ID: 904242873

View in Genome Browser
Species Human (GRCh38)
Location 1:29161220-29161242
Sequence TTTAATAGGCATTAGTAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 153}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904242873 Original CRISPR TTTAATAGGCATTAGTAGGA TGG (reversed) Intronic
902364030 1:15959121-15959143 TTTAATAGTATTTAGTGGGAAGG - Intronic
904242873 1:29161220-29161242 TTTAATAGGCATTAGTAGGATGG - Intronic
905646823 1:39630688-39630710 TTTAAGAGGCATTCTGAGGATGG - Intronic
907923539 1:58934896-58934918 TTGAATAGGCTTTTGTTGGAAGG + Intergenic
908030336 1:59992495-59992517 TTTGAAAGGCATTAGGGGGAGGG - Intronic
908688785 1:66753453-66753475 TTTAACAAGTATTAGTAGGAAGG + Intronic
911901014 1:103504241-103504263 TTTGATAGGCTTTAGCATGAAGG + Intergenic
912789037 1:112632780-112632802 TTTATTAGACATAAGTAGGTAGG - Intronic
914959127 1:152190495-152190517 TTAAATAGGCTTCATTAGGAAGG + Intergenic
915987566 1:160481749-160481771 CTTAATGGGCATTAAAAGGAGGG + Intergenic
916397729 1:164410469-164410491 TTTAATAAGGATTAGTATTAGGG + Intergenic
919319746 1:196020899-196020921 TTTAATAGGCAAGAGAAAGAAGG + Intergenic
919434237 1:197536693-197536715 TATAATAGATATTAGTAGGCAGG + Intronic
919442140 1:197648941-197648963 TTTAATAGTCATTTGTAGACTGG - Intronic
920888053 1:209952811-209952833 TATAATAGATTTTAGTAGGATGG + Intronic
922646347 1:227290632-227290654 TTTTATAGGCATTCAGAGGAGGG + Intronic
1065203974 10:23340958-23340980 ATTAATAAGCATTTGTAGGATGG - Intronic
1065716758 10:28577841-28577863 TTTAATAGGCATTCCCAGGATGG - Intronic
1067156444 10:43784980-43785002 TTTATTAGGGCTTATTAGGATGG + Intergenic
1068444529 10:57104099-57104121 TTTAATGGGCATAAGTTGTAGGG - Intergenic
1068684634 10:59857144-59857166 TTTATTAGATTTTAGTAGGATGG - Intronic
1071342477 10:84661616-84661638 TTGAAGAGGCAGTTGTAGGAAGG + Intergenic
1073880012 10:107970098-107970120 ATTAATAGGCATTAATAGGGAGG + Intergenic
1074839129 10:117330619-117330641 TTTAATAGGAACAAGAAGGAAGG - Intronic
1075930341 10:126289732-126289754 TTTAAGAGGCTACAGTAGGAGGG + Intronic
1078173194 11:8945983-8946005 TTTCATATTCATTAATAGGAAGG - Intergenic
1078811163 11:14765065-14765087 TTTATTAGGCCTAAGTTGGAAGG + Intronic
1079418426 11:20262825-20262847 CTAAATAGTCATTAGTTGGAGGG - Intergenic
1083704130 11:64501479-64501501 TTTAATAGGCATTTTTAAGCTGG - Intergenic
1085311027 11:75516759-75516781 TATAAAATGCATTTGTAGGAAGG - Intronic
1086920041 11:92575804-92575826 GTTAATAGGCAGAAGGAGGAAGG + Intronic
1087174213 11:95081396-95081418 TTTAATAGGCAGGAGTACAAGGG + Intergenic
1087174663 11:95085621-95085643 CTTAATAGGCATAATTAGAAGGG + Intergenic
1087229811 11:95647885-95647907 TTTCATGTGCATTAGAAGGAGGG - Intergenic
1090034947 11:123240979-123241001 TTAAATATGCATTTGTAGGCAGG + Intergenic
1090496079 11:127214070-127214092 TTTAATAGGTATTATTGGCAGGG + Intergenic
1091333138 11:134746232-134746254 ATTAACAGGCAATAGTGGGAAGG + Intergenic
1092651825 12:10643108-10643130 GTTAATAGGCATGAGTAAGTGGG - Intronic
1093833688 12:23799312-23799334 ATTAATGGGCATTAGAAGGAAGG - Intronic
1098743566 12:74205947-74205969 TTTAATAGCCATTAGCAAGAGGG - Intergenic
1099293118 12:80797099-80797121 TTTATTATGCATTAATAGAATGG - Exonic
1099545886 12:83978836-83978858 TTTAATAAGGGTTAGTTGGAGGG - Intergenic
1099631964 12:85161680-85161702 TTCAGTAGGCATTTCTAGGATGG - Intronic
1100849474 12:98694643-98694665 TTTTATGGGCATTAGTAATAGGG + Intronic
1106458324 13:29946904-29946926 ATTAATAACCATTAGTAGGGTGG + Intergenic
1107041344 13:35951217-35951239 TTAAATAAGCATTTGTTGGATGG + Intronic
1108245998 13:48514811-48514833 TGTAGTTGGCATTAGTAGTAGGG - Intronic
1111700273 13:91678362-91678384 TTTAGTATGCATTTGTATGATGG + Intronic
1111758660 13:92432901-92432923 TTTGACAGTCATTAGTATGAAGG + Intronic
1111964767 13:94849426-94849448 TTTAAAAGTCATTGGAAGGAAGG + Intergenic
1112336062 13:98517169-98517191 TTTAATATGAATTATTATGATGG - Intronic
1112454497 13:99546358-99546380 TTTAATTCTCATTAGTAGGAAGG + Intronic
1114126170 14:19729268-19729290 TTTTATAGGTATTAGTTGGCAGG + Intronic
1114404453 14:22442971-22442993 TTTACCAGTCATTAGTAGGCAGG + Intergenic
1115075121 14:29379784-29379806 ATTAATAGGCATTTTTAAGAAGG - Intergenic
1115732994 14:36292199-36292221 TTTAAATGGCCTTTGTAGGATGG - Intergenic
1115862216 14:37700151-37700173 TTGTATAAGCTTTAGTAGGAAGG + Intronic
1116985196 14:51211614-51211636 TTTTATAGGCAGTGGTATGAGGG - Intergenic
1120441818 14:84550895-84550917 TATAATTGGCTATAGTAGGAAGG - Intergenic
1121907500 14:97760268-97760290 TTTAATATACATGAGGAGGAGGG + Intronic
1123569689 15:21591482-21591504 TTTTATAGGTATTAGTTGGCAGG + Intergenic
1123605799 15:22026801-22026823 TTTTATAGGTATTAGTTGGCAGG + Intergenic
1124517759 15:30382341-30382363 TTTTATAGGGATTAGGAGGTAGG - Intronic
1127281730 15:57498842-57498864 TTTAAAAGCCAGTAGAAGGATGG + Intronic
1127976768 15:64003335-64003357 ATTAATCTGCATTAGTGGGAAGG + Intronic
1128299791 15:66559124-66559146 TTTGAGAGGCTTGAGTAGGAGGG - Intronic
1128694990 15:69754907-69754929 TTCAATAAGCATTTGTTGGATGG - Intergenic
1128925200 15:71648978-71649000 TGTAATGTGCATTATTAGGAAGG + Intronic
1202978040 15_KI270727v1_random:318573-318595 TTTTATAGGTATTAGTTGGCAGG + Intergenic
1135068417 16:19331316-19331338 TGCAATAGGCATTAGGAGCATGG + Intergenic
1142929244 17:3268495-3268517 TTTGAGAGGCCTTAGTAGCAAGG + Intergenic
1144146143 17:12399655-12399677 TATAACAGACATTAGAAGGATGG - Intergenic
1144874032 17:18387695-18387717 TTTAAGAGGCATAAATACGAAGG - Intronic
1147040450 17:37714255-37714277 TTTAAAAGACATTTTTAGGAAGG + Intronic
1147664344 17:42136730-42136752 TTTAATTGTCAACAGTAGGATGG - Intronic
1150016799 17:61565284-61565306 TTGAATTAGCATTAGTAGTAGGG + Intergenic
1153699139 18:7674920-7674942 TTTCAAACGCATCAGTAGGAAGG + Intronic
1155561558 18:27083197-27083219 TTAAATAGGCATTGGAAGGGAGG + Intronic
1157236673 18:45971121-45971143 TTTGTTAGACCTTAGTAGGATGG + Intergenic
1157383274 18:47239692-47239714 TTTAACAATCATTAGTAAGAAGG + Intronic
1157587398 18:48813248-48813270 GTGAATAGGCATTCGAAGGAAGG - Intronic
1161227320 19:3152824-3152846 TTCAATAGTCCTTACTAGGAAGG + Intronic
926180706 2:10640662-10640684 TTTAATTAGCATGAGTATGAGGG - Intronic
934101976 2:88661746-88661768 TTTAATAGGCAGAATTAGAAAGG - Intergenic
934834443 2:97571349-97571371 TCTAAAATGCATTAGTAGGCTGG + Intronic
941327086 2:164129781-164129803 TTTAACATCTATTAGTAGGATGG + Intergenic
941787354 2:169512685-169512707 TTTAAAAGGCACTAATAGAACGG + Intronic
941893685 2:170608377-170608399 ATTAATAGACATTAAAAGGATGG + Intronic
942695785 2:178643123-178643145 TTTAATTGACATTAGTAGAGAGG - Intronic
943573616 2:189603979-189604001 AATAATTGGCATTAGTGGGAAGG + Intergenic
943917958 2:193662157-193662179 TTTAATACGCATTAGTAAGATGG + Intergenic
944119136 2:196221861-196221883 TTTAATTGGCATTTATAGAATGG - Intronic
944963918 2:204907478-204907500 TTTATTCTGCATTAGTAGCAGGG - Intronic
945554085 2:211257491-211257513 TTTAATAGGTACTAGTATGTTGG + Intergenic
946490546 2:220145159-220145181 TGTACTAGGCATTAGAAGGCAGG - Intergenic
946749728 2:222881854-222881876 TTTAACAGGCATAAGTAGGAGGG - Intronic
946937877 2:224740189-224740211 TTTAATTGGCATTTCAAGGATGG + Intergenic
1171369740 20:24653911-24653933 TTTAAATGGCATTGTTAGGATGG - Intronic
1174359741 20:50020606-50020628 TTTTATAGGCATTATTACTACGG - Intergenic
1183866738 22:40710288-40710310 CTTAAGAAGCAGTAGTAGGACGG - Intergenic
949668188 3:6366043-6366065 TTTGATAGGCATTAATAAGAGGG - Intergenic
951586208 3:24217642-24217664 TTTTATTGGCAGTAGTGGGAAGG + Intronic
956390351 3:68765761-68765783 TTTAATAGCCTTTTGGAGGATGG + Intronic
958046168 3:88286271-88286293 TTTCATAGCCATTTGTAGCATGG - Intergenic
960961170 3:123071491-123071513 TTTAATAGGCTTTTGTGGGTTGG + Intronic
962436465 3:135371650-135371672 TTTAAAGGGCAATAGGAGGAGGG - Intergenic
963092181 3:141493605-141493627 TTTAAAAGGTATCAGTAGAAAGG + Intronic
963305616 3:143649222-143649244 TTTAATAGGCTATTGAAGGAAGG - Intronic
965320799 3:167249541-167249563 TTTACTGGGCATTTGTTGGAGGG - Intronic
967355223 3:188561832-188561854 TGTAATGGGCATTTGGAGGAGGG + Intronic
968052739 3:195666803-195666825 TTTAGTAGGGTTTAGTAGGTTGG - Intergenic
968103071 3:195981549-195981571 TTTAGTAGGGTTTAGTAGGTTGG + Intergenic
968301388 3:197619137-197619159 TTTAGTAGGGTTTAGTAGGTTGG + Intergenic
971850337 4:31978033-31978055 TTTAAAAGGCACGAGTAGGCCGG + Intergenic
977436441 4:97001688-97001710 TTAAAGAGGAATTAGGAGGATGG + Intergenic
978348692 4:107798716-107798738 TTTAATAGGGCTTAGAGGGAAGG + Intergenic
979477047 4:121170562-121170584 TTTAAGAGGCATTTGTATGAAGG - Intronic
980761983 4:137246623-137246645 TTTATCAGGCATGAGTGGGATGG - Intergenic
980999885 4:139818507-139818529 TAAAATAGTCATGAGTAGGAAGG - Intronic
982465942 4:155732392-155732414 TTTAATGGGCCTTTGTAGGCTGG - Intergenic
983329069 4:166301322-166301344 TTTAAAAGGAATGAGTAGGGGGG + Intergenic
990616822 5:57517138-57517160 TTCAATAGTCAATAGTGGGATGG + Intergenic
991594349 5:68287884-68287906 TTCAATAGTAAGTAGTAGGAGGG - Intronic
992022047 5:72634408-72634430 ATTAAAAGGCATGAGTGGGAAGG + Intergenic
993086221 5:83366874-83366896 TGTGATAGGTAGTAGTAGGAGGG - Intergenic
996649236 5:125853497-125853519 TTAAATAATTATTAGTAGGAGGG - Intergenic
996692587 5:126356411-126356433 TTTAATAGGGAGAAGTAAGAGGG + Intergenic
997570708 5:134925095-134925117 TTTAATGGGGTTTAGTAGGGTGG + Intronic
998234124 5:140383174-140383196 TTTAATATGCATTTGTTGAATGG - Intergenic
1000954493 5:167526704-167526726 TTGAATAGGAATTAGAAAGAAGG - Intronic
1004815566 6:19308550-19308572 TTTAATAAGCATTAATAGAATGG + Intergenic
1005041096 6:21601221-21601243 TTTTGTAGGCCTTAATAGGAGGG - Intergenic
1005258645 6:24032707-24032729 TTTAAAAAGCTTTATTAGGATGG - Intergenic
1010027436 6:71236147-71236169 TTTATTAGGCAATAGTTGTATGG - Intergenic
1010262438 6:73831923-73831945 TTGCACAGGCAGTAGTAGGAAGG - Intergenic
1010766745 6:79783783-79783805 TATGCTAGGCATTTGTAGGAAGG - Intergenic
1012113093 6:95261152-95261174 TTTACCAGGCATTTGTTGGAGGG + Intergenic
1012133878 6:95531235-95531257 TCTTATGGGCATTAGGAGGAGGG - Intergenic
1012896466 6:104955217-104955239 TTTACTAGGCATTATTTTGATGG - Intergenic
1015832940 6:137389219-137389241 TGCAATAGGGATTAGGAGGAAGG + Intergenic
1017247328 6:152240492-152240514 TTTCAAAAACATTAGTAGGATGG - Intronic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1027873723 7:83743413-83743435 TTTAAGAGACATCAGCAGGAAGG - Intergenic
1027874434 7:83750324-83750346 TTTAAGAGACATCAGCAGGAAGG - Intergenic
1028620753 7:92825645-92825667 TTTTATAGAAATTATTAGGAAGG + Intronic
1031421342 7:121555739-121555761 TATAATAGGCCTGAGGAGGATGG - Intergenic
1031690211 7:124778727-124778749 TTTAATTGGTTTTAATAGGAAGG - Intronic
1034949420 7:155287077-155287099 TGGAACAGGCACTAGTAGGAAGG - Intergenic
1037272522 8:17145617-17145639 TTAAATAGGCATTGGTGGGTGGG - Intergenic
1041646827 8:60261632-60261654 TTTAATAGCCAAATGTAGGAAGG - Intronic
1042756988 8:72225563-72225585 GTTAATAGGCATTAGGAATATGG + Intergenic
1044463848 8:92480998-92481020 TTTAAAAGGGAATAGTAGGCAGG + Intergenic
1046210556 8:111068878-111068900 TTTACTTGGCGTTAGTAAGAAGG + Intergenic
1047052304 8:121126402-121126424 TTTAATAGTCATTAATAGACAGG + Intergenic
1050004674 9:1117869-1117891 ATTAAAAGGCAATAGTAGGATGG - Intergenic
1055257707 9:74391878-74391900 TTGAATAGGCTTTAGAGGGATGG + Intergenic
1056038386 9:82634221-82634243 TGTAATAGGCATTGTTAAGAAGG - Intergenic
1202630629 M:13679-13701 TTTAATGGGGTTTAGTAGGGTGG - Intergenic
1203653762 Un_KI270752v1:3897-3919 TTTTATTGGCATTCATAGGAAGG + Intergenic
1186262543 X:7794828-7794850 TTCATCAGGCATTATTAGGAAGG + Intergenic
1186708095 X:12163974-12163996 TTTAAGAGAAATTGGTAGGATGG + Intronic
1187649644 X:21388367-21388389 TTCAATAGGAATTACTAGAATGG - Intronic
1187839241 X:23469585-23469607 TTTTATACTCATTATTAGGATGG + Intergenic
1189392559 X:40588620-40588642 TTTAAGAGCCATCAGTAGGAAGG + Intronic
1190774328 X:53540621-53540643 TTTAGAAGGCATTAGAAGGCCGG - Intronic
1191874726 X:65784623-65784645 TTTCAGAGGCATTATGAGGAAGG - Intergenic
1196432057 X:115637475-115637497 TTAAGTTGGCTTTAGTAGGAGGG - Intronic
1196616478 X:117771688-117771710 TTTCATATGCATTACTTGGAAGG + Intergenic
1199824418 X:151484262-151484284 TTCAACAGGCATTACTAGGAAGG - Intergenic