079180588 11:18190013-18190035 AAAAATAAGCACATGATGGCCGG + Intronic
1080469687 11:32533042-32533064 AAAAATTAGCTGAGTGTGGCGGG + Intergenic
1081718693 11:45270015-45270037 GAAAATAAGGGTAGGGTGGCTGG - Intronic
1082018805 11:47513749-47513771 AAAAAAAAAAAGAGGGTGGCCGG - Intronic
1082039163 11:47670695-47670717 AAAAAAAAAAAAAGGGTGGCTGG + Intronic
1082672225 11:56047629-56047651 AAGAAGAAAGAGAGGGGGGCAGG - Intergenic
1082673470 11:56066293-56066315 ATAAATCAGGAGAGGGGGACTGG + Intergenic
1083181031 11:60985479-60985501 TTATAAAAGGAGAGGGTGGCCGG - Intronic
1083412896 11:62506029-62506051 AAAAAAAAGGCGGGGGTGGGGGG + Intronic
1083437788 11:62654587-62654609 AAAAACAAAGAGAGACTGGCCGG - Intronic
1083909280 11:65696581-65696603 AAAAAAAAGGAGACGGGGGATGG + Intergenic
1083911766 11:65713931-65713953 AAAAATAAAGAAGGGGTGGTGGG + Intronic
1084071085 11:66735352-66735374 AAAATTAAGGAGAAGGGGGCTGG + Intergenic
1084219919 11:67671534-67671556 AAAAAAAAGGGGGGGGAGGCAGG - Intronic
1084548479 11:69826298-69826320 ACAAAGAGGGAGAGGGTGGCCGG + Intergenic
1085098035 11:73776658-73776680 AAAAAAAAAGAGAGGATGTCTGG - Intergenic
1085401394 11:76237938-76237960 AAAAAGAAAGAGAGGGAGGGAGG + Intergenic
1085774216 11:79351012-79351034 AAAAGGAAGGAGAGTATGGCCGG - Intronic
1086061644 11:82706115-82706137 TAAAATAAGGAGAAACTGGCTGG - Intergenic
1086553557 11:88082740-88082762 AAAAATTAGGAGAGTGATGCTGG - Intergenic
1087279710 11:96196865-96196887 AAAAAAAAGCCGAGGGTGGTTGG - Intronic
1087373401 11:97314167-97314189 AAAATGAAGGAGAGGAGGGCAGG + Intergenic
1087768496 11:102181514-102181536 AGAAATAAGGAGTAGGTGGCAGG - Intronic
1088330918 11:108650541-108650563 AAAAAAAAGGAGCAGGAGGCAGG + Intergenic
1088358627 11:108968692-108968714 AAAAATCAGGAGAGTGAAGCAGG - Intergenic
1089637956 11:119828475-119828497 AGGCATCAGGAGAGGGTGGCTGG + Intergenic
1089879731 11:121762300-121762322 AAAAATCAGGAGGGGATGGGAGG + Intergenic
1089886640 11:121831065-121831087 AAAAATAGGGGCATGGTGGCGGG + Intergenic
1090014277 11:123072006-123072028 GAGAATAAGTAGTGGGTGGCAGG - Exonic
1090069888 11:123534875-123534897 AAAAATAATGAGGGGGTCTCAGG + Intronic
1090271785 11:125391120-125391142 AAAAGGAAGGAGAGGGTGAAAGG + Intronic
1090508067 11:127340850-127340872 AAAAAGAAGGATAGGGTAGAAGG - Intergenic
1090648156 11:128783051-128783073 AAGAATAATAAGAGTGTGGCAGG + Intronic
1090966455 11:131601574-131601596 AAAAAAAAGGAGAGGGAAGGGGG - Intronic
1091029177 11:132169041-132169063 CAAAAGAAGGAGGGGGTGGATGG - Intronic
1091313693 11:134595800-134595822 AGAAATAAGGACAGAGTGGCAGG - Intergenic
1092672462 12:10879555-10879577 AAAAATAAATTGAGGGTGACCGG + Intronic
1092867777 12:12779108-12779130 AAAAATTAGGAGAGAGAGGAGGG - Intronic
1092871247 12:12807659-12807681 AAAAAAAAGGAGGGGGGGCCAGG + Intronic
1094349093 12:29503534-29503556 AAAAAAAAGGAGAGGTTAGATGG + Intronic
1094371004 12:29737528-29737550 AAAAATAAAAAAAGGGCGGCGGG + Intronic
1094456389 12:30638965-30638987 AAAAATAGGAAGAGTGAGGCCGG - Intronic
1094804895 12:34080148-34080170 AAAAAAAAGAAGAGGGTGGATGG + Intergenic
1095292649 12:40493184-40493206 AAGAATAAGGTGAGGGTGCCAGG + Intronic
1095817573 12:46441254-46441276 AAAAATAAAGAGAGAGAGGGAGG - Intergenic
1096130363 12:49154177-49154199 AAAAAGAAAGAAAGGATGGCAGG - Intergenic
1096136520 12:49206954-49206976 AAAAAGAAAGAGAGAGAGGCCGG + Intronic
1096389765 12:51218892-51218914 AAATATCGGGAGAGGGTGGGAGG - Intergenic
1096632219 12:52935228-52935250 AAAAATTAGCTGGGGGTGGCAGG + Intronic
1097031716 12:56094568-56094590 GATAATAAGGAGAGGGGGTCAGG + Intronic
1098115810 12:67175379-67175401 AAAAATGGGGTCAGGGTGGCAGG - Intergenic
1098213054 12:68186342-68186364 AAAGTGAAGGAGAGGGTGGAGGG + Intergenic
1098545522 12:71707242-71707264 AATAATGAGGAGGGGGTGGAAGG - Intergenic
1098634740 12:72768246-72768268 GAAAGTAAGGAGAGAGTGGTAGG - Intergenic
1098635139 12:72774280-72774302 AAAAAGAAGCAGATGGTTGCTGG + Intergenic
1100344188 12:93711041-93711063 AAAAAAAAGGCGGGGGTGGGAGG - Intronic
1100580565 12:95935780-95935802 ATAAATAAGCAGAAGGAGGCTGG + Intronic
1101289503 12:103353292-103353314 AAAAAAAAAGAGGGGGTGGGGGG + Intronic
1102049464 12:109852143-109852165 AAAAATAAGCACATGATGGCTGG - Exonic
1102321128 12:111935391-111935413 AAAAATCAGCAGATGGCGGCCGG - Intronic
1102420376 12:112798757-112798779 AAAAGTAAGGAGACAGGGGCAGG - Intronic
1102538833 12:113603289-113603311 AATAATTAGGAGAAGGTGGAAGG - Intergenic
1102719740 12:115005778-115005800 AAAAATCAGGATTGGGTGGAAGG - Intergenic
1102843176 12:116148064-116148086 AAAAAAAAAAAGAGGGGGGCGGG + Intronic
1103047492 12:117749423-117749445 AGAAATAACGAGAGGAAGGCAGG + Intronic
1103248233 12:119476781-119476803 AGAAAGTAGGAGAGTGTGGCTGG - Intronic
1103317610 12:120069138-120069160 AAAAATCAAGAGAGAGAGGCTGG + Intronic
1103559850 12:121787902-121787924 AAAAAAAAGGGGGGGGGGGCGGG + Intronic
1103835631 12:123818241-123818263 AAAAATAAAGAGATAGAGGCTGG - Intronic
1105803345 13:23931006-23931028 AAAAATTAGGGCATGGTGGCGGG - Intergenic
1105845866 13:24293015-24293037 AAAAAAAAGGCGAGGGTGTGGGG + Intronic
1105862342 13:24426741-24426763 AAAAATTAGCCGGGGGTGGCAGG + Intronic
1107268194 13:38582612-38582634 AAATATAAGAAGAGGGCGGAAGG - Intergenic
1107473562 13:40713308-40713330 TAAAAGAAGAAGGGGGTGGCTGG - Intergenic
1107780090 13:43890961-43890983 AAAAATCAGGCGAGGGAGCCAGG + Intronic
1107852617 13:44586475-44586497 AAAAATAAGTAGAGGGGGCCAGG + Intergenic
1108001523 13:45909530-45909552 GAAAGTATGGTGAGGGTGGCAGG + Intergenic
1108008144 13:45973862-45973884 AAATGTAAGGAGAGGGAAGCAGG + Intronic
1108152042 13:47546207-47546229 AAAAGTCAGAAGAGGGTGGATGG - Intergenic
1108262905 13:48676103-48676125 TAAAATGAGGATAGGGTGACTGG - Intronic
1108280255 13:48854101-48854123 ATAAATAAGGAAAGGCTGGAAGG - Intergenic
1108340011 13:49489904-49489926 AAAAAAAAGGGGGGGGGGGCGGG - Intronic
1108362491 13:49679925-49679947 AGTAATAAGGAGAGGCAGGCTGG + Intronic
1108632094 13:52294800-52294822 AAAAATAAAGAGATAGAGGCCGG + Intergenic
1108654606 13:52517794-52517816 AAAAATAAAGAGATAGAGGCCGG - Intergenic
1109140242 13:58705647-58705669 AAAAAGAAGGAGAGGAAGGGAGG - Intergenic
1109473053 13:62835979-62836001 AAAAAGAAAGAGAGGGAGGAAGG - Intergenic
1109496632 13:63180359-63180381 AAAAAGAAAGAGAGGGAGGGAGG - Intergenic
1110464606 13:75786679-75786701 GAAAATAAGTAGAGAGAGGCCGG - Intronic
1110863701 13:80371620-80371642 AAAATTAAGGAGAGGGCAGGTGG + Intergenic
1110952656 13:81515935-81515957 AAAAAAAAGGCTAGGGTGGGAGG - Intergenic
1110997103 13:82124174-82124196 AAGAATAATGGGAGGGTGGGGGG - Intergenic
1111536859 13:89612629-89612651 GAAAATAAGGAGAAGGTAGGGGG - Intergenic
1111596253 13:90415155-90415177 ACAAAAATGGAGAGGGTGGTTGG + Intergenic
1112220051 13:97479429-97479451 AAACAAAAGGAGAGGTGGGCAGG + Intergenic
1112513527 13:100031790-100031812 AAAAAAAAAGAAAGGGAGGCAGG - Intergenic
1112997756 13:105595239-105595261 AAAAATAAACAGTGCGTGGCGGG - Intergenic
1113641375 13:111959783-111959805 AGAAATAAGAAGATGTTGGCAGG - Intergenic
1113740928 13:112711908-112711930 ATAGATAAGGAGCGGGTGGAGGG + Intronic
1114407218 14:22468133-22468155 AACATCAAGGAGAAGGTGGCTGG + Intergenic
1114476920 14:23002152-23002174 AAAAAAAAAAAAAGGGTGGCCGG + Intronic
1114538554 14:23438251-23438273 ATAAATAAAGAGAGGCTGGAAGG + Intergenic
1114759790 14:25300794-25300816 AACTATCAGGAGAGGGTAGCTGG - Intergenic
1115989637 14:39139114-39139136 AATATTAAGAAGAAGGTGGCTGG + Intergenic
1116101159 14:40438402-40438424 AAAAATAATGAGAGGGTACTAGG + Intergenic
1116678350 14:47935058-47935080 AAAAAAAAGAGGTGGGTGGCTGG + Intergenic
1116843919 14:49847178-49847200 ATAAATAAGTAAAGGTTGGCTGG - Intronic
1117039461 14:51756203-51756225 AAAAATTAGCCGAGGGTGGCAGG - Intergenic
1117383892 14:55192264-55192286 AAAAAAAAGGGGAGGGGGGCTGG - Intergenic
1117390946 14:55262011-55262033 AAGAATAAGGACAGGCTGGCTGG + Intergenic
1117859264 14:60073171-60073193 AAAGAAAAGCAGGGGGTGGCTGG + Intergenic
1117963086 14:61181414-61181436 AAAAAAAAGAAGAGAGTTGCTGG - Intergenic
1118305153 14:64649414-64649436 AAAAAAAAGGGTAGGGTGGTGGG + Intergenic
1119408599 14:74413981-74414003 GACCAGAAGGAGAGGGTGGCAGG + Intronic
1119663306 14:76466292-76466314 AAACACAAGGAGAATGTGGCTGG - Intronic
1119957055 14:78809710-78809732 CAACCTAAGGAGAGGGTGGAGGG + Intronic
1120128284 14:80773047-80773069 AAAAGTAAAATGAGGGTGGCAGG + Intronic
1120525368 14:85570879-85570901 AAAAATAAGGGGAATTTGGCCGG - Intronic
1121069854 14:91008568-91008590 CAAAAAAATGAGAGGATGGCTGG + Intronic
1121535496 14:94687800-94687822 AAAAAGAGGGGGAAGGTGGCAGG - Intergenic
1121670614 14:95708176-95708198 TAAAATATGTAGAGGGAGGCTGG + Intergenic
1122048250 14:99038500-99038522 ATAGTTAAGGGGAGGGTGGCTGG - Intergenic
1122484661 14:102070719-102070741 CAAAATAAGCAGGGGGTGGAGGG + Intergenic
1123193769 14:106596917-106596939 AAAAATAAGGAGGGGATGAGTGG + Intergenic
1202873417 14_GL000225v1_random:186523-186545 TAAAAGAAGGCAAGGGTGGCTGG - Intergenic
1124041546 15:26110198-26110220 AAGAAGGAGGAGAGGGTGGAGGG + Intergenic
1124044608 15:26137446-26137468 GAAAAGGAGGAGAGGGAGGCAGG - Intergenic
1124261453 15:28196015-28196037 AAAAATCAGGATGGGGTGTCGGG - Intronic
1124422272 15:29533282-29533304 AAAAATATAGACAGGGTGACTGG - Intronic
1124827035 15:33107515-33107537 AGCAAGAAGGTGAGGGTGGCTGG - Intronic
1125540478 15:40467071-40467093 AAGACTAGGGAAAGGGTGGCAGG - Exonic
1125616335 15:41016975-41016997 AAAAAAAAGGGTAGGGGGGCTGG - Intronic
1125665710 15:41428562-41428584 AAAAAAAAGGAGTAGGGGGCCGG - Intronic
1125713238 15:41804134-41804156 AAAAATAAGCAGAAAGTGGCCGG - Intronic
1125755495 15:42061500-42061522 AAAAATTAGCAGATGGTGGGGGG + Intergenic
1125952747 15:43767425-43767447 AAAACTAATGAAAGGATGGCAGG + Intronic
1126008137 15:44278295-44278317 AAAAATAAGGCTATGGAGGCTGG + Intergenic
1126013501 15:44326946-44326968 AAAAAAAAGCAGATGTTGGCTGG - Intronic
1127674907 15:61229342-61229364 AAAAAGAAGGAGAAGGCGACCGG + Intergenic
1127815424 15:62604539-62604561 AAAAAAAAGAAAAGGGTGGGGGG + Intronic
1127952412 15:63822198-63822220 ATAAACAAGGAGAGGGAGGCAGG + Intronic
1128281613 15:66399442-66399464 AAAAAAAAAGAGGGGGTGGGAGG - Intronic
1128500478 15:68223747-68223769 AAAAAAAAAAAGAGGGGGGCTGG + Intronic
1128681430 15:69654927-69654949 AAAAATTAGCCGAGAGTGGCAGG - Intergenic
1128740145 15:70078187-70078209 AAAAATAAGCAGAGTGAGGAAGG - Intronic
1129431061 15:75502455-75502477 AAAAAAAAAGAGAGGGAGGGAGG + Intronic
1129481939 15:75833383-75833405 AAAAAAAAAGGGAGGGGGGCGGG + Intergenic
1129820823 15:78600717-78600739 AAAAATTAGGGTATGGTGGCGGG + Intronic
1130621130 15:85463655-85463677 AGAAACAAGAAGAGGGTAGCAGG - Intronic
1130942289 15:88521150-88521172 AACAAGAAGGCCAGGGTGGCTGG - Intronic
1131225686 15:90623005-90623027 AAAAGTGAGGCGAGGCTGGCAGG + Intronic
1131637979 15:94258020-94258042 AAAAAAAATGACATGGTGGCAGG - Intronic
1131640812 15:94291304-94291326 AAAAATAATGAAAGTGAGGCCGG + Intronic
1131839737 15:96424347-96424369 AGAAAAAAGGAGAGGGTCGGAGG - Intergenic
1132283760 15:100643787-100643809 AAAAAAAAGAAGGGGCTGGCTGG - Intronic
1132924001 16:2417846-2417868 AAAAATACAGAAAGGATGGCTGG + Intergenic
1133100234 16:3475079-3475101 AAAAAAAAGGAAAGGATGGAAGG - Intronic
1133457772 16:5957955-5957977 AAAAGTAATGAGAGGATGGTGGG - Intergenic
1133507003 16:6422215-6422237 AAAAAAAAGGAGAGGTGGTCGGG - Intronic
1133712627 16:8415917-8415939 AAAAATATTGAGAGAGAGGCTGG - Intergenic
1133713828 16:8427973-8427995 AAAAAAAGGAAGAGGGTGGCTGG + Intergenic
1133757437 16:8772807-8772829 AAAAAGAAGAAGACGGTGGCCGG + Exonic
1133791449 16:9012595-9012617 ATAAATAGGGGGAGGGTGGCAGG + Intergenic
1134444049 16:14317387-14317409 AAAAATTAGCCGAGAGTGGCCGG - Intergenic
1134589640 16:15442032-15442054 AAGACTTAGGAGAGGGAGGCCGG + Intronic
1134840875 16:17400594-17400616 AAAAAGAAAGAGAGGGAGGGAGG + Intronic
1135010550 16:18873866-18873888 AGAAATAAGGAGAAAGTGGGTGG - Intronic
1135064732 16:19299926-19299948 AAGAATAAGGAAAGGGGGCCAGG + Intronic
1135117353 16:19735034-19735056 AAAAACAAGGGGAGTGTGGTAGG - Intronic
1135317424 16:21461451-21461473 AGAAATAAGGAGAAAGTGGGTGG - Intergenic
1135370322 16:21893263-21893285 AGAAATAAGGAGAAAGTGGGTGG - Intergenic
1135441467 16:22477438-22477460 AGAAATAAGGAGAAAGTGGGTGG + Intergenic
1135469814 16:22720383-22720405 AAAAAAAAAAAGAGGGTGGAGGG + Intergenic
1135549497 16:23387280-23387302 AAAAAGAAGTAAAAGGTGGCTGG - Intergenic
1136006848 16:27336689-27336711 AAAAAAAAGGAAAGGGAGGAAGG + Intronic
1136101230 16:27997840-27997862 AAAAAAGTGGAGAGGGTGGGAGG - Intronic
1136314213 16:29441191-29441213 AGAAATAAGGAGAAAGTGGGTGG - Intergenic
1136327652 16:29542956-29542978 AGAAATAAGGAGAAAGTGGGTGG - Intergenic
1136442340 16:30282956-30282978 AGAAATAAGGAGAAAGTGGGTGG - Intergenic
1136515551 16:30766144-30766166 CAAACTAAGGAGTGGGAGGCAGG - Exonic
1136724932 16:32349563-32349585 AAAAATCAGCAGGTGGTGGCAGG - Intergenic
1136843261 16:33555616-33555638 AAAAATCAGCAGGTGGTGGCGGG - Intergenic
1137656145 16:50159534-50159556 AGAAATAAGCAGAGAGAGGCCGG - Intronic
1137819637 16:51431603-51431625 GAAAACATGGAGACGGTGGCTGG + Intergenic
1138109868 16:54315251-54315273 ATTAGTAAGGAAAGGGTGGCAGG - Intergenic
1138154105 16:54686460-54686482 AAAAAAAAAGTCAGGGTGGCTGG - Intergenic
1138268734 16:55679558-55679580 AAAGAAGAGGAAAGGGTGGCAGG - Intronic
1139065556 16:63309203-63309225 AAAAAAAAGGTGGGGGTGGCTGG + Intergenic
1139448875 16:67014804-67014826 AAAAAAAAGGAGGGGGGCGCTGG + Intergenic
1139524267 16:67503995-67504017 AAGAAAAAGAAGAGCGTGGCTGG - Intergenic
1139801661 16:69527757-69527779 AAAAAAAAAGAGAGAGAGGCCGG + Intergenic
1139889145 16:70236676-70236698 AGAAATAAGGAGAAAGTGGGTGG - Intergenic
1140165124 16:72543191-72543213 AAAAAAAAGCGGGGGGTGGCCGG + Intergenic
1140858836 16:79001649-79001671 AAAAAAAAGGAGCTGGTGGCAGG + Intronic
1141076371 16:81009436-81009458 AAAACCAAGGAGAGGGAAGCAGG + Intronic
1141138428 16:81481869-81481891 AAAAAAAAAAAGAGGGAGGCGGG - Intronic
1141617419 16:85217863-85217885 AAAAAAAAGAAGAGGCTGGAAGG - Intergenic
1141617548 16:85218794-85218816 AAAAATATGCAAAGGGTGCCTGG - Intergenic
1141905787 16:87026274-87026296 AAAAATTAGGGGAGCCTGGCTGG + Intergenic
1203001498 16_KI270728v1_random:168191-168213 AAAAATCAGCAGGTGGTGGCAGG + Intergenic
1203133100 16_KI270728v1_random:1704595-1704617 AAAAATCAGCAGGTGGTGGCAGG + Intergenic
1203153426 16_KI270728v1_random:1855914-1855936 AAAAATCAGCAGGTGGTGGCGGG - Intergenic
1142574125 17:894980-895002 AAAAAAAAGGAAAGGGTGAAAGG - Intronic
1142619516 17:1155967-1155989 AAAAAAAAGGATAGGGTGGCAGG + Intronic
1143052919 17:4141532-4141554 AAAAATAGGGTGCGGGTGGAGGG + Intronic
1143111012 17:4552823-4552845 AAAAATAAGGGGTGGGGGGCAGG - Intronic
1143711495 17:8739110-8739132 AAAGAGAAAGAGAGGGGGGCTGG + Intronic
1144315956 17:14061749-14061771 AGATATAAGGAGAGACTGGCTGG - Intergenic
1144453881 17:15403422-15403444 GAGAATAGGGAGAGGGTGGCTGG - Intergenic
1144684302 17:17216006-17216028 AAGAGTGAGGAGAGGATGGCAGG + Intronic
1144722757 17:17483640-17483662 AAGAATGAGGAAAGGGAGGCTGG + Intronic
1144886113 17:18463350-18463372 AAAAAGAAAGAAAGTGTGGCCGG + Intergenic
1145146094 17:20481020-20481042 AAAAAGAAAGAAAGTGTGGCCGG - Intergenic
1145221383 17:21092458-21092480 AAAAAGAAGAAGAAGGTGGTGGG - Intergenic
1145357341 17:22171660-22171682 TAAAATAAGGAGGGACTGGCTGG + Intergenic
1145931911 17:28692025-28692047 AAAAAAAGGGAGGGGCTGGCCGG + Intronic
1145956787 17:28860271-28860293 TAAAAAAAAGAGAGGGTGGCCGG - Intronic
1146090681 17:29874293-29874315 AAAAATGGGGAGGGGGTGGGTGG + Intronic
1146234957 17:31150620-31150642 CAAAATGAGGAGAGGGAGGGTGG - Intronic
1146332696 17:31941211-31941233 AAAAATAAGGAGGCTGAGGCAGG - Intronic
1146421806 17:32693862-32693884 AGAAAAAAGGAGAGTGGGGCCGG + Intronic
1146578044 17:34012046-34012068 CAAAATAAGGGGAGGGAGGAAGG - Intronic
1147381751 17:40060385-40060407 AAAAAGAAGATGGGGGTGGCCGG + Intronic
1147436966 17:40422419-40422441 AAAAATTATGGGAGGTTGGCTGG - Intergenic
1147505720 17:41015356-41015378 CTAAATAAGCAGAGGGAGGCTGG + Intronic
1147622843 17:41879399-41879421 AAAAAAAAGGCGGGGGGGGCAGG - Intronic
1147744114 17:42684627-42684649 AGAAAGAAGCAGAGGGGGGCCGG + Intronic
1147749229 17:42718386-42718408 AAAGAGAAGGAAATGGTGGCTGG + Intronic
1147851080 17:43443488-43443510 AAAAAGAAGTAGGGGGTGGGGGG - Intergenic
1148017856 17:44535054-44535076 AAAAATTAGCTGGGGGTGGCTGG - Intergenic
1148237998 17:45982327-45982349 AAAAAAAAGGGGTGGGGGGCGGG + Intronic
1148348296 17:46919257-46919279 AAAATGAAGGAGAGGCTGGAGGG + Intergenic
1148396194 17:47309906-47309928 AAAAAAAAAGAAACGGTGGCAGG + Intronic
1148501025 17:48091521-48091543 AAAAAAAAGGGCATGGTGGCGGG - Intronic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1148936729 17:51169144-51169166 GAATATGAGGAGAGAGTGGCTGG + Intronic
1149036992 17:52146261-52146283 AAAAATAAGATGTGGCTGGCTGG + Intronic
1149623750 17:58065073-58065095 CAAAATAAGGAGAGGCCTGCTGG - Intergenic
1149652170 17:58282276-58282298 AAAAAAAAAGAGTGGGTGGCGGG - Intergenic
1150513024 17:65776229-65776251 AAAAAAAAGGGGATGGGGGCGGG - Intronic
1150754215 17:67896376-67896398 AAACATTTGGAGAGGGTGGGAGG + Intronic
1151042427 17:70878328-70878350 AAAATGAAGGAAAGGATGGCTGG - Intergenic
1151486087 17:74401455-74401477 AAAAAGAAGGAAAGGTTGGCTGG - Intergenic
1151625940 17:75275821-75275843 AAAAATTAGGACATGGTGGCGGG + Intronic
1151710047 17:75799073-75799095 AAAAAAAAAAAGAGGGTTGCTGG + Intronic
1151730293 17:75907080-75907102 AAACAAAAGGACAAGGTGGCCGG - Intronic
1152179537 17:78810113-78810135 AAAAAAAAGAAGAGGGGGGCCGG - Intronic
1152231892 17:79117971-79117993 AAACAGAAGGAGGGGGTGGCCGG - Intronic
1152348371 17:79768783-79768805 AAAAAAAAGAAGAGGATGGCCGG + Intergenic
1153318573 18:3749447-3749469 AAATAGAAGGAGATGTTGGCCGG - Intronic
1153331298 18:3878361-3878383 AAACACAAGGAGACAGTGGCAGG + Intronic
1153890426 18:9509296-9509318 AAAAATATTGAGAGGAAGGCTGG + Intronic
1154255881 18:12780467-12780489 AAAAAAAAATAGAGGTTGGCTGG - Intergenic
1154353518 18:13607130-13607152 CAAAACAATGAGTGGGTGGCCGG + Intronic
1155004230 18:21713740-21713762 AAAAAAAAGGAGAGGGGTGCAGG - Intronic
1155280080 18:24230235-24230257 ACAAACAAGGAGAGGGAGGAGGG + Intronic
1155662237 18:28263156-28263178 AAAAACAAGGGGTGGGGGGCCGG - Intergenic
1156090413 18:33461178-33461200 AAAAATTAGGACAGTGTGCCTGG + Intergenic
1156248830 18:35331248-35331270 ACAAATGTGGTGAGGGTGGCAGG - Intergenic
1156261617 18:35449590-35449612 TAAAATAAAGAGATGTTGGCAGG + Intronic
1156303337 18:35854399-35854421 AAAAAGAAGGAGAGCATGACCGG - Intergenic
1156379518 18:36545099-36545121 ATAAAGAAGGAGAGGGAGGGAGG - Intronic
1156821073 18:41373657-41373679 AACAATAGGAAGAGGGTGGATGG + Intergenic
1157209609 18:45730617-45730639 AAAAAAATGGAGAGGTTTGCAGG - Intronic
1157495117 18:48151528-48151550 AAAGATAAGGAAACGGAGGCTGG + Intronic
1157986302 18:52441840-52441862 AAAAAGAAGAAAAGAGTGGCTGG - Intronic
1158154059 18:54405607-54405629 AAAATTAAGCAGGGGGAGGCAGG - Intergenic
1158385888 18:56991126-56991148 AAAAATGAGGAGAAGGTGTACGG - Intronic
1159235519 18:65667898-65667920 AATAAAAAGGAGTGGGTGGCTGG - Intergenic
1159977877 18:74738441-74738463 AAAAAAAAGGAGAAGTTGGCCGG + Intronic
1160337678 18:78057249-78057271 CAGAAAAAGGAGAGAGTGGCTGG + Intergenic
1160761930 19:789821-789843 ACAAATAAGGAAGGGGGGGCAGG - Intergenic
1160779229 19:870577-870599 AAAAAAAGGGAGAGGGTGAATGG + Intronic
1160876571 19:1299260-1299282 AAAAATAAAAACAGAGTGGCCGG + Intronic
1161270599 19:3387513-3387535 ATTAATAAGAAGAGGGTGTCAGG + Intronic
1161405692 19:4090090-4090112 AAAAGGAAGGAGAGTGAGGCTGG - Intergenic
1161462671 19:4408006-4408028 AAAAAAAAAGAGGGGGTGGGGGG - Intronic
1161649668 19:5476703-5476725 AAAAAAAAGGAGAGGCGGCCGGG + Intergenic
1161696126 19:5769304-5769326 AAAAAAAAAAAGAGGGTGGTGGG + Intronic
1161810666 19:6469325-6469347 AAAAAAAAGAAGACTGTGGCTGG - Intronic
1161811619 19:6474770-6474792 AAATATATAGAGACGGTGGCCGG + Intronic
1161850558 19:6735971-6735993 AAAAAAAAGGGGAGGGTGTGAGG + Intronic
1161919745 19:7257238-7257260 AAAGATAAGGTGGGGGAGGCCGG - Intronic
1162126610 19:8502749-8502771 AAAAAAAAGAAGTGGCTGGCAGG - Exonic
1162185114 19:8898716-8898738 AGAAATAAGGTGAGTGAGGCAGG + Intronic
1162256733 19:9496587-9496609 AAAAAAAAGGTGGGGGTGGGGGG + Intronic
1162260811 19:9532446-9532468 AAAAATTAGCCGAGGGTGGTGGG - Intronic
1162269656 19:9603859-9603881 AAAGAAAAGGAGAGGGAGGGAGG + Intergenic
1162297949 19:9826488-9826510 AAAAATTAGCCGAGGGTGGTGGG + Intronic
1162420605 19:10564162-10564184 AAAAAGAAAGAAAGGCTGGCTGG + Intronic
1162422373 19:10573120-10573142 AGAAATGGGGAGAGGGGGGCCGG + Intronic
1162429440 19:10618720-10618742 AAAAATTAGGCGAGCATGGCCGG - Intronic
1162721044 19:12663221-12663243 AAAAATAAGGAGAACGTGTTAGG + Intronic
1162768842 19:12937240-12937262 AAAAAAAAAGAAATGGTGGCCGG - Intergenic
1162934534 19:13975052-13975074 AAAAAAAAAGGGAGGGGGGCAGG + Intronic
1163056229 19:14720427-14720449 CAAGCTAAGAAGAGGGTGGCCGG + Exonic
1163339753 19:16697785-16697807 AAAAATTAGCTGGGGGTGGCAGG + Intergenic
1163508444 19:17721523-17721545 AAAAATAACGGCATGGTGGCAGG + Intronic
1163523986 19:17809128-17809150 ATAAACAAGGAGATGTTGGCCGG - Intronic
1163801708 19:19369703-19369725 AAAAAAAAGGGGGGGGTGGCAGG + Intergenic
1163840309 19:19603962-19603984 AAAAAAAAGAATAGGGTAGCTGG + Intronic
1164217815 19:23165435-23165457 AAAAAAAAAGAGAGAGAGGCTGG - Intergenic
1164249734 19:23466305-23466327 AAAAATAAGGAGAGGAGAGGAGG - Intergenic
1164280173 19:23762257-23762279 AGAAATAAGGCGGGGGTGGGAGG - Intergenic
1164931190 19:32177546-32177568 AAAAAGAAGGAAAGGAAGGCAGG + Intergenic
1164943125 19:32267052-32267074 ATAAATATGAAGAGGGTGGGGGG + Intergenic
1165084070 19:33330530-33330552 AAAATTAAAGAGTGGCTGGCTGG + Intergenic
1165395771 19:35562857-35562879 ACAAATAAGGAGAGAGCAGCAGG - Intronic
1165459056 19:35933553-35933575 AAAAAAAAAGAGATGGGGGCTGG + Intergenic
1165459132 19:35934011-35934033 AAAAAAAAAGAGATGGGGGCTGG + Intergenic
1165580838 19:36862155-36862177 AAAGATAAAGAGAAGTTGGCCGG - Intronic
1165790187 19:38486662-38486684 AAAGATAGGGAGATGGTGGGAGG - Intronic
1165810213 19:38607573-38607595 AAAAAAAAGAAGAAGGTGGAAGG + Intronic
1166834381 19:45658264-45658286 AAAAAAAAGGAGAGAGAGACAGG - Intergenic
1166836393 19:45670399-45670421 AAAATTGGGGAGGGGGTGGCTGG - Intronic
1166854501 19:45776801-45776823 AGAATTATGGAGAGTGTGGCAGG - Intronic
1166984241 19:46649896-46649918 AAAAAAAAAGAGAGAGTGGAGGG + Intronic
1167033324 19:46978085-46978107 AAGTATAAGGGGAGGGTGGCAGG + Intronic
1167086362 19:47312380-47312402 AAAGATAAGGAGAAGGAGGCTGG - Intronic
1167391696 19:49199553-49199575 TAAAAAAACGGGAGGGTGGCCGG - Intronic
1167657074 19:50771850-50771872 AAAAAAAAGGGGGGGGGGGCGGG - Intergenic
1168327431 19:55545440-55545462 GAAAAGAAGGAGAGAGAGGCAGG - Intronic
1202697439 1_KI270712v1_random:135299-135321 AAAAATAAGGAAAGGGAGGCTGG - Intergenic
925306185 2:2849439-2849461 AAAAAGAAGGAGGGGGAGGGGGG - Intergenic
925856656 2:8135411-8135433 AAAAAAAAGGAGGGTGTGGTGGG + Intergenic
926104773 2:10143252-10143274 AAAGATCAGGAGCGGGTGGGTGG - Intronic
926725054 2:15991206-15991228 AAGAAGAAGAAGAAGGTGGCCGG - Intergenic
926948583 2:18216492-18216514 AAAAAAAAGGAGTGGGAGGCGGG + Intronic
927231706 2:20830412-20830434 AAAAAAAAGGAGAGGTGGGGTGG - Intergenic
927598042 2:24414741-24414763 AAAGATAAGGAGAGGATGGCTGG - Intergenic
927626583 2:24727150-24727172 AAAAAAAAAAAAAGGGTGGCGGG + Intronic
927688979 2:25194075-25194097 AGAAATCAGGAGAGTGTGGAGGG + Intergenic
927868466 2:26608250-26608272 AAAAAAAAGGAGAGTGGGTCTGG + Intronic
928218022 2:29378713-29378735 AAAAAGAAAGAGAGGGAGGGAGG - Intronic
928285241 2:29984747-29984769 AAAAAAAAAAAGAGGGGGGCGGG - Intergenic
928535132 2:32232733-32232755 AAAAATAGGTAGAAGGTAGCGGG + Intronic
928816273 2:35298300-35298322 AAAAGTAAAGAGAGAGTGGTGGG + Intergenic
928902798 2:36338673-36338695 AGAGAGAAGGGGAGGGTGGCAGG - Intergenic
929027592 2:37619657-37619679 AGAAAAAAAGGGAGGGTGGCTGG + Intergenic
929720640 2:44363674-44363696 AAAAAAAAGAAGGGGGTTGCCGG - Intronic
929777484 2:44938105-44938127 CAAAACAAGGAGAGAGTGGGAGG + Intergenic
929827397 2:45319818-45319840 TAAAAGAAGGCCAGGGTGGCTGG - Intergenic
930063266 2:47308579-47308601 AAAAAAAAAGAGAAGGTGGCAGG - Intergenic
930731106 2:54728828-54728850 GAAAATAAGGATAGGATGGTAGG - Intronic
931483862 2:62670809-62670831 AATAATCAGGAGAGGGTGTATGG + Intergenic
931884377 2:66599769-66599791 AAGAGCAAGGAGAGGGTGGAAGG - Intergenic
932238041 2:70136759-70136781 AAAAACAAGGGGTGGGAGGCAGG - Intergenic
932603153 2:73144049-73144071 AAATATAAGCAGAGGGAGTCTGG - Intronic
932821767 2:74907405-74907427 AAAAATGAGGAAAAAGTGGCTGG + Intergenic
933472347 2:82742085-82742107 AAAAAGAGAGAGAGGGTGGGAGG - Intergenic
933740853 2:85532800-85532822 AAAGATAAAGAGAGGGAGGGAGG - Intergenic
933769584 2:85734501-85734523 AAAAAAAAGGAGTGGGAGGAAGG + Intergenic
934278608 2:91592324-91592346 AAAAATAAGGAAAGGGAGGCTGG - Intergenic
934321244 2:91974107-91974129 AAAAATTAGCAGGCGGTGGCAGG + Intergenic
936970450 2:118171688-118171710 ACAAGTAAGGAGAGAGTTGCAGG - Intergenic
937067454 2:119028635-119028657 AAAACGATGGAGTGGGTGGCTGG + Intergenic
937143394 2:119620926-119620948 AAAAAAAAGCAGGGGTTGGCTGG + Intronic
937358866 2:121215135-121215157 AAAAGGAAGGAGAGTCTGGCCGG + Intergenic
937838518 2:126498650-126498672 AAAAATTAGCTGGGGGTGGCAGG - Intergenic
938242463 2:129753828-129753850 AAAAATTAGCTGGGGGTGGCAGG + Intergenic
938657418 2:133448253-133448275 AAAAAAAAAAAGAGGGAGGCGGG + Intronic
938703041 2:133895992-133896014 AAAAAAAAAGAGAGGGTTGGGGG + Intergenic
938863300 2:135392348-135392370 AAAAAAAAGGGGGGGGGGGCAGG + Intronic
939721826 2:145663240-145663262 AAATATAAAGAAAAGGTGGCCGG - Intergenic
939946683 2:148419718-148419740 AAAGGTAGGTAGAGGGTGGCTGG - Intronic
939995663 2:148916911-148916933 AAAGATCAGGAGAGGGTAGATGG - Intronic
941339019 2:164282750-164282772 AAAAAAAAAAAGAGAGTGGCTGG - Intergenic
941650100 2:168083214-168083236 AAAAAAAAGGAGAATGTGGAAGG - Intronic
941751325 2:169137847-169137869 AAGAATAAGGAGAGAGGGGAAGG + Intronic
942044824 2:172094445-172094467 AAAAGAAAGGAGGAGGTGGCAGG - Intergenic
942207114 2:173630146-173630168 AAAAATAAGGAAAATATGGCTGG + Intergenic
943577136 2:189643072-189643094 AAAAAAAAGGAGAAGGAGGGAGG - Intergenic
944187312 2:196963374-196963396 AATATTAAGGAGAGGGAGGTAGG + Intergenic
944747396 2:202672206-202672228 AACAAAAAGGAGGGGGAGGCAGG - Intronic
945013102 2:205485813-205485835 AAGGATAAAGAGAGGGTGGCTGG - Intronic
945434387 2:209801675-209801697 AAAAAAAAGCAGGGGTTGGCCGG - Intronic
946269473 2:218578654-218578676 TAAAAGAAGGAGCGGGAGGCGGG - Intronic
946298163 2:218803253-218803275 AAAAATAAGCAAAGAATGGCTGG - Intronic
946357286 2:219195954-219195976 AAAAAAATGGAGAGGCTGTCTGG - Intronic
946566366 2:220970248-220970270 AAAAATAGGAAGATGGGGGCCGG + Intergenic
946745692 2:222843273-222843295 AAAAAGTAGGAGGGGGTTGCAGG + Intergenic
946868585 2:224065308-224065330 AAAATTAGGGAGATGGGGGCAGG + Intergenic
947152302 2:227128283-227128305 AAAAATAAGAAGAGGCTTGAAGG - Intronic
947411553 2:229846024-229846046 AAAAAAAAGGTGGGGGGGGCAGG + Intronic
947737204 2:232461933-232461955 AAAAATAAGGAGGGAGGGCCAGG + Intergenic
947921655 2:233880534-233880556 AAAAATTAGCTGAGGGTGGTGGG + Intergenic
948563170 2:238867238-238867260 AGAAAGAGGGAGAGGGAGGCAGG + Intronic
948959645 2:241323160-241323182 AAAAAAAATTAGATGGTGGCTGG - Intronic
1168803462 20:659178-659200 AGACTTAAGGAGAGGGTTGCTGG - Intronic
1168950132 20:1792273-1792295 ACAAATTAGGACAGGGTGGGTGG + Intergenic
1169259348 20:4124507-4124529 AAGAAAAAAGAGAGGGGGGCGGG - Intronic
1169376112 20:5067748-5067770 AAAAAAAAGCAGAGGGGGGCTGG - Intergenic
1170248332 20:14249416-14249438 AAAACCAAGGAGAAGGTGGCAGG + Intronic
1170717833 20:18847349-18847371 AAAAATAAGGTGAAGGTTGGTGG + Intergenic
1171197320 20:23210175-23210197 AAAAAGAAGAAAAGGGTGACAGG - Intergenic
1171982249 20:31636455-31636477 AAAAATTAGCCGAGTGTGGCAGG - Intergenic
1172262411 20:33579713-33579735 AAAAAGAAGGACAGGGTTGGAGG - Intronic
1172334885 20:34107027-34107049 AAAAATTAGCAGAAGGTGGCGGG + Intronic
1172351899 20:34249602-34249624 AAAAATTAAGAGATGGTGACAGG - Intronic
1172365242 20:34344052-34344074 AAAAAGAAGAAGAAGGTGGCAGG - Intergenic
1172473140 20:35215861-35215883 AATATAAATGAGAGGGTGGCTGG - Intergenic
1172514244 20:35522176-35522198 AAAGATAAGGTGAGGGTCCCAGG - Intergenic
1172546725 20:35767674-35767696 AAAAAAAAGGAGGGGGGGCCAGG - Intergenic
1172569864 20:35961582-35961604 AAAAAGCAGGAGAGGGAGGCAGG - Intronic
1173163917 20:40672620-40672642 AAAAAGAAGAAGAAGGTGGGTGG + Intergenic
1173230102 20:41188394-41188416 AAAAAAAAGGTGGGGGTGGGTGG - Intronic
1173519512 20:43688741-43688763 CAAAATAAGAATAGGGTGCCAGG - Intronic
1173593042 20:44240362-44240384 AAAAAGAAGAAGAGCATGGCAGG + Intergenic
1173613242 20:44386145-44386167 AAAAAAAATCAGATGGTGGCTGG - Intronic
1174185718 20:48704556-48704578 AAAAAAAAAGAGAGGGAGGGAGG - Intronic
1174288958 20:49493555-49493577 ATAAATAAGAAGAGTGAGGCCGG - Intergenic
1174329797 20:49808926-49808948 AAAAAAAAGGGGGGGGTGGAGGG + Intergenic
1174534581 20:51241049-51241071 AAAAAAAAGGGTAGTGTGGCAGG - Intergenic
1174629878 20:51947082-51947104 TAAAATGAGTAGGGGGTGGCCGG + Intergenic
1174986507 20:55460134-55460156 AAAAAGAAGGACAGGGTGCAAGG + Intergenic
1175053441 20:56176340-56176362 AAAAAAAGGGAGAGAGAGGCAGG + Intergenic
1175066078 20:56290007-56290029 AAAAAAAAGAAGAGGTGGGCAGG - Intergenic
1175096274 20:56543933-56543955 AAAAAAAAAAAGAGGGTGGGGGG - Intergenic
1175102102 20:56586597-56586619 AAAAAAAAGGAGTGGGGGGCGGG + Intergenic
1175235094 20:57504270-57504292 AAAAAAAAGGAGACGGGGGGCGG - Intronic
1176421301 21:6518282-6518304 AGAAAGAGGGAGAGAGTGGCAGG - Intergenic
1176721412 21:10396801-10396823 AAAAAAAAGGAGAAGAAGGCTGG + Intergenic
1177574304 21:22930965-22930987 ATAAATAAGTAGAGGGTGACTGG - Intergenic
1177952565 21:27556879-27556901 AAAAAAAAAGTGAGGTTGGCCGG - Intergenic
1178142494 21:29699943-29699965 AAAAAAAAGAAGATGTTGGCTGG - Intronic
1178318368 21:31585945-31585967 AAAAAAAAGGAGAGGTGGGGAGG + Intergenic
1178365885 21:31988423-31988445 AAACTGACGGAGAGGGTGGCAGG + Intronic
1178424927 21:32471620-32471642 AAAAAAAAGGAAATGGAGGCTGG - Intronic
1178534783 21:33402966-33402988 AAAAAAAAGGGGAGGGGGGCGGG + Exonic
1178786798 21:35661224-35661246 AAAAAAAAAGAGGGGGGGGCAGG + Intronic
1179200844 21:39219127-39219149 AAAAATAAGGAGAAGCAGGCAGG + Intronic
1179299196 21:40091261-40091283 AGAAATAAGGAGATGGTGTAGGG - Intronic
1179672362 21:42958610-42958632 AAAAAAAAGGGGGGGGTGGGGGG + Intergenic
1179696791 21:43126597-43126619 AGAAAGAGGGAGAGAGTGGCAGG - Intergenic
1180302603 22:11049577-11049599 AAAAAAAAGGAGAGGAAGGCTGG + Intergenic
1180309489 22:11158079-11158101 AAAAATTAGCAGGCGGTGGCGGG + Intergenic
1180547966 22:16519890-16519912 AAAAATTAGCAGGCGGTGGCGGG + Intergenic
1180620011 22:17154919-17154941 AAAAATAAGGACATTCTGGCTGG - Intronic
1180675321 22:17582376-17582398 AAAAAAAAGGAGAATGTGGTAGG + Intronic
1180872193 22:19152568-19152590 AAAAAAAAAGGGAGGGGGGCAGG - Intergenic
1181347079 22:22227443-22227465 AAAAAAAAAGAGAGAGAGGCTGG - Intergenic
1181406574 22:22689212-22689234 AAAAATAAGTAGAGGGAGGCTGG + Intergenic
1181762607 22:25068408-25068430 AAAAACAAGGAGAGGGTGCTGGG - Intronic
1181926584 22:26364439-26364461 AAAAAAAAGCCGAGTGTGGCGGG + Intronic
1182058571 22:27380413-27380435 AAAAAGCAGGCAAGGGTGGCAGG + Intergenic
1182572218 22:31248034-31248056 AAAAAAAAGCAGAGGATGCCAGG - Intronic
1182596468 22:31424797-31424819 AAAAAAAAGGGGGGGGGGGCGGG - Intronic
1182659658 22:31916242-31916264 AAAAAAAAGGGGGGGGTGGTGGG + Intergenic
1183129427 22:35819808-35819830 AAAAATAAGAGGAGGGTATCGGG + Intronic
1183670863 22:39271776-39271798 AAAAAAAAATAGAAGGTGGCTGG - Intergenic
1183881477 22:40835065-40835087 AAAAATTAGGAGAAGGCGGGGGG - Intronic
1183914927 22:41110114-41110136 AAAAAAAAGGGGGGGGGGGCAGG - Intronic
1184629808 22:45767683-45767705 AAAAAAAGGGAGAGGGTTGGAGG + Intronic
1184954913 22:47879530-47879552 AAAAATAAGGCCAAGGGGGCAGG - Intergenic
1203290062 22_KI270735v1_random:28033-28055 AAAAATAAGGAAAGGAAGGGAGG - Intergenic
949092440 3:44602-44624 AAAAGTAAGGGGAGGTTGGTGGG - Intergenic
949510769 3:4764927-4764949 AAAAATAAGTAGTGGGTGGCTGG + Intronic
949680681 3:6511044-6511066 AAAAATATGGATATTGTGGCTGG - Intergenic
950297359 3:11843438-11843460 AAAAATAAAGTCAGTGTGGCCGG + Intronic
950404492 3:12796435-12796457 AATAACAAGGAGGTGGTGGCAGG + Intergenic
950692603 3:14672027-14672049 AGTAATAAGGAGAGGGTTGGGGG + Exonic
950787020 3:15445333-15445355 CAAAATAAGGAATGGTTGGCCGG - Intronic
950991349 3:17441527-17441549 GAAAATAAGGCCAAGGTGGCTGG + Intronic
951475144 3:23097093-23097115 AAAAATATGTAGAAGGTAGCCGG - Intergenic
952100396 3:30005197-30005219 AAAAAAAAAAAGAGGGTGGGGGG + Intronic
952449124 3:33414271-33414293 AAAAAGAAAGAGAGGGAGGAGGG + Intronic
952484217 3:33793278-33793300 CAGAATAAGGAGAGGGTGGAGGG - Intergenic
952754515 3:36854753-36854775 AAAAAAAAAGGGAGGGTGGTAGG - Intronic
953082973 3:39638435-39638457 AAAACTAAGGAGAGGGTCATGGG - Intergenic
953738399 3:45515567-45515589 AAGAATAGGGTGTGGGTGGCTGG + Intronic
954165685 3:48755766-48755788 AAAAAAAAGGAAATGGGGGCTGG - Intronic
954319642 3:49822990-49823012 AAAAAAAAGGAGGGGGAGCCAGG + Intergenic
954429523 3:50462894-50462916 AAAAAAAGAGAGAGGGAGGCTGG + Intronic
955241771 3:57184758-57184780 AAAAACAGAGAGCGGGTGGCAGG - Intergenic
955760127 3:62271306-62271328 AAAAATAATGTAAGGGTGTCAGG - Intronic
956518032 3:70072116-70072138 AAAAACGAGGAGCGGGTGGGAGG - Intergenic
957032702 3:75260678-75260700 AAAAGTAAGGGGAGGTTGGTGGG - Intergenic
957293795 3:78310674-78310696 AAAAAGAAAGAGAGGGTGGTGGG + Intergenic
957580942 3:82072373-82072395 AGAAATAAGGAGAGGGAGAAAGG + Intergenic
958415554 3:93869034-93869056 AAAAAGAAGGATAGGGAGGTAGG - Intergenic
958590603 3:96154254-96154276 AAGAATATGGTGGGGGTGGCTGG - Intergenic
959080583 3:101796581-101796603 ACTAAAAAGGAGAGGGTGGCTGG + Intronic
959575890 3:107933126-107933148 AAAAATAAGGAAAGAGTTGGAGG - Intergenic
959650119 3:108743357-108743379 CAAATTAAAGAGAAGGTGGCAGG - Intergenic
959985406 3:112565808-112565830 AAAGAGAAGGAGTGGTTGGCTGG + Intronic
960044001 3:113178912-113178934 AAAAATAAGGTCAGCATGGCAGG + Intergenic
960319989 3:116222706-116222728 AAAAAAAAGGAGAGGATGAAAGG - Intronic
960709613 3:120514579-120514601 AAGAAGAAGGAGAGGGAGGGGGG - Intergenic
960710478 3:120522610-120522632 AAAAATCAGCTGAAGGTGGCTGG + Intergenic
961488521 3:127234288-127234310 AGTAATAGGGAGAGGGTGACAGG + Intergenic
961961424 3:130859147-130859169 AGAAATAAGGAGAGGGCAGAGGG + Intronic
962042249 3:131719548-131719570 AAAAAGAAGGACAGGCTGGCTGG - Intronic
962075908 3:132081419-132081441 AACAATCAGGAGAGGCTTGCTGG + Intronic
962289805 3:134124349-134124371 AGAAGTAAGGAGAGGGTTGGAGG - Intronic
962386135 3:134934063-134934085 AAAGATAAAGAGTGGGTGGGAGG - Intronic
963158794 3:142128684-142128706 AAAAAGAAAGAGAGGGAGGGAGG + Intronic
963244083 3:143044275-143044297 AAAAAAAAGGAGAGGGGAGAGGG - Intronic
963252312 3:143114765-143114787 AAAAAGGAGGAGGTGGTGGCAGG - Intergenic
963624117 3:147649220-147649242 AAAAATAAGGTTAAGGTGGTAGG - Intergenic
963718918 3:148837490-148837512 AAAAAAAAGGAGAAGTTGGATGG + Intronic
964796293 3:160501310-160501332 AAAAAAAAGGATTGGGTGGGGGG + Exonic
964839744 3:160980769-160980791 AAAGAAAAGGAGAGGGAGGGAGG + Intronic
964984391 3:162721609-162721631 AAGAATAAGGAGGGGGTAGAAGG + Intergenic
965042003 3:163520287-163520309 AAAAAAAAGGGGGGGGTGGGTGG + Intergenic
965076004 3:163977303-163977325 TAAAAGAAGGAGAAGGGGGCTGG - Intergenic
965730583 3:171767943-171767965 AAAAAAAAAGAGAGGGGGGCTGG + Intronic
965833534 3:172826043-172826065 AAAAATTAGCAGGGCGTGGCGGG - Intergenic
966621224 3:181966302-181966324 AAAAAAAAAAAGAGGGTGCCTGG - Intergenic
966676958 3:182600065-182600087 TAAAAAAAAGAGGGGGTGGCTGG + Intergenic
966830858 3:184007314-184007336 AAAAATAAGCAGAAGTGGGCCGG - Intronic
966853030 3:184176183-184176205 AAAAATAAGGACTGGGGGGTGGG - Intronic
967068899 3:185944947-185944969 AAAAAAAAAGAGAGAGAGGCCGG + Intergenic
967075620 3:185999523-185999545 AAAAATTAGCCGAGCGTGGCCGG + Intergenic
967104575 3:186245013-186245035 AAAAAAAAGTGGAGGGGGGCGGG + Intronic
967398534 3:189033726-189033748 AAAAATTAGGGCATGGTGGCTGG - Intronic
967471300 3:189865026-189865048 AAAAAAAATAAGAGGGTGCCAGG + Intronic
967800741 3:193656317-193656339 AAAAATACGGAGTGAGTGGTGGG - Intronic
968118679 3:196109162-196109184 AAAAATTAGCAGGTGGTGGCAGG - Intergenic
968121822 3:196131293-196131315 TAAAAAAAAGAGAGGGTGACAGG + Intergenic
968310353 3:197677544-197677566 GAAAAGAAAGAGAGGGGGGCAGG + Intronic
969134415 4:5018972-5018994 AAAAAAAAGGAGTGGGAGGATGG - Intronic
969221269 4:5760397-5760419 TAACATCAGGAGAGGGTGACAGG + Intronic
969685410 4:8671266-8671288 AAGAAGAAGGTGAGGGTGGAAGG + Intergenic
970075419 4:12213495-12213517 AAAAATTAGCTGGGGGTGGCAGG - Intergenic
970160823 4:13187340-13187362 AAAACTGAGGACAGGTTGGCAGG + Intergenic
970219364 4:13794974-13794996 AAAAATCAGAAGTGGGAGGCAGG - Intergenic
970285754 4:14512595-14512617 AAAGATGAGGAGTGAGTGGCCGG + Intergenic
970526109 4:16933885-16933907 AAAAAAAAAGGGGGGGTGGCGGG - Intergenic
970572043 4:17392879-17392901 AGAAGGAAGGAGAGGGTGGAAGG + Intergenic
971411173 4:26374465-26374487 AAAAAAAAGAAAAGGGTGACCGG - Intronic
971834880 4:31749814-31749836 AAAAAAAAGGATAGCCTGGCAGG - Intergenic
972299169 4:37768935-37768957 CTAAAGAAGGTGAGGGTGGCCGG + Intergenic
972511767 4:39773623-39773645 AAAACTAACAAGAAGGTGGCTGG + Intronic
972521510 4:39861462-39861484 AAAAATAAAGAGAGAGAGACTGG + Intronic
972919218 4:43917391-43917413 AAAAATTAGCCGAGTGTGGCAGG + Intergenic
973653547 4:53021985-53022007 AAAAATGAGGAGGGGGTCACAGG + Intronic
973671402 4:53222146-53222168 AAAACAAAGGTGAGGGTGGGCGG - Intronic
973818424 4:54640265-54640287 AAAAAAAAGGTGGGGGTGGTGGG + Intergenic
975495403 4:75030843-75030865 AAAAATGAGGAAGGTGTGGCTGG - Intronic
975870018 4:78769633-78769655 AAAAAAAAGAAGAGGGAGGGCGG + Intergenic
975940275 4:79635657-79635679 AAAAAAAAAGAGGGGGTGGGGGG - Intergenic
976253048 4:83072851-83072873 AAAAAAAAGGAGTGGGAAGCAGG - Intronic
976990350 4:91357873-91357895 AAAAAAAAGGGGGGGGGGGCAGG - Intronic
977221304 4:94340637-94340659 AAAAAAAAAGGGAGGGGGGCGGG - Intronic
977717894 4:100204057-100204079 AAAAATAAGGACAGTTTGGCTGG + Intergenic
978237937 4:106482617-106482639 AAAAAAAAGGAGAGAGGAGCGGG - Intergenic
978571462 4:110142339-110142361 AAAAATTAGTAAGGGGTGGCCGG - Intronic
979018701 4:115467601-115467623 AAAAATATGGAGACAGTTGCAGG + Intergenic
979321596 4:119331164-119331186 AAAAAGAAAGAGAGGGTGATAGG - Intergenic
979609447 4:122673732-122673754 AAAAAGAAGGACACAGTGGCAGG + Intergenic
979701507 4:123673432-123673454 AAAAATAGGGAGTAGGTGACTGG + Intergenic
979831557 4:125311673-125311695 AAAAAAAAGGAGAGGGAGAGAGG + Intergenic
980108778 4:128614751-128614773 GCAAAGAAGGAGAGGGAGGCAGG + Intergenic
980215302 4:129844988-129845010 AAAAATAAGCACAGGGTGCTTGG - Intergenic
981138796 4:141242886-141242908 AAGAATAAAGAGAAGTTGGCTGG - Intergenic
982147183 4:152407723-152407745 ATAAATAAATAGAGGGTGGGGGG - Intronic
982156013 4:152521638-152521660 AGAAATAAGGGGACGGTGGAAGG + Intronic
982450128 4:155543173-155543195 AAATAAAAAGAGAGAGTGGCTGG + Intergenic
983347485 4:166545706-166545728 AAAAATAAGGAGACCCTGGGAGG - Intergenic
983479382 4:168254289-168254311 AAAAATAAAGTGAGGGTGAGGGG - Intronic
983560467 4:169096588-169096610 ATAAAAAACGAGAGGATGGCTGG - Exonic
984316034 4:178133667-178133689 ACAAAAAAGGATAGTGTGGCCGG + Intergenic
984509564 4:180662111-180662133 TAAAATGAGGACAGGGAGGCAGG - Intergenic
984519731 4:180787282-180787304 AAAAAGAAGGAAAGGGTGATTGG + Intergenic
984591359 4:181620780-181620802 AAAAATAAGGAATGTGTGCCTGG + Intergenic
984679268 4:182588420-182588442 ATAGATAAGGACAGGGTGGAAGG - Intronic
985179336 4:187239571-187239593 AAAAAAAAGGAAAGGAAGGCAGG - Intergenic
985269114 4:188177423-188177445 AAAAAAAAGGAGATGGGGGCAGG + Intergenic
985313815 4:188632558-188632580 AAGAAGAAGGGGAGGGTGGCCGG + Intergenic
985979912 5:3453879-3453901 AAAAAAAAGGAGAGTCTGGGAGG - Intergenic
986004772 5:3658445-3658467 AAAAACAAAGAGAAGGGGGCTGG - Intergenic
986748121 5:10761457-10761479 AGAAGGAAGGAGAGGGAGGCGGG + Intergenic
986786890 5:11122976-11122998 AAGGATAAGGAGAGGCTGTCTGG + Intronic
986985466 5:13495633-13495655 AAACATAAGGAGAGAGTTCCAGG - Intergenic
987047919 5:14124828-14124850 AAAAAAATGGAGAAGGAGGCCGG + Intergenic
987683897 5:21171802-21171824 AAAAACAGGGAGAGGAGGGCAGG + Intergenic
987976588 5:25022484-25022506 AGAAATAGGGAGAGGAAGGCTGG + Intergenic
989003106 5:36782101-36782123 AAAACCAAAGAGAGGGTGGAGGG + Intergenic
989553069 5:42757883-42757905 AAAAAAAAGGTGGGGGTGGAGGG + Intronic
990042191 5:51388846-51388868 TAAAATACCGAGAGGGAGGCGGG + Intronic
990731331 5:58812176-58812198 AAAAAGAAAGAGATGGGGGCTGG + Intronic
990886032 5:60594712-60594734 AAAAAGAAGGAAAGGATGGAGGG + Intergenic
991063003 5:62398289-62398311 AAAAATAGGGAAAGGCTGTCTGG + Intronic
991649281 5:68835308-68835330 CAAAATAAGGAGGGGGCGACGGG + Intergenic
993299050 5:86183984-86184006 TAAGATAAGGTGGGGGTGGCAGG - Intergenic
993439587 5:87939361-87939383 AAAATCAAGGAAAGGGAGGCAGG - Intergenic
993450743 5:88069897-88069919 AAAAAAGTGGGGAGGGTGGCTGG - Intergenic
993981910 5:94553144-94553166 AAAAATAAGTAAAGGCTGGGCGG + Intronic
994047959 5:95330509-95330531 AAGAATAAAGAGAGGGAGGAAGG + Intergenic
995824922 5:116285371-116285393 GATAAAAAGGAAAGGGTGGCAGG - Intronic
996428023 5:123335802-123335824 AATATTGAGTAGAGGGTGGCTGG - Intergenic
997044841 5:130302581-130302603 AAAAATAATGAGGAAGTGGCCGG + Intergenic
997547265 5:134719393-134719415 AAAAAAAAGAAGAAGTTGGCTGG + Intronic
997646671 5:135486709-135486731 AATAACAAGAAGAGGGTGCCAGG + Intergenic
997753427 5:136372030-136372052 AAAAATCAGGAAAGGATGACTGG + Intronic
997938744 5:138137609-138137631 AAAAATAAAGAGAAAATGGCGGG - Intronic
998254607 5:140575136-140575158 ACAAATAAGGAAAGAGAGGCAGG - Intronic
998269799 5:140696273-140696295 AAAAATAAGGAGATTGTGGCTGG + Intronic
998413878 5:141931272-141931294 AAAAGAAAGGTGAGTGTGGCTGG + Intronic
998784538 5:145694805-145694827 AAAAAAAAGGAAAGAGTGGCAGG + Intronic
998886830 5:146703337-146703359 GGAAATAATGAGAGGGTGGTGGG + Intronic
999623125 5:153491860-153491882 AGAAATACAGGGAGGGTGGCGGG - Intronic
1000145401 5:158448785-158448807 ATGAACAAGGAGAGGGTGGTTGG - Intergenic
1000442694 5:161282209-161282231 AACAATGAGGCCAGGGTGGCTGG + Intergenic
1000625168 5:163529942-163529964 AAAAAAAAGGAGGGGGAGGGAGG + Intergenic
1001036467 5:168300280-168300302 AAAAATAATAATGGGGTGGCGGG + Intronic
1001109903 5:168886955-168886977 AAAAAGGTGGGGAGGGTGGCTGG - Intronic
1001165427 5:169361337-169361359 GAAAAAAAGGGGAGGGGGGCAGG + Intergenic
1001274880 5:170343336-170343358 AGAAAAGAGGAGAGGGAGGCTGG - Intergenic
1001445140 5:171777041-171777063 AAAAAAAAGGAGGGGGAAGCTGG - Intergenic
1001681293 5:173558974-173558996 AAATATAAGGAGAAAGTGGGGGG - Intergenic
1001742478 5:174065340-174065362 AGAAATAAGGACAGTGAGGCCGG + Intronic
1002155541 5:177275727-177275749 AATAATAAGAAAAGGGAGGCCGG - Intronic
1002519816 5:179786086-179786108 AAAAATTAGCAGAGAGTGGTGGG + Intronic
1002691087 5:181051099-181051121 AAAAACAAGAAGAAGGTGGTAGG + Intronic
1002713351 5:181208800-181208822 AAAAATTAGCCGGGGGTGGCGGG + Intergenic
1002717856 5:181239753-181239775 AAAAATTTAGAGATGGTGGCTGG + Intronic
1002764823 6:230102-230124 AAAAATGAGGGGTGGGTGGGGGG - Intergenic
1003393652 6:5734419-5734441 TAAAGCAAGGAGAGGGTGTCAGG + Intronic
1004251889 6:14029596-14029618 AAAAATAAGGAAAATGAGGCTGG + Intergenic
1004255236 6:14057733-14057755 AAAAATAAATAGAGGCAGGCAGG + Intergenic
1004375802 6:15089832-15089854 AAGCAGAAGGACAGGGTGGCAGG + Intergenic
1004387211 6:15183534-15183556 AAAAAGAAGAAGAAGGAGGCTGG - Intergenic
1004505251 6:16241888-16241910 AAAAATTAGCAGAGCGTGGTAGG - Intronic
1004583436 6:16976719-16976741 TAAAATAATGACAGGTTGGCAGG - Intergenic
1005352962 6:24954442-24954464 AAAAAAAAGGAGAGAGAGACTGG - Intronic
1005732662 6:28713689-28713711 AAAAAAAAAAAGAGGGGGGCCGG - Intergenic
1006112158 6:31754020-31754042 AAAAAAAAAAAGAGGGAGGCCGG - Intronic
1006227422 6:32551368-32551390 AAAAATAAAGAAATGGTGGATGG - Intergenic
1006229950 6:32577411-32577433 AAAAATAAAGAAATGGTGGATGG - Intronic
1006314665 6:33283232-33283254 AAAAACAGGGAGCGGGTGGTGGG + Intronic
1006717998 6:36132272-36132294 AAGCATAAGGGGAGGGTGGAAGG - Intronic
1006921124 6:37627857-37627879 CAAAAGAAGGAGAGGGTGAAAGG + Intergenic
1007002368 6:38326176-38326198 AAGGATAAGGAGAGGGTGAGGGG + Intronic
1007286728 6:40753253-40753275 AAAGGTGGGGAGAGGGTGGCTGG - Intergenic
1007377379 6:41466171-41466193 AAAGAAAAGGAGAAGGGGGCCGG + Intergenic
1007520128 6:42445610-42445632 AAAGATTGGGAGAGGGAGGCGGG - Intronic
1007532711 6:42556933-42556955 AAAAATACAGAAATGGTGGCAGG - Intergenic
1007722216 6:43891735-43891757 AGAGAAAAGGGGAGGGTGGCAGG + Intergenic
1007975909 6:46100952-46100974 GAAAATCAGGTGATGGTGGCAGG + Intergenic
1008154406 6:47996169-47996191 CAGAATCAGGAGAGAGTGGCTGG + Intronic
1008545400 6:52578831-52578853 AAAAATTAGCAGGGGGTGGAGGG - Intergenic
1010014505 6:71088841-71088863 TAAAATAAGGAAATTGTGGCAGG - Intergenic
1010026725 6:71227294-71227316 AAAAAAAGGGAAAGGGTTGCAGG - Intergenic
1010067077 6:71695305-71695327 GAACAAAAGGAGAGAGTGGCAGG - Intergenic
1011136110 6:84102812-84102834 AAAAATAATGTGAGGTGGGCAGG + Intergenic
1011701128 6:89955869-89955891 AAAAATAAGAGGGGGGTGGGAGG + Intronic
1011843346 6:91529306-91529328 AAGAAAGAGGAGAGGGAGGCAGG + Intergenic
1012257976 6:97056072-97056094 AAAAAAAAGAAAAGGGAGGCTGG - Intronic
1012596003 6:101041050-101041072 AAAAAGAAGGAGAAGAAGGCAGG - Intergenic
1012812912 6:103983701-103983723 AAAAAAAAGGGGAGGGTAGGGGG + Intergenic
1013005351 6:106068082-106068104 AAAAAAAAGAACAGGGTGGCTGG - Intergenic
1013626960 6:111948109-111948131 AAAAATAGGCAGAGGGAGGTGGG + Intergenic
1013833778 6:114308287-114308309 AAAACTAACTAGATGGTGGCAGG + Intronic
1014552832 6:122808657-122808679 AGAAAGAAGGAGAGGGAGGGAGG - Intronic
1014971013 6:127815289-127815311 AAAAATGACGGAAGGGTGGCTGG - Intronic
1015234114 6:130951255-130951277 AAAAAAAAGGAGGGGGAGGGGGG + Intronic
1015300054 6:131642865-131642887 AAAAATAGGGTGAGGGTGCTGGG - Intronic
1015551230 6:134414342-134414364 AAAAAAAAGGGGGGGGTGGGGGG + Intergenic
1016055564 6:139574590-139574612 AAAAAAAAGCAGATGCTGGCGGG - Intergenic
1016225125 6:141725390-141725412 AAAGAAAAGGAGATGGTGGAAGG - Intergenic
1016446933 6:144143427-144143449 AAAGATATGGACAGGGTGGAGGG + Intergenic
1016477601 6:144445052-144445074 AAAAATAAGTAGATACTGGCCGG + Intronic
1016879634 6:148898207-148898229 AAAAAAAATGAGAGGGTGGAAGG - Intronic
1017089231 6:150743740-150743762 AAAAAAAAGGAGGGGGTGGGAGG - Intronic
1017238515 6:152141772-152141794 AAAAATAAGCAGAGGTAGGCTGG + Intronic
1017757920 6:157545378-157545400 AAAAAAAAGGAGGAGGAGGCCGG + Intronic
1019786057 7:2978304-2978326 AAAAATTAGGGCACGGTGGCGGG - Intronic
1019978982 7:4606997-4607019 GAAAATAAAGAGAGGCTGGCTGG - Intergenic
1019990697 7:4688673-4688695 AGAAAAAAGCAGAGGGTGCCGGG - Intronic
1020069007 7:5213194-5213216 ACAAATGGGGAGATGGTGGCAGG - Intronic
1020703848 7:11517372-11517394 AAAAATAATGATATGGGGGCCGG - Intronic
1020876331 7:13699381-13699403 AAAAAAAAGGTGGGGGTGGGGGG + Intergenic
1021298577 7:18941184-18941206 AAGAATAACGGGAGGGAGGCAGG - Intronic
1021373285 7:19877206-19877228 AAAAATAAGAAGAGAGGGGAGGG - Intergenic
1021427810 7:20522628-20522650 AAAGAGGAGGAGAGGGAGGCTGG + Intergenic
1021711380 7:23419230-23419252 AAAAATGAGGTGTGGGTGGCAGG + Intronic
1022474565 7:30701502-30701524 AAAAACAAGGAGAGGAAGGTTGG - Intronic
1022478560 7:30727948-30727970 TGAAAGAGGGAGAGGGTGGCAGG - Intronic
1022495349 7:30849846-30849868 CAAAATAAGGACAATGTGGCTGG - Intronic
1022575540 7:31493468-31493490 ATAAATAAGAAGAGGGTTTCAGG - Intergenic
1022670971 7:32455738-32455760 AAAAATATAGATAGGATGGCTGG + Intergenic
1023024816 7:36040911-36040933 AAAATGAAGGGGAGTGTGGCTGG + Intergenic
1023558141 7:41444815-41444837 CAAAATGAGGAGAAGGTGCCAGG - Intergenic
1023563349 7:41498568-41498590 AGAAATGGGGAAAGGGTGGCAGG + Intergenic
1023821985 7:43985633-43985655 AAAAAAAAGGGGGGGGTGTCAGG - Intergenic
1023927702 7:44682096-44682118 AAAAATTAGCACTGGGTGGCCGG + Intronic
1024653504 7:51429309-51429331 AGAATTAAGGAGAGGGTGGTGGG - Intergenic
1025925353 7:65954970-65954992 AAAAATAATAATAGGGTGGTCGG + Exonic
1027282055 7:76615982-76616004 AAAAAAAAGGGGGGGGGGGCAGG + Intronic
1027722210 7:81758447-81758469 AAAAATAAACAGAGGGAGGAAGG + Intronic
1027882593 7:83860368-83860390 AAAAATAAGGAGAGGATGAGAGG - Intergenic
1028071878 7:86460708-86460730 ATAAATATTGTGAGGGTGGCCGG + Intergenic
1028313520 7:89369716-89369738 AAAAAGAAGGTGAGTTTGGCTGG - Intergenic
1029150122 7:98474366-98474388 AAAAATTAGCAGAGCGTGGTGGG + Intergenic
1029554002 7:101255060-101255082 AAGAAGAAGGAGAAGCTGGCTGG + Intergenic
1029574986 7:101397529-101397551 AAAAAAAAGGAGGGGGGGGGAGG - Intronic
1029750247 7:102539047-102539069 AAAAAAAAGGGGGGGGTGTCAGG - Intronic
1029768198 7:102638155-102638177 AAAAAAAAGGGGGGGGTGTCAGG - Intronic
1030021607 7:105280649-105280671 AAAAAAAAGGGGGGGGGGGCCGG + Intronic
1030480742 7:110100826-110100848 AAAAAAAAATAGAGGTTGGCAGG + Intergenic
1030921285 7:115391772-115391794 AAAAATTGGGAGAAGGAGGCGGG - Intergenic
1030999236 7:116395716-116395738 AAAAAAAAGGAGGGGGAGGAAGG - Intronic
1031081790 7:117265150-117265172 AAAAAAAAAGGGAGGGAGGCAGG - Intergenic
1032359047 7:131237848-131237870 AAAAATAACTAAAGGGTGGCTGG + Intronic
1032557793 7:132855883-132855905 AAAAAAAAGAAGAGGGTGGGTGG + Intronic
1033171571 7:139089117-139089139 AAAAAAAAAAAAAGGGTGGCAGG + Intronic
1033190938 7:139278473-139278495 AAAAAAAGGGAGAAGGAGGCTGG - Intronic
1033549023 7:142428610-142428632 AAAAAAAAAGGGTGGGTGGCAGG + Intergenic
1034921789 7:155089225-155089247 AAAAATCCGGACATGGTGGCGGG - Intergenic
1035520191 8:269771-269793 AAAAAGAAAGAGAGGGAGGGAGG + Intergenic
1036051649 8:5205763-5205785 AAAAAAAAAGAGAGGGAGGAAGG + Intergenic
1036475234 8:9087202-9087224 AAAAATAAGATGAAGGTGGGGGG - Intronic
1036580931 8:10074952-10074974 AAAAAGAAGTACAGGGTGCCGGG - Intronic
1036943785 8:13075293-13075315 AAAAACAAGGAAAGGATGGAGGG + Intergenic
1037081777 8:14796631-14796653 CAAAATAAGTAGAGAGTGTCAGG - Intronic
1038077038 8:24087919-24087941 AAAAAAAAGGAGAGGAAGGTGGG - Intergenic
1038399300 8:27270786-27270808 AAAAATAAGAAATGGGTGGCAGG - Intergenic
1038667661 8:29554250-29554272 AAAAAGAAGGGGAGGGAGGGAGG - Intergenic
1039052614 8:33508632-33508654 AAAAAAAAGGGCAGGGGGGCAGG + Intronic
1039144696 8:34434282-34434304 AAAAATAAATAGACGTTGGCAGG - Intergenic
1039171171 8:34747213-34747235 AAAAATGAGGAGAAGGTAGTGGG + Intergenic
1039951271 8:42174634-42174656 AAAATTAACCAGGGGGTGGCTGG - Intergenic
1040499600 8:47995246-47995268 AAAAAAAAGGAGAGAGTGAAAGG + Intergenic
1041200432 8:55448887-55448909 AAAAATAAAGAGAGTGTTACTGG + Intronic
1041395142 8:57382856-57382878 ATATATAAAGAGAGGGAGGCAGG + Intergenic
1041399651 8:57428537-57428559 AAAAATTAGCCGGGGGTGGCGGG - Intergenic
1042277263 8:67018811-67018833 AAAAAAAAGGGGGGGGGGGCGGG - Intronic
1042363898 8:67914542-67914564 AAAAAGAAGGGGAGGAAGGCTGG - Intergenic
1042695339 8:71548301-71548323 AAACAGAAGGAGGGGGTGGTGGG + Intronic
1043393179 8:79810737-79810759 AAGAATAATGATAGGCTGGCTGG - Intergenic
1045169025 8:99643231-99643253 AAAAAACTGGAGAGGGTAGCTGG + Intronic
1045396526 8:101766064-101766086 GAAAATAAGGAGATGTTGGTGGG - Intronic
1045706881 8:104934205-104934227 ACAAATAAAGAGAGGGAGGGAGG + Intronic
1045982667 8:108209807-108209829 GAAATTAAGGACAGGGTGGCAGG + Intronic
1046353063 8:113041210-113041232 AAAAAAAAGGGGGGGGTGGGGGG + Intronic
1046476359 8:114749861-114749883 AAAAATAGGAGGAGGGTGGGTGG - Intergenic
1046971085 8:120224009-120224031 AAAAAAAAGGAGATGAGGGCAGG - Intronic
1046996683 8:120531549-120531571 AAAAATTAGGAGGGGGCGGGTGG + Intronic
1047147913 8:122226415-122226437 AAAAAAAAGTAGAGGGGGGAGGG - Intergenic
1047416907 8:124672196-124672218 AAAAATATGGAGAAGGGGCCAGG + Intronic
1047504500 8:125468502-125468524 TAAAATCAGGAGAGTGTAGCAGG + Intergenic
1047672056 8:127158734-127158756 AAAAAAAAAGGGAGGGTGGCAGG + Intergenic
1047754298 8:127906940-127906962 AAAAAAAAAGAGAGAGTGCCAGG - Intergenic
1048235016 8:132681304-132681326 AAAAAAAAGGAATGGTTGGCTGG - Intergenic
1048292375 8:133190924-133190946 AAAAAAAAAGAGAGAGAGGCAGG + Intergenic
1048541010 8:135342118-135342140 GCAAAGAAGGAGAGAGTGGCTGG - Intergenic
1048569525 8:135639983-135640005 AAAAAAGTGGAGAGGGTTGCTGG + Intronic
1049358579 8:142200952-142200974 AAAGAAAAAGAGAGGGAGGCAGG + Intergenic
1050507767 9:6365183-6365205 AAAAGGAAGGAGAGGGCTGCAGG + Intergenic
1050516109 9:6445972-6445994 AAAAAAAAAAAAAGGGTGGCGGG - Intronic
1050607087 9:7313519-7313541 AAAAATAAAGAAAAGGGGGCTGG - Intergenic
1050885669 9:10762171-10762193 AAAAAGAAGGAGAGGGAGAGAGG + Intergenic
1051221990 9:14858494-14858516 AAAAAAAAAAAGTGGGTGGCTGG - Intronic
1051448232 9:17164741-17164763 AAAAATAAGGAGTTCTTGGCTGG - Intronic
1052505246 9:29345008-29345030 AAAAAAAAGGGGGGGGTGGAGGG - Intergenic
1052522504 9:29566583-29566605 AAAAATTAGGGCATGGTGGCGGG - Intergenic
1052978081 9:34426751-34426773 AAAAATAGAGAGAGGATTGCAGG + Intronic
1053049502 9:34947810-34947832 AAAAATAAGAAAAAGTTGGCTGG + Intergenic
1053345885 9:37378020-37378042 TAAAATGAGGTGAGGGTGGGGGG - Intergenic
1053408405 9:37898257-37898279 AAAAATTAGCCGGGGGTGGCCGG + Intronic
1055020946 9:71669088-71669110 AAAAATGAGCCGAGTGTGGCAGG - Intergenic
1055249575 9:74286938-74286960 AAAAATAATGAGGGGGAGGATGG - Intergenic
1055323695 9:75106658-75106680 AAAAAAAAGCAGTGGGTGCCGGG + Intronic
1055490596 9:76801054-76801076 AAAAACAAGGAGAGGGCAGTTGG - Intronic
1056332867 9:85536071-85536093 ACATATAGGGAAAGGGTGGCAGG - Intergenic
1056436756 9:86581708-86581730 TAAAAAGAGGAGAGGTTGGCTGG - Intergenic
1056620963 9:88214255-88214277 AAAAAAAAGGAGATCTTGGCCGG - Intergenic
1056645291 9:88406441-88406463 AAAAATTAGCTGAGGGTGGTTGG - Intronic
1057550954 9:96050545-96050567 AACAATTAGAAGAGTGTGGCTGG + Intergenic
1057842978 9:98501139-98501161 AAAAAAAAGGAGCAGGGGGCGGG - Intronic
1058111094 9:101030946-101030968 AAAAAGAAGCAGGGGGTGGGGGG + Intronic
1058617744 9:106851704-106851726 AAAAATAAGCAAAGGGGGCCGGG + Intergenic
1058938656 9:109792622-109792644 AAAAATCAGTTGAGGGTGGGAGG + Intronic
1059869817 9:118560576-118560598 AAAGAAAAGGTGAGGGTAGCAGG + Intergenic
1060387209 9:123241970-123241992 AAAAAGGAGGACAGGGTGTCTGG - Intronic
1060673451 9:125490984-125491006 AAAAATTAGCTGAGGATGGCGGG + Intronic
1061132540 9:128716008-128716030 AAAAAAAAGGAGGGGGAGGCTGG + Intronic
1061394503 9:130336683-130336705 AAAAGGATGGAGGGGGTGGCTGG + Intronic
1061483393 9:130908432-130908454 AAAGATAAGGACAAGGCGGCAGG - Intronic
1061765676 9:132879649-132879671 AACAATGAGGAGTGGTTGGCTGG + Intronic
1203731040 Un_GL000216v2:90014-90036 TAAAAGAAGGCAAGGGTGGCTGG + Intergenic
1185445873 X:257865-257887 AAAAATAAGCGGAAAGTGGCCGG + Intergenic
1185538357 X:882046-882068 AAAAAAAAGGAGAGGAAGGCTGG - Intergenic
1185661636 X:1733203-1733225 GAAAAAAAGGAGAGGGGGCCGGG + Intergenic
1185764748 X:2716311-2716333 AAAAAAGTGAAGAGGGTGGCTGG - Intronic
1185931102 X:4204329-4204351 CCAAAAAAGGGGAGGGTGGCAGG + Intergenic
1186159936 X:6766751-6766773 AAAATTAAGGAGGGGAGGGCAGG - Intergenic
1186309533 X:8302674-8302696 AAAAGCAAGGAGAGGGTGCATGG - Intergenic
1187165222 X:16798872-16798894 AAAAAAAAGGAAATGCTGGCTGG - Intronic
1187282851 X:17874323-17874345 AAAAAAAAGGGCATGGTGGCAGG - Intergenic
1187416138 X:19094900-19094922 AAAAAGAAGGAGAAAGTGGACGG - Intronic
1187500911 X:19837735-19837757 ATAAAAAAGGAAAAGGTGGCTGG - Intronic
1187722521 X:22165982-22166004 AAAAACAGGGGTAGGGTGGCTGG + Intronic
1187976818 X:24711132-24711154 AAAAATTAGCCGAGCGTGGCAGG - Intronic
1189227776 X:39427664-39427686 AAAAATAATCAGAGTGTGGGGGG + Intergenic
1189473215 X:41330438-41330460 AAAAAGAAGGCGGGGGTGGGGGG - Intergenic
1189867083 X:45342075-45342097 GAAAATAAGGGGAGGGTGTGAGG + Intergenic
1189907223 X:45773813-45773835 CAAAATGAAGAGAGGGTGGTTGG + Intergenic
1190227094 X:48554571-48554593 AAAAAAAAGGATAGGGTTGGTGG + Intronic
1190318909 X:49167806-49167828 AAAACTAAGTACATGGTGGCTGG - Intronic
1190443755 X:50502340-50502362 ATCAATAAGGAGAAAGTGGCTGG + Intergenic
1190745507 X:53319999-53320021 AAAAAAAAGGCGGGGGTGGGGGG + Intronic
1190819282 X:53958409-53958431 AAAAAAAAGGAGGGGGAGGTAGG + Intronic
1191633184 X:63346612-63346634 AAACATCAGGGGTGGGTGGCGGG + Intergenic
1191940606 X:66476633-66476655 AAAAACCATAAGAGGGTGGCAGG + Intergenic
1192295189 X:69840107-69840129 AAAAAAAAGGCCAGTGTGGCTGG - Intronic
1192591413 X:72363049-72363071 AAAGACAAGGGCAGGGTGGCAGG + Intronic
1192593208 X:72379152-72379174 AAAAATAACTAAATGGTGGCCGG - Intronic
1192741773 X:73900300-73900322 AAAAAAAAGGGGAGAGTGGGAGG + Intergenic
1192776480 X:74250881-74250903 AAAAATTAGCAGGGGGTGGTAGG + Intergenic
1192858238 X:75037166-75037188 ATCAACAAGGAGAGGGTTGCTGG - Intergenic
1193027548 X:76861008-76861030 AAGAATACCTAGAGGGTGGCTGG + Intergenic
1193276636 X:79596467-79596489 AAAAATAACTAATGGGTGGCCGG - Intergenic
1195322024 X:103728166-103728188 AGAAGGAAGGAGAGGGTTGCAGG + Exonic
1196116314 X:112003440-112003462 AAAAGCAAGGCCAGGGTGGCTGG + Intronic
1196177665 X:112658127-112658149 AAAAATAAGCAAAGGATGGCTGG + Intronic
1196398255 X:115288878-115288900 AAGAAGAAAGAGAGGGTGGGAGG + Intergenic
1196769799 X:119282107-119282129 AAGAAAATGGAGAGGGAGGCCGG - Intergenic
1196785976 X:119421910-119421932 AAAAATAAAAAGGGGGTGGGTGG - Intronic
1197310737 X:124901933-124901955 AAAATAAAGGAGAGGGGGGAGGG + Intronic
1197775121 X:130113850-130113872 AAAAATAAGAAAAGTGAGGCTGG - Intergenic
1198116500 X:133549782-133549804 AAAAAGAAGGACAGGGAGGGAGG - Intronic
1198116512 X:133549826-133549848 AAAAAGAAGGACAGGGAGGGAGG - Intronic
1198754763 X:139971138-139971160 AAAAAGAAAGAGAGGGAGGGAGG - Intergenic
1198789537 X:140328576-140328598 AAGAGTAATGAGAGGGCGGCCGG - Intergenic
1200168336 X:154052754-154052776 AAAAAAAAAGAGTGGCTGGCCGG - Intronic
1200415621 Y:2906915-2906937 AAAAATAAGGAGAAGGAGGCTGG - Intronic
1201188731 Y:11429229-11429251 AAAAATTAGCAGGCGGTGGCGGG + Intergenic
1201267614 Y:12223428-12223450 AAAAATAATAATATGGTGGCTGG + Intergenic