ID: 904246393

View in Genome Browser
Species Human (GRCh38)
Location 1:29191212-29191234
Sequence GCTCTTAGAGTGGGCACCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904246385_904246393 22 Left 904246385 1:29191167-29191189 CCTCCAGATCTTGAAGCGTGGTG No data
Right 904246393 1:29191212-29191234 GCTCTTAGAGTGGGCACCAGGGG No data
904246386_904246393 19 Left 904246386 1:29191170-29191192 CCAGATCTTGAAGCGTGGTGTTA No data
Right 904246393 1:29191212-29191234 GCTCTTAGAGTGGGCACCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904246393 Original CRISPR GCTCTTAGAGTGGGCACCAG GGG Intergenic