ID: 904252238

View in Genome Browser
Species Human (GRCh38)
Location 1:29233346-29233368
Sequence CTATAATCCTTGAGAGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 226
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 210}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904252238 Original CRISPR CTATAATCCTTGAGAGAAGA AGG (reversed) Intergenic
900321872 1:2088484-2088506 CTCGAGTCCTTGAGTGAAGACGG + Intronic
901642766 1:10701444-10701466 CCAAAATCCTTGGGAGAGGATGG + Intronic
904252238 1:29233346-29233368 CTATAATCCTTGAGAGAAGAAGG - Intergenic
906349558 1:45046296-45046318 CAATAATTTTTGAGAGATGATGG + Intronic
910070819 1:83211520-83211542 CTATAATACTTAAGTGAACATGG - Intergenic
911101252 1:94097558-94097580 TTAGAATCCTTCAGAGAAGGTGG - Intronic
911312211 1:96307292-96307314 CTAGAATACAGGAGAGAAGATGG + Intergenic
916292757 1:163184642-163184664 CAAGAATCCTTGTAAGAAGAAGG + Intronic
916344626 1:163774250-163774272 GTATATACCCTGAGAGAAGAGGG + Intergenic
920353669 1:205354557-205354579 CAGTAATCCTTGAGAGAAATTGG + Intronic
922028658 1:221777620-221777642 CTATAATGCTTGGAAGGAGAAGG + Intergenic
923814930 1:237366996-237367018 CTATACTCCTTCAGAGAATGAGG - Intronic
924329543 1:242928123-242928145 CAAGAATCCTTTAGAGAAAAGGG + Intergenic
1063299142 10:4836198-4836220 CTGAAATGCTTGAGAGAAAAAGG - Intronic
1063875278 10:10470130-10470152 CTAAAATGCTTGAGACCAGAAGG - Intergenic
1064584914 10:16830184-16830206 CTATAATCCCTGGGAGACCAAGG - Intronic
1065052161 10:21805515-21805537 CTATCATCCTTGAAACAAAAAGG + Intronic
1065506157 10:26432084-26432106 CTGTTTTCCTTGTGAGAAGAAGG - Intergenic
1066334127 10:34458933-34458955 CTATACTCCTTAAAACAAGAAGG + Intronic
1068666270 10:59678887-59678909 ACAGAATCCTTGAGAGAAGCAGG + Intronic
1068723615 10:60275272-60275294 CTATAAACATTCAGAGCAGAAGG - Intronic
1070851957 10:79571457-79571479 CTGCAATCCTTTGGAGAAGAAGG - Intergenic
1072095884 10:92179168-92179190 CTCCAATCCTTGAGAGAAGGGGG - Intronic
1073992781 10:109282498-109282520 CTATAATCCCTGAAAAAAAATGG - Intergenic
1075680107 10:124325478-124325500 CTATGATCGTGGAGAGAGGAGGG + Intergenic
1075910559 10:126122090-126122112 ACTTAATCCTTCAGAGAAGAAGG + Intronic
1079961873 11:26934344-26934366 CTATAATCATGGAGATAAGGAGG + Intergenic
1081275674 11:41146280-41146302 CTCTTAACCTTGAGAGATGATGG - Intronic
1083277623 11:61606153-61606175 TTATAAACCTTGGGAGAAGCTGG - Intergenic
1084343719 11:68528368-68528390 ATATATTTCTTTAGAGAAGAGGG - Intronic
1085734640 11:79028741-79028763 CTATAATCCTGAATAGCAGAAGG + Intronic
1086868958 11:92014425-92014447 CTAAAAACCTTGAAAAAAGATGG - Intergenic
1087122082 11:94585487-94585509 CTATAATCCTTCAGAGCCAATGG + Exonic
1093941044 12:25054811-25054833 ATTCAATCTTTGAGAGAAGAGGG + Intronic
1095390411 12:41699314-41699336 CTATAATTCTAGAAATAAGAGGG + Intergenic
1097994346 12:65871369-65871391 CTCCAACCCTTAAGAGAAGAAGG + Intronic
1099030959 12:77524849-77524871 TTGTGATCCTTGGGAGAAGAAGG - Intergenic
1100031140 12:90192880-90192902 ACAAAATCCTTGAGAGAAAAAGG + Intergenic
1100298052 12:93281048-93281070 CTATAACCCTACAGGGAAGAAGG + Intergenic
1101538825 12:105645757-105645779 CAATAATCCTAAAGAGAAGAGGG - Intergenic
1104086390 12:125478203-125478225 CTATGATCCTTTGGAGGAGAAGG - Intronic
1106639153 13:31564790-31564812 CAATAATTCATGAGAGAGGATGG + Intergenic
1107052409 13:36065599-36065621 CTATAGTTCTAGAGATAAGAGGG - Intronic
1108459833 13:50654165-50654187 GTATTATCCTTTAGAAAAGAGGG + Intronic
1113129334 13:107017888-107017910 GTATAACCCTTGAATGAAGACGG - Intergenic
1113131145 13:107038330-107038352 CCATAATCCTTGGGAGGAAAAGG + Intergenic
1113300863 13:109018019-109018041 CTGTGATCCTTTGGAGAAGAAGG + Intronic
1114268789 14:21088991-21089013 CTAGAAGCCAGGAGAGAAGAGGG - Intronic
1114334007 14:21668899-21668921 CTAAACTTCTTGAGAGAATATGG + Intergenic
1115036363 14:28861533-28861555 CTATATTTATTGAGAGAAAAGGG - Intergenic
1115179028 14:30600697-30600719 CTCTCATCCTAGTGAGAAGAAGG + Intronic
1115184047 14:30664486-30664508 CTGCAATCCTTTGGAGAAGAAGG - Intronic
1116137375 14:40945252-40945274 CTAAAATCCTTCCCAGAAGATGG + Intergenic
1116551079 14:46238572-46238594 CTACAATCCTTGAGAAAAAGAGG + Intergenic
1116899759 14:50350456-50350478 CCTTAATCTATGAGAGAAGAAGG + Intronic
1116981899 14:51180379-51180401 GTAAAATAATTGAGAGAAGATGG - Intergenic
1117895547 14:60481994-60482016 ATATAATCTTTGAGAGAGGAAGG - Intronic
1118377854 14:65192433-65192455 CTACAAACCATGAGAAAAGAAGG - Intergenic
1118441996 14:65820873-65820895 CTATAATCTCTGAGAGCAGCAGG - Intergenic
1120129605 14:80789564-80789586 CTAAAATCCTTGAGAAATGTAGG + Intronic
1120443754 14:84567665-84567687 TTATAATCCATGACAGAAGTGGG + Intergenic
1125103784 15:35947122-35947144 CTATAATCTTACAGAGAAGGAGG - Intergenic
1125489163 15:40133811-40133833 CTATCATGCTAGAGTGAAGAAGG + Intergenic
1125777499 15:42230246-42230268 CTGCAAGCGTTGAGAGAAGAGGG - Intronic
1127275306 15:57438522-57438544 CTAAAAACGTTGACAGAAGAAGG + Exonic
1127423342 15:58830547-58830569 CTAAAATGCTTGAGATCAGAAGG - Intronic
1129096335 15:73212396-73212418 CTATAATATATGAAAGAAGAAGG - Intronic
1130242222 15:82205095-82205117 ACCTAATGCTTGAGAGAAGATGG + Intronic
1130331549 15:82925894-82925916 CTAAAATCATTGAGAAATGAGGG - Intronic
1130458154 15:84135728-84135750 ACCTAATGCTTGAGAGAAGATGG - Intergenic
1130534461 15:84773654-84773676 TCATAATACTAGAGAGAAGAGGG - Intronic
1131439092 15:92445077-92445099 CTCCATTCCTTGAGAGATGAGGG + Intronic
1132838485 16:1966706-1966728 CTGTGATCCTTCAGAGAAGGGGG + Intergenic
1138260479 16:55616515-55616537 CTATGATCCTTTGGAGGAGAAGG - Intergenic
1143686380 17:8520069-8520091 ATATATTCATTGAGAAAAGATGG + Intronic
1145923975 17:28632380-28632402 CTTAGATCCTTGAAAGAAGAGGG - Intronic
1146604272 17:34244967-34244989 CAACAATCCATGAGAGCAGAGGG - Intergenic
1146702329 17:34971968-34971990 CTATACTCCTCGAAATAAGAGGG + Intronic
1148039108 17:44692074-44692096 CTATCATCCTTGAGCCATGATGG - Intergenic
1150905476 17:69332207-69332229 ATTTGATCTTTGAGAGAAGATGG + Intergenic
1151778473 17:76226002-76226024 CGATCCTCCTGGAGAGAAGATGG - Intronic
1154108246 18:11543620-11543642 AAATAATCCTTGGGAGGAGAAGG - Intergenic
1155487659 18:26363820-26363842 ATATAATCCCAGAGAGAAGTGGG + Intronic
1155646610 18:28085946-28085968 TTATTCTCCTTTAGAGAAGATGG - Intronic
1157390100 18:47294603-47294625 CAATAATCCTTGAGAGAGGCAGG + Intergenic
1158843193 18:61410812-61410834 TTATAATCTTTGAAAGGAGATGG + Intronic
1158951136 18:62496254-62496276 CTATGATCCATGAAGGAAGAAGG - Intergenic
1161171850 19:2816105-2816127 GTATCATCCTTGAGAGGAGTGGG - Intergenic
1162159829 19:8703537-8703559 CAATACTGCTTGAGTGAAGATGG + Intergenic
1162361277 19:10221952-10221974 CTATATAACTTGAAAGAAGAAGG + Intronic
1164182068 19:22828120-22828142 TTATAATTTTTGAGAGAATACGG - Intergenic
1166238029 19:41470586-41470608 CTAATATCCAGGAGAGAAGAGGG - Intergenic
1167461856 19:49629270-49629292 CTAGAATCATTGAGTTAAGAGGG + Intergenic
926034059 2:9620754-9620776 CTATATTCCTAGGGATAAGATGG + Intronic
926180106 2:10634989-10635011 CTAAAATGCTTGAGATCAGAAGG + Intronic
926613932 2:14976053-14976075 CTATGATCCTTGAAAGAATACGG + Intergenic
926618787 2:15027500-15027522 CTATAATTATTAAGAGAATATGG - Intergenic
927033536 2:19148051-19148073 CTATAATCATTAAGACATGAAGG - Intergenic
928754295 2:34505686-34505708 CTGTGATCCTTTGGAGAAGAAGG - Intergenic
930512833 2:52367255-52367277 CTAAAATCCTTGAGAAAATTAGG - Intergenic
931010147 2:57902304-57902326 CCATAATTCTGGAAAGAAGAGGG - Intergenic
932421009 2:71601366-71601388 CTCTATTCCTTGAGGGTAGAAGG - Intronic
933202544 2:79467034-79467056 CTTTAAGAGTTGAGAGAAGAAGG + Intronic
936289304 2:111207627-111207649 CTTAAAGCCATGAGAGAAGAAGG - Intergenic
936656203 2:114490431-114490453 CTAATTTCCTTGAGGGAAGAAGG + Intronic
937166119 2:119819229-119819251 CTATGATCTTTGGGAGAAAAGGG - Intronic
937549634 2:123071502-123071524 ATATAATCCTTGAGACAGAATGG - Intergenic
937794026 2:125995930-125995952 CTATATTCTTAGCGAGAAGAAGG - Intergenic
938075493 2:128331206-128331228 CTAAAATCTATGAGAGATGAGGG - Intergenic
938285952 2:130117375-130117397 CAATAATCCTTGGGAAGAGAAGG - Intronic
938336599 2:130505938-130505960 CAATAATCCTTGGGAAGAGAAGG - Intronic
938353219 2:130614724-130614746 CAATAATCCTTGGGAAGAGAAGG + Intronic
938429654 2:131221527-131221549 CAATAATCCTTGGGAAGAGAAGG + Intronic
939752755 2:146067838-146067860 CTGTGGTCCTTGAGAGAAGGAGG + Intergenic
943842377 2:192599181-192599203 CCATGATCCTGGAGGGAAGAGGG - Intergenic
943929373 2:193830404-193830426 TTAGAAGCCTTGAGAGTAGAAGG + Intergenic
944374258 2:199022460-199022482 CTACAATCCTTAACAGAACATGG - Intergenic
944393490 2:199244649-199244671 CTGTAATCCTTTGGAGGAGAAGG + Intergenic
944456519 2:199900651-199900673 ATAAAATGCTTGTGAGAAGATGG - Intergenic
945529888 2:210939384-210939406 CTTTCAGCCTTGAGATAAGATGG + Intergenic
945638645 2:212393559-212393581 CAATAATCTTTGTGAGAATAGGG + Intronic
1169479044 20:5960961-5960983 TTATAATGCTTGAGTGAAAAGGG - Intronic
1171014914 20:21531316-21531338 CTATTTTCCCTGAGGGAAGATGG + Intergenic
1171081947 20:22195196-22195218 CCGTAATCCTTTGGAGAAGAAGG - Intergenic
1177336715 21:19737509-19737531 CTATAAACTTTGTGAGAAAAGGG + Intergenic
1179032500 21:37732728-37732750 CTAGAATTCTTAAGAGAAGCGGG - Intronic
1180674192 22:17576042-17576064 CTAAATTCCTTCAGAAAAGAAGG + Intronic
1182520082 22:30880271-30880293 CTAGAAACCTGGAGAGCAGAGGG + Intronic
1182932119 22:34184427-34184449 CTAAAATCCTTGAGGGATGAAGG + Intergenic
1183055729 22:35304404-35304426 TTGAAATCCTTGAAAGAAGAGGG - Intronic
1183713892 22:39522329-39522351 CGATCCTCCTGGAGAGAAGATGG + Exonic
1185350222 22:50332132-50332154 CCATAATCCATGAAAGAAAATGG - Intergenic
949695564 3:6690176-6690198 CTGAAATCATGGAGAGAAGAAGG + Intergenic
950339823 3:12233361-12233383 CTATAATCCTTCAGAGGCCAAGG + Intergenic
957306705 3:78467092-78467114 CTATGATCCTTTGGAGGAGAAGG + Intergenic
958528650 3:95294414-95294436 ATCTAATCCTTTAGAGAAGAAGG + Intergenic
959878355 3:111413335-111413357 CAATGATCACTGAGAGAAGAAGG - Intronic
961917167 3:130388988-130389010 GTATACTCCTACAGAGAAGATGG - Exonic
962572742 3:136727390-136727412 ATATAACCCTTCAGAGAATATGG - Intronic
963359763 3:144256300-144256322 CCAGAATCCTTAAAAGAAGAAGG - Intergenic
963486115 3:145936096-145936118 CTTTACTACTTGAGAGTAGATGG - Intergenic
963572860 3:147019508-147019530 GAGTAATCCTTGAGAAAAGAGGG - Intergenic
965253412 3:166371041-166371063 CCATTATACTTGAGAGAAGCAGG - Intergenic
966160814 3:176966405-176966427 CTATAGTCCTAGAAATAAGAGGG - Intergenic
966318164 3:178672073-178672095 CTACAGTCCTTCAGAGAAAAAGG - Intronic
967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG + Intronic
967573636 3:191063429-191063451 TTATAATCCTGTAGAGAAGATGG + Intergenic
967595043 3:191317953-191317975 TTATAAGCCTTGACATAAGAAGG - Intronic
967653588 3:192017285-192017307 CCATTATCTTTGAGTGAAGATGG - Intergenic
969193715 4:5544088-5544110 CTGAAATCTATGAGAGAAGAGGG + Intronic
969213259 4:5704199-5704221 CAATAATCCCAGAGAGAAGGTGG + Intronic
969733572 4:8971827-8971849 CCATGATCCAGGAGAGAAGAGGG - Intergenic
973857517 4:55028250-55028272 ATATAATCCTTTTGGGAAGATGG + Intergenic
975671498 4:76785487-76785509 TTTTAATCTTTGAGGGAAGATGG - Intergenic
976443671 4:85105877-85105899 CTATAAGCCTTCAGGGAACAGGG + Intergenic
976594510 4:86882258-86882280 TAATATTCCTTGAGAAAAGATGG - Intronic
979932483 4:126648275-126648297 CAGTAATCATTGAGAGATGATGG - Intergenic
979934171 4:126670826-126670848 CTACAATCCTTTGGAGGAGAAGG - Intergenic
982629196 4:157810188-157810210 ATCCACTCCTTGAGAGAAGAGGG - Intergenic
982780690 4:159488068-159488090 CTAACATTCTTGAGAGAGGATGG + Intergenic
983382843 4:167019771-167019793 TTATAATTCTTTAGAAAAGAAGG - Intronic
985379688 4:189379562-189379584 TTATAATCCTAAAGGGAAGAAGG + Intergenic
988046164 5:25957233-25957255 CTATATTCTTTGAAAGAAAATGG - Intergenic
989467710 5:41776083-41776105 CTATAACCCCTGATATAAGAAGG + Intronic
989511866 5:42297460-42297482 CTATAATACATTAGAAAAGAAGG + Intergenic
990081499 5:51920999-51921021 CTACAATCCTTGATACTAGATGG + Intergenic
994285423 5:97958992-97959014 CCATAATTTTTGAGAGGAGAAGG - Intergenic
996234835 5:121113596-121113618 CAATAAATCTGGAGAGAAGAAGG - Intergenic
997752255 5:136357603-136357625 CTATACTCCTTGGGTGGAGACGG + Intronic
998935351 5:147227625-147227647 CTATGATCCAGGAGAGAAGAGGG - Intergenic
1001076486 5:168631814-168631836 CTGTAATCCTTTGGAGGAGAAGG - Intergenic
1003272225 6:4617346-4617368 CTACAGTTCTTGAGAGAAGGAGG - Intergenic
1003578583 6:7319199-7319221 TTATAATCCTTATGAAAAGAGGG + Intronic
1004889318 6:20084025-20084047 CTATAATACTTAAGGGTAGAAGG - Intergenic
1005471938 6:26169834-26169856 CTGTAGTCCTTGAGCCAAGAGGG + Intronic
1007457199 6:41988366-41988388 CTATCAGGATTGAGAGAAGATGG - Intronic
1008011528 6:46472785-46472807 ATATAAGTCTTGAAAGAAGAAGG + Intronic
1008904482 6:56661438-56661460 CTGTAAAGCTTGAGGGAAGATGG - Intronic
1009425089 6:63505212-63505234 TTATAATGCTTGATAGAAAATGG - Intergenic
1010154901 6:72781151-72781173 CTGGTATCCTTGTGAGAAGAGGG + Intronic
1011135618 6:84096837-84096859 GGGTAATTCTTGAGAGAAGAAGG + Intergenic
1012578383 6:100831217-100831239 CTTTTATGCTTGAGAGAAAAAGG + Intronic
1015859953 6:137665492-137665514 CAGTAATCCTTCAAAGAAGAAGG + Intergenic
1016053813 6:139557563-139557585 ATATAATCCTTTATAAAAGATGG - Intergenic
1016146532 6:140683658-140683680 ATAAAAGCCTTGAGAAAAGAGGG + Intergenic
1020217618 7:6206651-6206673 TTTTAATCCTTAACAGAAGAAGG + Intronic
1020929619 7:14376387-14376409 CTATAATTTCTGAGACAAGAAGG - Intronic
1023611758 7:41978712-41978734 CCATATTCATGGAGAGAAGAAGG - Exonic
1027262945 7:76478051-76478073 GTATAGTGCTTGAGAGACGAGGG - Intronic
1027288540 7:76676386-76676408 CTATAATACTTAAGTGAACATGG - Intergenic
1027314329 7:76976152-76976174 GTATAGTGCTTGAGAGACGAGGG - Intergenic
1027573750 7:79905806-79905828 GTTTAATCTTAGAGAGAAGAGGG - Intergenic
1028013494 7:85678870-85678892 CTGTGATCCTTTGGAGAAGAAGG + Intergenic
1028077921 7:86537525-86537547 CTATAAGCCATCAGAGAAGTTGG - Intergenic
1028722231 7:94046749-94046771 CTACAATCCTTAAGAGAAAGGGG + Intergenic
1028734228 7:94189286-94189308 CTAAAATCCTTGAGAAATGAAGG - Intergenic
1029046511 7:97635082-97635104 CTATACTCTTTGAGAAGAGAAGG + Intergenic
1031282885 7:119826952-119826974 ATATAATCATTGTAAGAAGAGGG - Intergenic
1031342618 7:120622624-120622646 CTTTAAAGCCTGAGAGAAGATGG - Intronic
1032198017 7:129800407-129800429 CTATAATCCTGGGCAGCAGAGGG - Intergenic
1033452206 7:141472018-141472040 ACATAAGCCATGAGAGAAGAGGG + Exonic
1033765937 7:144490400-144490422 CTAAACTCCTTGTAAGAAGACGG + Intronic
1033776316 7:144615394-144615416 CTAAAAACCTTGAAAAAAGATGG + Intronic
1035491279 7:159280991-159281013 CTACGATCCTCAAGAGAAGAGGG - Intergenic
1036722714 8:11192065-11192087 CTATAATCCTTGGGAGGACAAGG + Intronic
1038243959 8:25836668-25836690 GTATAATACTTGAGAAAAGCAGG - Intergenic
1039861390 8:41461549-41461571 CTATAATCCTTGGGAGATCAAGG + Intergenic
1042149941 8:65771014-65771036 TTATAAGCCTTAAGAGAATAAGG + Intronic
1042977866 8:74490837-74490859 ATTTAATACTTCAGAGAAGAAGG + Intergenic
1043225977 8:77730629-77730651 CTATAATTACTGAGAGGAGATGG - Intergenic
1043339011 8:79214773-79214795 CTATATACATGGAGAGAAGATGG - Intergenic
1046089622 8:109485574-109485596 CTATAATTGTTGAGGAAAGAAGG + Intronic
1047023365 8:120801030-120801052 CTAATATCCTTGGCAGAAGAGGG + Intronic
1047572339 8:126113074-126113096 CTATAACCCTGGTGAGAACAGGG + Intergenic
1048083713 8:131155888-131155910 CTATAATCCCTGAGAGGAGGTGG - Intergenic
1054174090 9:61863105-61863127 CTTTAAGCCTTGATAGGAGACGG + Intergenic
1054663447 9:67717676-67717698 CTTTAAGCCTTGATAGGAGACGG - Intergenic
1056502241 9:87221438-87221460 CTAGAATCTTTGAGAGAGGCAGG - Intergenic
1186615393 X:11180993-11181015 CTATAAGCCTTGACAGAAGTGGG + Intronic
1187494030 X:19778623-19778645 CTACAATCCTTGTGAAAAGTGGG + Intronic
1187548814 X:20280808-20280830 CTAGAATCCTGGAGAGATGAGGG + Intergenic
1189241307 X:39526649-39526671 CTGGGATCCTTGAGAGATGAGGG + Intergenic
1192226887 X:69235043-69235065 CTGTAAGGATTGAGAGAAGAAGG + Intergenic
1196645453 X:118112844-118112866 CTTTATTCCTTGAGAGATTAGGG - Intronic
1199067242 X:143434013-143434035 CTATAATTCTAGAAATAAGAGGG - Intergenic
1201226904 Y:11827242-11827264 CAAGAATCCTTTAGAGAAAAGGG + Intergenic