ID: 904239608 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:29135202-29135224 |
Sequence | CAGTGTCAAGGCTCTGAGGA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 4 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
904239601_904239608 | -2 | Left | 904239601 | 1:29135181-29135203 | CCAAGGTGATACCTCCATCTCCA | No data | ||
Right | 904239608 | 1:29135202-29135224 | CAGTGTCAAGGCTCTGAGGAGGG | No data | ||||
904239594_904239608 | 29 | Left | 904239594 | 1:29135150-29135172 | CCAAGGAGGTGGCAGGCTGCAGT | No data | ||
Right | 904239608 | 1:29135202-29135224 | CAGTGTCAAGGCTCTGAGGAGGG | No data | ||||
904239600_904239608 | -1 | Left | 904239600 | 1:29135180-29135202 | CCCAAGGTGATACCTCCATCTCC | No data | ||
Right | 904239608 | 1:29135202-29135224 | CAGTGTCAAGGCTCTGAGGAGGG | No data | ||||
904239599_904239608 | 0 | Left | 904239599 | 1:29135179-29135201 | CCCCAAGGTGATACCTCCATCTC | No data | ||
Right | 904239608 | 1:29135202-29135224 | CAGTGTCAAGGCTCTGAGGAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
904239608 | Original CRISPR | CAGTGTCAAGGCTCTGAGGA GGG | Intergenic | ||
No off target data available for this crispr |