ID: 904236708

View in Genome Browser
Species Human (GRCh38)
Location 1:29121656-29121678
Sequence AGCGCCGCGAACGCCCCCGA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 25
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 23}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904236699_904236708 6 Left 904236699 1:29121627-29121649 CCATACCCACCAGTACCACGAGC 0: 1
1: 0
2: 1
3: 3
4: 103
Right 904236708 1:29121656-29121678 AGCGCCGCGAACGCCCCCGACGG 0: 1
1: 0
2: 0
3: 1
4: 23
904236700_904236708 1 Left 904236700 1:29121632-29121654 CCCACCAGTACCACGAGCGCCCC 0: 1
1: 0
2: 0
3: 3
4: 68
Right 904236708 1:29121656-29121678 AGCGCCGCGAACGCCCCCGACGG 0: 1
1: 0
2: 0
3: 1
4: 23
904236703_904236708 -9 Left 904236703 1:29121642-29121664 CCACGAGCGCCCCCAGCGCCGCG 0: 1
1: 0
2: 3
3: 35
4: 265
Right 904236708 1:29121656-29121678 AGCGCCGCGAACGCCCCCGACGG 0: 1
1: 0
2: 0
3: 1
4: 23
904236698_904236708 7 Left 904236698 1:29121626-29121648 CCCATACCCACCAGTACCACGAG 0: 1
1: 0
2: 1
3: 7
4: 93
Right 904236708 1:29121656-29121678 AGCGCCGCGAACGCCCCCGACGG 0: 1
1: 0
2: 0
3: 1
4: 23
904236695_904236708 29 Left 904236695 1:29121604-29121626 CCAGTAGCCGGCCACTGCAATGC 0: 1
1: 0
2: 0
3: 6
4: 61
Right 904236708 1:29121656-29121678 AGCGCCGCGAACGCCCCCGACGG 0: 1
1: 0
2: 0
3: 1
4: 23
904236701_904236708 0 Left 904236701 1:29121633-29121655 CCACCAGTACCACGAGCGCCCCC 0: 1
1: 0
2: 1
3: 10
4: 150
Right 904236708 1:29121656-29121678 AGCGCCGCGAACGCCCCCGACGG 0: 1
1: 0
2: 0
3: 1
4: 23
904236697_904236708 18 Left 904236697 1:29121615-29121637 CCACTGCAATGCCCATACCCACC 0: 1
1: 0
2: 1
3: 11
4: 202
Right 904236708 1:29121656-29121678 AGCGCCGCGAACGCCCCCGACGG 0: 1
1: 0
2: 0
3: 1
4: 23
904236696_904236708 22 Left 904236696 1:29121611-29121633 CCGGCCACTGCAATGCCCATACC 0: 1
1: 0
2: 1
3: 8
4: 178
Right 904236708 1:29121656-29121678 AGCGCCGCGAACGCCCCCGACGG 0: 1
1: 0
2: 0
3: 1
4: 23
904236702_904236708 -3 Left 904236702 1:29121636-29121658 CCAGTACCACGAGCGCCCCCAGC 0: 1
1: 0
2: 0
3: 8
4: 104
Right 904236708 1:29121656-29121678 AGCGCCGCGAACGCCCCCGACGG 0: 1
1: 0
2: 0
3: 1
4: 23

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904236708 Original CRISPR AGCGCCGCGAACGCCCCCGA CGG Exonic