ID: 904246393 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:29191212-29191234 |
Sequence | GCTCTTAGAGTGGGCACCAG GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
904246385_904246393 | 22 | Left | 904246385 | 1:29191167-29191189 | CCTCCAGATCTTGAAGCGTGGTG | No data | ||
Right | 904246393 | 1:29191212-29191234 | GCTCTTAGAGTGGGCACCAGGGG | No data | ||||
904246386_904246393 | 19 | Left | 904246386 | 1:29191170-29191192 | CCAGATCTTGAAGCGTGGTGTTA | No data | ||
Right | 904246393 | 1:29191212-29191234 | GCTCTTAGAGTGGGCACCAGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
904246393 | Original CRISPR | GCTCTTAGAGTGGGCACCAG GGG | Intergenic | ||