ID: 904239608

View in Genome Browser
Species Human (GRCh38)
Location 1:29135202-29135224
Sequence CAGTGTCAAGGCTCTGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904239601_904239608 -2 Left 904239601 1:29135181-29135203 CCAAGGTGATACCTCCATCTCCA No data
Right 904239608 1:29135202-29135224 CAGTGTCAAGGCTCTGAGGAGGG No data
904239594_904239608 29 Left 904239594 1:29135150-29135172 CCAAGGAGGTGGCAGGCTGCAGT No data
Right 904239608 1:29135202-29135224 CAGTGTCAAGGCTCTGAGGAGGG No data
904239600_904239608 -1 Left 904239600 1:29135180-29135202 CCCAAGGTGATACCTCCATCTCC No data
Right 904239608 1:29135202-29135224 CAGTGTCAAGGCTCTGAGGAGGG No data
904239599_904239608 0 Left 904239599 1:29135179-29135201 CCCCAAGGTGATACCTCCATCTC No data
Right 904239608 1:29135202-29135224 CAGTGTCAAGGCTCTGAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904239608 Original CRISPR CAGTGTCAAGGCTCTGAGGA GGG Intergenic
No off target data available for this crispr