ID: 904252734

View in Genome Browser
Species Human (GRCh38)
Location 1:29236591-29236613
Sequence GGCGCGGGGGACGCCGCCCC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 335
Summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 295}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904252734_904252741 -9 Left 904252734 1:29236591-29236613 CCGGGGGCGGCGTCCCCCGCGCC 0: 1
1: 0
2: 2
3: 37
4: 295
Right 904252741 1:29236605-29236627 CCCCGCGCCGGGCCCCGGGACGG 0: 1
1: 0
2: 5
3: 39
4: 411
904252734_904252751 24 Left 904252734 1:29236591-29236613 CCGGGGGCGGCGTCCCCCGCGCC 0: 1
1: 0
2: 2
3: 37
4: 295
Right 904252751 1:29236638-29236660 TCCAACCATGGCCCGTGCCCAGG 0: 1
1: 0
2: 0
3: 10
4: 133
904252734_904252750 12 Left 904252734 1:29236591-29236613 CCGGGGGCGGCGTCCCCCGCGCC 0: 1
1: 0
2: 2
3: 37
4: 295
Right 904252750 1:29236626-29236648 GGGCGGCGACGCTCCAACCATGG 0: 1
1: 0
2: 0
3: 4
4: 34
904252734_904252745 -5 Left 904252734 1:29236591-29236613 CCGGGGGCGGCGTCCCCCGCGCC 0: 1
1: 0
2: 2
3: 37
4: 295
Right 904252745 1:29236609-29236631 GCGCCGGGCCCCGGGACGGGCGG 0: 1
1: 1
2: 2
3: 48
4: 379
904252734_904252743 -8 Left 904252734 1:29236591-29236613 CCGGGGGCGGCGTCCCCCGCGCC 0: 1
1: 0
2: 2
3: 37
4: 295
Right 904252743 1:29236606-29236628 CCCGCGCCGGGCCCCGGGACGGG 0: 1
1: 0
2: 10
3: 31
4: 384

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904252734 Original CRISPR GGCGCGGGGGACGCCGCCCC CGG (reversed) Exonic
900233501 1:1574785-1574807 GGCGCGGCGTTGGCCGCCCCCGG - Exonic
900449990 1:2701161-2701183 GGGGCTGTGGGCGCCGCCCCAGG - Intronic
900453477 1:2762272-2762294 GGGGCTGTGGGCGCCGCCCCAGG - Intronic
900454190 1:2765857-2765879 GGGGCTGTGGGCGCCGCCCCAGG - Intronic
900455669 1:2773279-2773301 GGGGCTGTGGGCGCCGCCCCAGG - Intronic
900458659 1:2789783-2789805 GGAGCAGGGGGCGCCGCACCCGG - Intronic
900460613 1:2800749-2800771 GGCGCTGGGGGAGCTGCCCCTGG - Intronic
900633725 1:3651949-3651971 GGGGTGAGGGGCGCCGCCCCAGG - Intronic
900786773 1:4654665-4654687 GGCGCGGGCGGCGGGGCCCCGGG + Intergenic
901007611 1:6179566-6179588 AGCGCGGGGTGCGCCGCTCCGGG + Intronic
901045442 1:6393199-6393221 GGCGCGCCGGTCACCGCCCCAGG - Intronic
901686443 1:10946139-10946161 GGCGTGGGGGCCGCCGTCCCAGG + Intergenic
902916781 1:19644395-19644417 GGTGCGGGGGTCGCGGGCCCGGG - Intronic
903155625 1:21440491-21440513 AGCGCGGGGAACTCAGCCCCCGG - Intronic
903349762 1:22710746-22710768 GGCGCGGGGGGAGCCTCGCCAGG - Intergenic
904252734 1:29236591-29236613 GGCGCGGGGGACGCCGCCCCCGG - Exonic
905137043 1:35808098-35808120 GGCGCGGGGTGCGCGGACCCAGG - Intergenic
905684879 1:39901265-39901287 GGCGCAGGGGACCCGGCCCCCGG - Exonic
907278078 1:53327919-53327941 GGCGCGGCGGCCGGAGCCCCGGG - Exonic
910935093 1:92480839-92480861 GGCGCGGGGGCCGGGGCGCCAGG - Exonic
911208699 1:95117784-95117806 GGCGCGCGGGAGGCGGCCCGGGG + Intronic
911208732 1:95117898-95117920 GGCGCGGGGGCCGCGGGCCCCGG - Intronic
915246465 1:154559045-154559067 GGGGCGGGGGAAGCGGCGCCCGG - Intergenic
916588287 1:166166588-166166610 GGGGCGGGGGGCTCCGGCCCGGG - Exonic
917817674 1:178726053-178726075 GGGGCAGGGGCCGCAGCCCCAGG + Intronic
918348993 1:183635175-183635197 GGCGCTGGGGAAGGCGGCCCCGG - Intronic
919923805 1:202181850-202181872 GGCACGTGGGAGGCAGCCCCAGG - Intergenic
920237313 1:204516631-204516653 GGCGTGGGGAAGGCCGCGCCAGG + Intronic
920704839 1:208243551-208243573 GGCGCGGGAGAAGCCGCCACGGG + Intronic
921190049 1:212700329-212700351 GGCGCGGGGGTCACAGTCCCGGG + Intergenic
922619706 1:226982157-226982179 GGCGCGGGGGCTGCTGCCCCGGG + Intronic
922851306 1:228735822-228735844 GACGCGGGGGACGCGGGCCTGGG + Exonic
1062932703 10:1363379-1363401 GACTCGCGGGAGGCCGCCCCGGG - Exonic
1062932812 10:1363817-1363839 CGCGCCGGGCGCGCCGCCCCGGG + Exonic
1064028803 10:11869990-11870012 GCCGCGGGGGACGCCGGCGAGGG + Exonic
1065020097 10:21496198-21496220 GGCGCGGGGGACCTCTTCCCCGG - Intronic
1067711576 10:48655268-48655290 GGGGCGGGGGACGCTGCATCAGG + Intronic
1073057209 10:100710347-100710369 GGAGCGCGGGACGCGGCGCCCGG - Intergenic
1073207382 10:101776190-101776212 GGGGCGGGGGGCGCCGCACCGGG + Intronic
1076176593 10:128372969-128372991 GGCCCAGGGGACGCTGCCACTGG + Intergenic
1077038674 11:507627-507649 GGGGCGCGGGGCGCGGCCCCCGG + Intergenic
1077107897 11:849826-849848 GGCGCGGGGGCCGCAGCGCGCGG + Intronic
1077962483 11:7089705-7089727 GGCGCGGGGGCAGCGGCTCCCGG - Exonic
1078594279 11:12673867-12673889 AGCGCGGTGGACGCCGTCTCCGG - Intergenic
1080551380 11:33376326-33376348 GGCCCGGGGGAGGGGGCCCCGGG + Intergenic
1080595797 11:33773885-33773907 GGCGCTGGGGAAGTCGCGCCAGG + Intronic
1082086233 11:48052413-48052435 GGAGCGGGTGAGGCCACCCCTGG - Intronic
1082811862 11:57483161-57483183 GGTGCGGGGGGCGGCGACCCGGG - Intergenic
1083995078 11:66267672-66267694 GGCACGGCCGACCCCGCCCCGGG + Exonic
1084046070 11:66568375-66568397 GGCCTGGGGGCCGCCGTCCCCGG - Exonic
1085474928 11:76783577-76783599 GGAGTGGGGAACGCCGACCCAGG + Intronic
1087014607 11:93543198-93543220 GGCGCGGGGCACGGGGCACCGGG - Intronic
1089814196 11:121158004-121158026 GGTGCGGAAGACGCCGCCGCCGG - Exonic
1090190292 11:124762386-124762408 CGCGCGGGGTCCGCCGCCCGGGG + Intergenic
1090636654 11:128694154-128694176 GGCGCCAGGGAGGCCGCGCCGGG + Exonic
1094564979 12:31590999-31591021 GGCGCGGGGGAAGCGGCCGCGGG + Exonic
1096622687 12:52874335-52874357 GGCGCGGCCGGCGCCGCCCTGGG - Intergenic
1097793981 12:63843698-63843720 GGTGCCGGGGGCGCCGCCCACGG + Intergenic
1100391460 12:94148949-94148971 GGGGCTGGGGGGGCCGCCCCCGG - Exonic
1100565635 12:95790927-95790949 GGCGCGGGGGACCCCCCCCCCGG - Intronic
1100830940 12:98516099-98516121 GGCTCTGGGGCCGCCGCCGCGGG + Exonic
1103020601 12:117530981-117531003 GGTGCCGGAGACGCCGACCCGGG - Exonic
1103363866 12:120368924-120368946 GGCGCAGGGGGCGCGGGCCCGGG + Intronic
1103407775 12:120687590-120687612 GGCTCGGGGCCCGCAGCCCCCGG - Intronic
1103568714 12:121830306-121830328 GGCGCGGGGGGCCGGGCCCCGGG - Exonic
1103779409 12:123389144-123389166 GGCGCGGGGCGCGCCGCCATGGG + Intronic
1104008868 12:124914973-124914995 GGCGCGGAGGCCGCTGCACCGGG + Exonic
1104602362 12:130162336-130162358 GGCGGGGAGGAGGCTGCCCCGGG + Intergenic
1104769825 12:131354439-131354461 GGCGCTGGGGACACAGCCCCAGG + Intergenic
1105207066 13:18233814-18233836 GCCGACGGGGACGCCGCCCAGGG + Intergenic
1105207201 13:18234455-18234477 GCCGACGGGGACGCCGCCCAGGG + Intergenic
1105207210 13:18234482-18234504 GCCGACGGGGACGCCGCCCAGGG + Intergenic
1105207219 13:18234509-18234531 GCCGACGGGGACGCCGCCCAGGG + Intergenic
1105344658 13:19561396-19561418 GGGGCGGGGCGCGGCGCCCCGGG - Intergenic
1105535380 13:21260171-21260193 GGGGCGGGGCGCGGCGCCCCGGG + Intergenic
1105964469 13:25372130-25372152 GGCGCAGGGGCCGCCGCCCGAGG - Exonic
1106087626 13:26557692-26557714 GGCGCGAGCGACGCCGCCTCCGG - Intronic
1108389894 13:49937011-49937033 GGCGCGTGGGAGGCCGCCCTGGG + Intergenic
1110318426 13:74135033-74135055 CGCGCGGGGGGCACCGCCCGCGG - Intergenic
1110573034 13:77026833-77026855 TGTGTGGGGGAAGCCGCCCCCGG - Exonic
1112494768 13:99896058-99896080 GGCGCGGGCGACGAGGCCTCGGG - Exonic
1113082949 13:106535994-106536016 GCCGAGGGGGAAGGCGCCCCCGG - Intergenic
1113897448 13:113775382-113775404 GGTGCGGGGCCCGACGCCCCAGG - Intronic
1114664266 14:24368906-24368928 CGAGCGGCGGCCGCCGCCCCCGG - Intronic
1116950130 14:50872025-50872047 GGCGGGGGAGACGCGGCCCGAGG - Intronic
1118350943 14:64972177-64972199 GGCGAGGAGGACGCCGGGCCCGG + Intronic
1118610173 14:67533466-67533488 CGCGCGGGGGACGGCCCCTCGGG + Intronic
1122249653 14:100428904-100428926 GGCTCGGGGGATGACGCCTCTGG - Intronic
1122961536 14:105096174-105096196 GGCCCAGGGGAGGCCTCCCCTGG - Intergenic
1122975272 14:105168384-105168406 GCCGCCGGGGAAGGCGCCCCCGG + Exonic
1124014214 15:25862591-25862613 GGCGCAGGGCAGGGCGCCCCGGG - Intronic
1124696751 15:31870321-31870343 GACGCGGGGGGCGCGGGCCCCGG - Intronic
1125468258 15:39976584-39976606 GGGACCGGGGACGCCGCCCCCGG + Exonic
1126626078 15:50686821-50686843 GGCGCGTGCGTCGCCGCCCGCGG + Intergenic
1126852621 15:52806227-52806249 GGCGCGGGGACTGCGGCCCCAGG - Intergenic
1127753456 15:62068073-62068095 GCCGCGGGGGTCGCCGGGCCCGG - Exonic
1129387077 15:75202125-75202147 GGGGCGGGTGGCGCTGCCCCAGG + Intronic
1130662358 15:85840681-85840703 GGCGCGGGCCACCCAGCCCCTGG + Intergenic
1131948440 15:97653099-97653121 GGCGCGGTGGCAGCAGCCCCCGG + Intergenic
1132419477 15:101652824-101652846 GGCCCGAGGGACCCCTCCCCTGG + Intergenic
1132654585 16:1036528-1036550 GGCGTGGGGTACACCGCCCGGGG + Intergenic
1132841160 16:1979108-1979130 GGCGCCGTGGGCGCCGCTCCAGG + Exonic
1132847997 16:2009495-2009517 GGCGCCGGGGGCGCGGCCCGGGG - Intronic
1133052301 16:3124154-3124176 GGCGCTGAGGCCGACGCCCCCGG - Intergenic
1133771302 16:8868582-8868604 GGCGCGGGGGGCGTCGCACGCGG - Intronic
1135607501 16:23836606-23836628 GGCTCCCGCGACGCCGCCCCTGG - Intronic
1137426374 16:48384838-48384860 GGCGCGCCGGGCGCCACCCCCGG + Intronic
1139466238 16:67155539-67155561 GGCGCGGAGGAAGCGGCCACAGG + Exonic
1139534293 16:67562232-67562254 TGGGCGGAGGCCGCCGCCCCTGG - Intergenic
1139615441 16:68085747-68085769 GGCGCCGGCGCCGCCGCCCCCGG + Exonic
1139848451 16:69936463-69936485 GGCGCCGGGGGCTCCGCTCCAGG + Intronic
1141231437 16:82170730-82170752 AGCGCGGCGGGGGCCGCCCCAGG + Intergenic
1141946620 16:87315198-87315220 GGAGCTGGGGACCCTGCCCCCGG - Intronic
1142480492 17:215672-215694 CGCCAGGGGGACCCCGCCCCGGG - Exonic
1142547399 17:714540-714562 GGCGCTGGGGAGGCCGCGGCGGG - Intronic
1142849607 17:2697955-2697977 GGCGCGGGGGAAGCCGGCGCGGG + Exonic
1143016242 17:3892631-3892653 GGCGCGGGGGACAGTGCACCGGG + Intronic
1143030431 17:3964362-3964384 GGCGCGGGGGACTCGGGCCCGGG + Intronic
1143155433 17:4833469-4833491 GGCGCGGTGGAGTCCGCCCCCGG + Exonic
1143544772 17:7589538-7589560 GGCCCCCGGGACGCTGCCCCTGG - Exonic
1145941222 17:28744293-28744315 GGGGCGGGGGGCGCCGCCTGGGG + Intronic
1146058604 17:29593234-29593256 GGCCCCGGGGACGCCGCCGCAGG - Intronic
1146058607 17:29593249-29593271 GGCGCACGGGACGCGGGCCCCGG - Intronic
1146723907 17:35142218-35142240 GGGGCGGGGGGCGTCGCCGCGGG - Intronic
1147150235 17:38510094-38510116 GGCGCTGTGGCCCCCGCCCCAGG - Exonic
1147168604 17:38605714-38605736 GGCGCGGGGGGCGGGGGCCCCGG + Exonic
1147315395 17:39617899-39617921 GGCCGCGGGGAGGCCGCCCCGGG - Intergenic
1147987512 17:44315033-44315055 GGGGCGGGGGACGGGGCCTCGGG + Intronic
1148337492 17:46851474-46851496 GGCGGGGGGCTCGCCGCCCGGGG + Intronic
1149512634 17:57256269-57256291 GGCGGAGGGGACCCCGCCTCCGG - Intronic
1149848701 17:60022272-60022294 GGAGCGTGGGACGCCCACCCAGG + Intergenic
1149861468 17:60124252-60124274 GGAGCGTGGGACGCCCACCCAGG - Intergenic
1152711036 17:81870744-81870766 GGCGCGGAGGCCCCAGCCCCTGG - Intronic
1152729235 17:81961554-81961576 GGGGCGGGGAACTCCGCCCGCGG + Intronic
1152743962 17:82030863-82030885 CGCGGGCGGGACGCAGCCCCTGG - Exonic
1154202469 18:12308620-12308642 GGCGCGGGTGGCGGCGTCCCGGG + Intronic
1158530529 18:58256184-58256206 TGCGCGGAGGAGGCTGCCCCGGG + Intronic
1158893574 18:61894254-61894276 GGAGCGGCGGCCGCCGGCCCGGG - Intergenic
1160500832 18:79400497-79400519 GGCGCGGGGGGCGCGGGGCCAGG + Intronic
1160631203 18:80247409-80247431 GGGCCTGGGGGCGCCGCCCCCGG - Exonic
1160659319 19:291018-291040 GGGGCGGGGGATGCTGGCCCCGG + Exonic
1160691149 19:461119-461141 GCCGCGGGGGGCTGCGCCCCTGG + Intergenic
1160738765 19:676505-676527 GGCTCGGGGAACCCCGCGCCCGG + Exonic
1160791493 19:925690-925712 GCCGCGGGAGGCCCCGCCCCCGG - Intergenic
1160853512 19:1205953-1205975 GGCGAGGGGGACGCGCCGCCCGG + Intronic
1160869247 19:1269516-1269538 GGCGGGGCGGACTCCACCCCGGG - Intronic
1160875763 19:1295555-1295577 GGCGCGGGGGACGACGGCGGGGG + Exonic
1160952739 19:1675467-1675489 GGCGCTGGGGACACCTCCTCGGG + Intergenic
1160991771 19:1863144-1863166 GGCGCCGGGGGCGCGGCCCGAGG + Exonic
1161027105 19:2041821-2041843 GGTGCGCGGGCCGCCGCACCTGG + Exonic
1161306758 19:3573074-3573096 GGCCCGGGGGAAACCGGCCCAGG + Intronic
1161337649 19:3722867-3722889 GGCACAGGGGACGGCGGCCCGGG + Intronic
1161374714 19:3933514-3933536 GCCCCGGGGGAGGCGGCCCCTGG - Exonic
1162021225 19:7869445-7869467 GGGGCGGGGGTCGCCGACTCGGG + Exonic
1162312379 19:9914655-9914677 GGCCCCGGGGACCCCGCTCCCGG + Intronic
1162772411 19:12957116-12957138 GGCGCGGGGGCGGCCGCGCCCGG + Exonic
1163598292 19:18233077-18233099 GGCGCCGGGGTTGCCGCCACAGG + Exonic
1163668217 19:18612917-18612939 GGCGCGGGGGACTCCAGCTCAGG - Exonic
1163729531 19:18941150-18941172 GGCGCGGAGGGCGCGGGCCCGGG - Intronic
1163749016 19:19064366-19064388 GGCGCCGGGGACAAGGCCCCAGG - Intronic
1165092183 19:33393178-33393200 GGCGTGGGGGAGGCCGTCCCGGG + Intronic
1165092197 19:33393212-33393234 GGCGTCGGGGAGGCCGTCCCGGG + Intronic
1165528812 19:36379282-36379304 TGCGCGGGGGCCGGAGCCCCGGG + Intergenic
1166543277 19:43619557-43619579 GGAGCGGGGGCCGCCGGCGCCGG - Exonic
1167040607 19:47020785-47020807 GGCGCGGGGGAGGCGGCGGCGGG + Intronic
1167040887 19:47021792-47021814 CGCGCTGGGGGCGCCGCCCTGGG + Exonic
1167843262 19:52139404-52139426 GGCGCGGGGGACGGTGTCTCAGG + Intronic
925713822 2:6767216-6767238 GGTGCTGGGGACGCTGGCCCAGG + Intergenic
925730736 2:6917979-6918001 GGCGCGGGACAGGGCGCCCCGGG + Intronic
929780135 2:44952193-44952215 GGCGTGGGGGACGCGGCCCCCGG + Intergenic
930177406 2:48314841-48314863 GGGGCGGGGAGCGCCGACCCTGG - Intronic
932288101 2:70553696-70553718 GGCGCAGGGGGCGCCGCAGCCGG + Intronic
932699902 2:73985210-73985232 GGCGCGGGGGGCCCGGCCCGGGG + Intergenic
934754559 2:96816344-96816366 GCCGCGGGGGAGGCCGCGCCGGG + Exonic
935265207 2:101387576-101387598 CGCGCGGGGGACCGCGCCCGGGG - Exonic
935645423 2:105329939-105329961 GGCGCTGAGGCCGCCGGCCCCGG + Exonic
936985737 2:118310224-118310246 GGCGCGCGGGCCGCCCCCGCCGG - Intergenic
937208462 2:120252384-120252406 GGCGATGGGGATGCCGCCCGGGG - Intronic
939191055 2:138917247-138917269 GGAGCGGGGGATGCAGCACCCGG + Intergenic
939275230 2:139990990-139991012 GGCTCGGCGGACCCCGCCCTGGG - Intergenic
940830156 2:158457334-158457356 GGCGCTGGGGACGCGGCAGCGGG - Intronic
942278743 2:174340984-174341006 GGGGCGGGGGACGCGGCCTGGGG + Intergenic
942279199 2:174343742-174343764 CGCGCGGGGGACTGCGCCCGAGG + Intergenic
946416817 2:219543930-219543952 GAGGCAGGGGACTCCGCCCCCGG - Exonic
948140611 2:235669947-235669969 GGCTGCGGGGACGGCGCCCCTGG - Intronic
948329792 2:237155884-237155906 AGCCCAGGGGACGCAGCCCCAGG + Intergenic
948823115 2:240560389-240560411 GGCGGGGAGGACGGCGCCCGGGG + Exonic
1168795835 20:609776-609798 GGCGGCGGGGACGGCGCCCTTGG + Exonic
1169074397 20:2752230-2752252 GCCGTCGGGGACGCCACCCCGGG + Exonic
1169143737 20:3239557-3239579 GACGCGGGGGAAGCCCTCCCGGG - Intergenic
1169214631 20:3786061-3786083 GGCGCGGGCCACGCCGCTGCAGG + Exonic
1169214728 20:3786511-3786533 GGCGCCGCCGCCGCCGCCCCGGG + Exonic
1169244543 20:4015391-4015413 AGCGCCGCGGCCGCCGCCCCCGG - Intronic
1170890002 20:20368538-20368560 GGCGCGGGGTGCGCAGCCTCGGG - Exonic
1170924677 20:20712337-20712359 GGCGCGGGGGTCGGGGCGCCGGG - Intronic
1172117945 20:32583235-32583257 GGCGCGGGGGGAGGCGCCTCCGG + Intronic
1172644447 20:36461284-36461306 GGCGCGCGGGCCGCCGCGTCCGG - Intronic
1172962081 20:38806457-38806479 GGCGCGGGGGACCCAGCCGCCGG - Intronic
1173210750 20:41029494-41029516 GGCGCGGGGGAGGCGGCCGGCGG - Intronic
1173633257 20:44532115-44532137 GGCGTCGGGGGCGCCGTCCCCGG - Intronic
1174231189 20:49046642-49046664 GGCCCTGGGGTCGCCGCACCTGG - Intronic
1175215319 20:57389380-57389402 GGCGCGGGCGAGGCGGGCCCGGG + Intergenic
1175394741 20:58650512-58650534 GGCGCGGGGGTCGCAGGGCCAGG + Intergenic
1175429575 20:58891873-58891895 CGGGCGGGGGGCGCCGGCCCCGG + Intronic
1175715421 20:61252128-61252150 GGCGCGGGGGGCGCGGGCGCGGG + Intergenic
1175866706 20:62182647-62182669 GGCGGTGGGGACGGCGCCCCGGG + Intergenic
1175962025 20:62642213-62642235 CGCGGTGGCGACGCCGCCCCAGG - Exonic
1175994166 20:62804953-62804975 GGCGCGAGGGACGCGGACGCAGG + Exonic
1176550278 21:8217880-8217902 GGGCCGGCGGACCCCGCCCCGGG - Intergenic
1176569206 21:8400918-8400940 GGGCCGGCGGACCCCGCCCCGGG - Intergenic
1176577120 21:8445150-8445172 GGGCCGGCGGACCCCGCCCCGGG - Intergenic
1178404003 21:32310113-32310135 GGCGTGGTGGAGGCAGCCCCTGG - Intronic
1178457724 21:32771423-32771445 GCCGCCGGGGAAGCCGCCCCCGG + Exonic
1178951487 21:36989780-36989802 GGCGCGGGGCACGCGGCCAGGGG + Intronic
1179581563 21:42347753-42347775 GTCCCGGGGGATGCTGCCCCAGG - Intronic
1180045309 21:45302449-45302471 GGCCCTGGGGACGCCACCACTGG + Intergenic
1180163507 21:46008526-46008548 AGCACGGGGGAGGCCACCCCCGG + Intergenic
1181168094 22:20993998-20994020 GGCGCGGGAGAGGCTGGCCCAGG + Exonic
1181458126 22:23070864-23070886 GGCGCCGGGGATGCCGCGCGGGG + Intronic
1182237128 22:28884218-28884240 GGCGGGCGGGACGCGGCCTCCGG + Intronic
1184114967 22:42417043-42417065 GGTGCGGGGGAGGCTGGCCCTGG - Intronic
1184342189 22:43892031-43892053 GGCGCAGGTGACGCAGCCCGGGG - Intergenic
1184729573 22:46365238-46365260 GGTGCTGTGGACGGCGCCCCTGG + Exonic
1184766997 22:46577236-46577258 GGCGAGGGGGGCGCCGCGGCGGG + Intronic
1185409451 22:50674466-50674488 GGCGCGGGGGACAGCGGCTCCGG - Intergenic
1203255173 22_KI270733v1_random:134218-134240 GGGCCGGCGGACCCCGCCCCGGG - Intergenic
1203263229 22_KI270733v1_random:179297-179319 GGGCCGGCGGACCCCGCCCCGGG - Intergenic
951640313 3:24829164-24829186 GGCGCGGCCGCCGCCGCCTCCGG + Intergenic
953099207 3:39809335-39809357 GGGGCGCGGGTCCCCGCCCCGGG + Intronic
954151819 3:48661743-48661765 GTCCCGGGGGACGCGGCCCGGGG + Exonic
954664752 3:52245858-52245880 GGCGCGGGGAGCGGCTCCCCAGG - Intronic
954735827 3:52705900-52705922 GGGACGGGGGACGCGGCTCCAGG + Exonic
956674986 3:71725162-71725184 GGCGCGGGGCCCGCCGCGCACGG - Intronic
961665884 3:128492906-128492928 GGCGCGGTGGGCGGCGCCCCCGG + Exonic
962818134 3:139020671-139020693 GGCGCTGTGGACGGCGCTCCTGG + Exonic
962820625 3:139044630-139044652 GGCGCTGCGGACGGCGCTCCTGG + Exonic
965310044 3:167116260-167116282 GGCGCCTGGGACCCCGTCCCTGG - Intergenic
965962053 3:174440900-174440922 GGCGCCGGGGCCGCCGCTCGGGG + Intronic
967858202 3:194134127-194134149 GGCACGGGGGCCGGCGACCCGGG + Intergenic
968286230 3:197510377-197510399 GGCACTGGGGACCCTGCCCCGGG + Exonic
968506741 4:974317-974339 GAAGCGGGGGACCCCACCCCGGG + Intronic
968659458 4:1793172-1793194 GGCGCAGGGCACGCCCCCTCGGG - Intergenic
968701377 4:2059653-2059675 GGCGCGGGGGGCGCGGCGGCCGG - Exonic
968775487 4:2537135-2537157 AGCGCGGGCGGCGCCGCCCCCGG + Intronic
968941882 4:3643258-3643280 GGGGCTGGGCAGGCCGCCCCAGG - Intergenic
969368642 4:6716351-6716373 GGCGCGGAGGACGGCGCGCCGGG + Exonic
969619019 4:8269728-8269750 GGCGCGGGACCCGCCGCCCGCGG + Intergenic
969671480 4:8592593-8592615 GGGGCGGGGCACTCCGCCCGGGG + Intronic
970499154 4:16659315-16659337 GGCTCCGGGGATGCCGACCCAGG - Intronic
979455641 4:120922845-120922867 GGCGCGGGGGGCGCGGGCCTGGG + Exonic
982033612 4:151325212-151325234 GGCGCGGGGGACGGGGCGGCGGG - Intronic
982288735 4:153759755-153759777 GGCGTGGGGGACGCCAGGCCGGG - Intronic
983238709 4:165207708-165207730 GCCGCGGGGGCCGCCGCCGCAGG + Intronic
985749674 5:1667163-1667185 AGGGCGGGAGACGCAGCCCCGGG - Intergenic
985782445 5:1878300-1878322 GGCGCGGAGGACACAGCCGCAGG + Exonic
986297058 5:6448645-6448667 GGCGCGGGCGACGCCAGCCCGGG + Exonic
992528885 5:77637152-77637174 GGCGTGGGGGGCTCCGACCCCGG - Exonic
993654260 5:90558648-90558670 GGAGCGGGGGTGGCCGCCCCGGG - Intronic
996404291 5:123090635-123090657 GGCGCCGGCGCCGGCGCCCCGGG - Intronic
997235988 5:132272157-132272179 GGCGCGCGTGAAGCCGCCCGAGG + Exonic
998080870 5:139274069-139274091 GCCGAGGGGAACCCCGCCCCGGG - Exonic
1001945318 5:175773320-175773342 GGCGCGGGGGAAGCGGGGCCGGG - Intergenic
1002927783 6:1614771-1614793 GGGGCGGGGGGCGCCGAGCCGGG + Intergenic
1003552274 6:7109281-7109303 GGCGCGGGGGGCCCGGCCCAAGG - Intronic
1004720424 6:18264144-18264166 AGCGGGAGGGAAGCCGCCCCTGG - Intronic
1005942506 6:30571375-30571397 GGCGCGGCCAACCCCGCCCCCGG - Exonic
1005987654 6:30884475-30884497 GGCGAGGGGGAGGCGGCGCCTGG + Intronic
1006491485 6:34392184-34392206 GGCGCGAGGGGCGCGGCCGCCGG - Intronic
1006599022 6:35213731-35213753 GGCGCGGTGGCCCCCTCCCCAGG - Intergenic
1006641108 6:35490294-35490316 GGGGCGGGGCAGGCGGCCCCTGG + Intronic
1007327561 6:41073551-41073573 GGAGCGGGGGGCGCGGGCCCCGG - Intronic
1007383529 6:41505180-41505202 GGCGCGAGGGACGCGGCATCTGG + Intergenic
1007491739 6:42228506-42228528 GGCGCCGGGGCTGCTGCCCCTGG - Exonic
1014079515 6:117270777-117270799 GGCGCCGAGGGCGCCGCCCAGGG - Exonic
1015440437 6:133241266-133241288 GGCGGGGGCGACGTCGCCACCGG - Intronic
1016034860 6:139374768-139374790 GGCGGCGGGGACGCGGCTCCGGG - Intergenic
1016433072 6:144008162-144008184 GGCGCGCGGGGCGCTTCCCCGGG - Intronic
1016936288 6:149451249-149451271 GGCGCGGGGGTCCCCGGACCTGG - Exonic
1019197248 6:170289935-170289957 GGCGCTGGGGTCGTCGCCCCCGG + Intronic
1019212177 6:170415475-170415497 GGGGCGTGGGACGCAGCCCCAGG - Intergenic
1020099948 7:5389052-5389074 GGCGCGGGGGCCCCCGGTCCTGG + Exonic
1022207575 7:28179714-28179736 GGGGCCGGGGACGCGGGCCCGGG - Intronic
1022427930 7:30285475-30285497 GGCGCTCGGGCCGCCGCCGCGGG + Exonic
1022698007 7:32728685-32728707 GGCCGGGGGGCCGCCGCCGCGGG + Intergenic
1023638419 7:42236481-42236503 GCCGCGGGGGCCGCCGCCGCTGG - Intronic
1023937268 7:44748878-44748900 GGCGCGGGTGGCGGCGGCCCCGG + Intronic
1026091173 7:67302240-67302262 GGCGCTGAGGACGCCGCTCCGGG + Intergenic
1026745257 7:73006292-73006314 GGCGCTGAGGATGCCGCTCCGGG - Intergenic
1026797822 7:73377417-73377439 GGCTCGGAGGCCGCCGCCTCCGG - Intergenic
1027031365 7:74890965-74890987 GGCGCTGAGGATGCCGCTCCGGG - Intergenic
1027098485 7:75358804-75358826 GGCGCTGAGGATGCCGCTCCGGG + Intergenic
1029399594 7:100335697-100335719 GGCGCTGAGGATGCCGCTCCGGG + Intergenic
1029640762 7:101817442-101817464 GGCGCCGGGGACTCCGCGCGCGG - Intronic
1029896489 7:103989695-103989717 GGCGGGGGGGACGCGGCGCCCGG - Intergenic
1031927422 7:127651860-127651882 GGCGCGGCTGGCTCCGCCCCTGG + Intergenic
1034306291 7:150047692-150047714 GGCGCAGGCGGCGGCGCCCCGGG - Intergenic
1034800556 7:154052961-154052983 GGCGCAGGCGGCGGCGCCCCGGG + Intronic
1035160965 7:156949753-156949775 AGCGCGGGAGAGGCCGGCCCGGG + Exonic
1035277720 7:157758047-157758069 GGTGCGGGGGACGCGGTCTCGGG + Intronic
1035724620 8:1816894-1816916 GGCCCACGGGACGCCGCCCACGG + Intergenic
1035751723 8:2001499-2001521 GGTTCGGGGGACGGCGCCGCGGG - Exonic
1037825217 8:22156567-22156589 GGGGCGGGGGCCGCGGCCGCCGG - Exonic
1041689787 8:60678310-60678332 GGAGCCGGGTGCGCCGCCCCGGG - Intergenic
1043463907 8:80486741-80486763 AGCGCGCGGGACGCGGCCCGAGG + Exonic
1045063585 8:98427381-98427403 GGCGCAGCGCACGCGGCCCCGGG + Intronic
1045443539 8:102238655-102238677 AGCGCCGGGGAGGCCGTCCCCGG - Intronic
1047024608 8:120811964-120811986 GGCACGCGGGACTCCGCTCCGGG + Exonic
1048553984 8:135457632-135457654 AGCGCGGGGGCCGCCGGCGCTGG + Exonic
1049726102 8:144147283-144147305 GGCGCGTGGGAAGCCGCCGCAGG + Intergenic
1049807811 8:144548764-144548786 GGCCCTGGTAACGCCGCCCCCGG - Intronic
1053381179 9:37650809-37650831 GGCGCGCGGGGCTCCTCCCCCGG + Intronic
1058991301 9:110256815-110256837 GGCCCGGCGGACGCATCCCCAGG - Intergenic
1059061519 9:111038651-111038673 GGCGCTGGGGGCGCCACACCAGG - Intergenic
1059314142 9:113410087-113410109 GGCGCGGGAGATGGCGCTCCGGG + Exonic
1060283477 9:122228850-122228872 GGCGCCGGCCCCGCCGCCCCGGG + Intronic
1061052336 9:128204019-128204041 GGTGTGGGGGACGCTGCCCCCGG - Intronic
1061128317 9:128690084-128690106 GGTGCCGGGGGCGCCGCCGCGGG - Intronic
1061222120 9:129258428-129258450 GGCCCGGGTGACCCCGACCCCGG - Intergenic
1061540778 9:131277086-131277108 GGGGCGGGGGCCACCGCCTCCGG - Intergenic
1061592038 9:131603876-131603898 GGTGCGGGGGAAGCGGCCTCGGG + Intronic
1061925110 9:133802391-133802413 GGGGAGGGGGAGGCTGCCCCTGG - Intronic
1062274043 9:135722267-135722289 GGGACGGGGGATGCAGCCCCAGG - Intronic
1062570754 9:137184095-137184117 GGCACGGGGGACGCCGCAGTGGG + Intronic
1062596472 9:137302083-137302105 GGGCCGGGGGTCGCCGCCGCGGG + Exonic
1203471571 Un_GL000220v1:117355-117377 GGGCCGGCGGACCCCGCCCCGGG - Intergenic
1203479392 Un_GL000220v1:161327-161349 GGGCCGGCGGACCCCGCCCCGGG - Intergenic
1186496289 X:10015044-10015066 GGCGCGGAGGACGCGGGGCCGGG + Intergenic
1187508594 X:19897499-19897521 CACGCTGGGGACCCCGCCCCAGG + Intergenic
1189915511 X:45851642-45851664 GGCGCGGCGCCCGCAGCCCCCGG - Intergenic
1196734963 X:118975137-118975159 GGCGCTGGCGCCGGCGCCCCCGG + Exonic
1197754302 X:129983699-129983721 GGGGCGGGGGCCGCCGGGCCGGG + Intronic
1197774466 X:130110536-130110558 AGGGCGGGGGACGGCGGCCCCGG - Intronic
1199736898 X:150693621-150693643 GCCGCGGGGGGCGCCACCGCCGG + Exonic
1200100516 X:153687598-153687620 GGCCCGGGGGACGTCTTCCCAGG + Intronic
1200150698 X:153950035-153950057 GGTGCAGGGGACGCCACCCCAGG - Intronic