ID: 904246385

View in Genome Browser
Species Human (GRCh38)
Location 1:29191167-29191189
Sequence CACCACGCTTCAAGATCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904246385_904246393 22 Left 904246385 1:29191167-29191189 CCTCCAGATCTTGAAGCGTGGTG No data
Right 904246393 1:29191212-29191234 GCTCTTAGAGTGGGCACCAGGGG No data
904246385_904246391 20 Left 904246385 1:29191167-29191189 CCTCCAGATCTTGAAGCGTGGTG No data
Right 904246391 1:29191210-29191232 CTGCTCTTAGAGTGGGCACCAGG No data
904246385_904246388 12 Left 904246385 1:29191167-29191189 CCTCCAGATCTTGAAGCGTGGTG No data
Right 904246388 1:29191202-29191224 CTGTATGCCTGCTCTTAGAGTGG No data
904246385_904246392 21 Left 904246385 1:29191167-29191189 CCTCCAGATCTTGAAGCGTGGTG No data
Right 904246392 1:29191211-29191233 TGCTCTTAGAGTGGGCACCAGGG No data
904246385_904246389 13 Left 904246385 1:29191167-29191189 CCTCCAGATCTTGAAGCGTGGTG No data
Right 904246389 1:29191203-29191225 TGTATGCCTGCTCTTAGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904246385 Original CRISPR CACCACGCTTCAAGATCTGG AGG (reversed) Intergenic