ID: 904246386

View in Genome Browser
Species Human (GRCh38)
Location 1:29191170-29191192
Sequence TAACACCACGCTTCAAGATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904246386_904246391 17 Left 904246386 1:29191170-29191192 CCAGATCTTGAAGCGTGGTGTTA No data
Right 904246391 1:29191210-29191232 CTGCTCTTAGAGTGGGCACCAGG No data
904246386_904246393 19 Left 904246386 1:29191170-29191192 CCAGATCTTGAAGCGTGGTGTTA No data
Right 904246393 1:29191212-29191234 GCTCTTAGAGTGGGCACCAGGGG No data
904246386_904246389 10 Left 904246386 1:29191170-29191192 CCAGATCTTGAAGCGTGGTGTTA No data
Right 904246389 1:29191203-29191225 TGTATGCCTGCTCTTAGAGTGGG No data
904246386_904246392 18 Left 904246386 1:29191170-29191192 CCAGATCTTGAAGCGTGGTGTTA No data
Right 904246392 1:29191211-29191233 TGCTCTTAGAGTGGGCACCAGGG No data
904246386_904246388 9 Left 904246386 1:29191170-29191192 CCAGATCTTGAAGCGTGGTGTTA No data
Right 904246388 1:29191202-29191224 CTGTATGCCTGCTCTTAGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904246386 Original CRISPR TAACACCACGCTTCAAGATC TGG (reversed) Intergenic