ID: 904253015

View in Genome Browser
Species Human (GRCh38)
Location 1:29237894-29237916
Sequence CGGGCTGGGCTGCGACGTCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 153}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904253005_904253015 3 Left 904253005 1:29237868-29237890 CCGGGCGGCCGGGCGGGGGCTGT 0: 1
1: 0
2: 2
3: 44
4: 389
Right 904253015 1:29237894-29237916 CGGGCTGGGCTGCGACGTCCGGG 0: 1
1: 0
2: 0
3: 11
4: 153
904252996_904253015 16 Left 904252996 1:29237855-29237877 CCGCGGCTGCGCCCCGGGCGGCC 0: 1
1: 0
2: 4
3: 33
4: 341
Right 904253015 1:29237894-29237916 CGGGCTGGGCTGCGACGTCCGGG 0: 1
1: 0
2: 0
3: 11
4: 153
904252993_904253015 21 Left 904252993 1:29237850-29237872 CCGGGCCGCGGCTGCGCCCCGGG 0: 1
1: 0
2: 5
3: 54
4: 430
Right 904253015 1:29237894-29237916 CGGGCTGGGCTGCGACGTCCGGG 0: 1
1: 0
2: 0
3: 11
4: 153
904253004_904253015 4 Left 904253004 1:29237867-29237889 CCCGGGCGGCCGGGCGGGGGCTG 0: 1
1: 0
2: 13
3: 126
4: 672
Right 904253015 1:29237894-29237916 CGGGCTGGGCTGCGACGTCCGGG 0: 1
1: 0
2: 0
3: 11
4: 153
904253008_904253015 -5 Left 904253008 1:29237876-29237898 CCGGGCGGGGGCTGTCCCCGGGC 0: 1
1: 0
2: 7
3: 56
4: 982
Right 904253015 1:29237894-29237916 CGGGCTGGGCTGCGACGTCCGGG 0: 1
1: 0
2: 0
3: 11
4: 153
904253003_904253015 5 Left 904253003 1:29237866-29237888 CCCCGGGCGGCCGGGCGGGGGCT 0: 1
1: 0
2: 9
3: 51
4: 381
Right 904253015 1:29237894-29237916 CGGGCTGGGCTGCGACGTCCGGG 0: 1
1: 0
2: 0
3: 11
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904253015 Original CRISPR CGGGCTGGGCTGCGACGTCC GGG Intronic
900299362 1:1969287-1969309 AGGGCTGGGCTGGGAAGGCCTGG - Intronic
900627738 1:3617020-3617042 AGGCCTGGGCTGCGGCGTGCAGG + Intergenic
903140820 1:21338199-21338221 CAGGCTGGGCTGGGGTGTCCAGG - Intronic
904253015 1:29237894-29237916 CGGGCTGGGCTGCGACGTCCGGG + Intronic
904499919 1:30907997-30908019 CGGGCTGGGGGTCGCCGTCCCGG - Intronic
904614532 1:31742794-31742816 CGGGCTGGGCAGCGCCCTCATGG + Intronic
905912085 1:41662161-41662183 TGGGCTGGGCTGCGCCGCGCTGG + Intronic
906290558 1:44617062-44617084 TGGGCTGGGCCGCGACGTGAGGG - Intronic
908780629 1:67686263-67686285 CGGGCCGGGCGGCGACCCCCAGG + Intronic
910771492 1:90836172-90836194 CTGGTTGGGCCGCGACCTCCGGG - Intergenic
915107817 1:153545317-153545339 CGAGCTGGGCTGCTGCGTGCAGG + Intronic
922774337 1:228207944-228207966 GGGGCTGGGCTGGGCCGGCCTGG + Intronic
924679893 1:246220711-246220733 GGGGCTGGGCTGCCAGTTCCGGG + Intronic
1063008479 10:1997589-1997611 CAGGCTGGGCTGCAGAGTCCAGG + Intergenic
1069818611 10:71213996-71214018 CTGGCTGGGCTGCGTCTTCTCGG + Intronic
1075647762 10:124107828-124107850 CGGGCTGGGCTGGGCCGGGCTGG - Intergenic
1076719003 10:132384776-132384798 CGGGCTGAGCTGAGACGTGCAGG + Intergenic
1076747267 10:132520543-132520565 CAGGCTGGGCTGCGGAGGCCTGG + Intergenic
1077311363 11:1890338-1890360 CGTGCGGGGCTGTGACCTCCTGG + Exonic
1078431189 11:11290024-11290046 CTGGCTGGGCTGTGGCCTCCAGG + Intronic
1079195327 11:18322035-18322057 GGAGCTGGGCTGGGACCTCCGGG - Exonic
1084151334 11:67289264-67289286 CGGGCGGGGCTGCGCCGGGCCGG - Intronic
1084378961 11:68798526-68798548 CTGGCTGGGCTTCCACGTACTGG - Intronic
1084762044 11:71280115-71280137 CTGGCTGGGCAGCCACATCCTGG + Intergenic
1087131385 11:94672052-94672074 AGGGCTGGGCTGCCAGTTCCTGG + Intergenic
1087182940 11:95157378-95157400 CGGGCTGGGCTGCCGGCTCCGGG + Intergenic
1088172857 11:107017906-107017928 CGGGCTGGGCTCCAGCGGCCCGG + Exonic
1090377841 11:126303990-126304012 CTGGCTGGGCTGCTAACTCCCGG - Exonic
1093525718 12:20102130-20102152 GGGGCTGGGCTGCCAGCTCCAGG - Intergenic
1096099074 12:48957777-48957799 CGGGCTGGGCTGCGGGGCCCAGG + Intergenic
1096466394 12:51849216-51849238 CGGGCTGGGCTGCTCAGTCCCGG - Intergenic
1097120066 12:56724827-56724849 CTGGCTGGGCTGGGGCCTCCTGG + Intronic
1097223240 12:57462330-57462352 CGGGCTGGGTCGCGGGGTCCGGG + Intronic
1103933145 12:124461065-124461087 CAGGCTGGGCTGCCACCTTCCGG + Intronic
1105291505 13:19056447-19056469 CGGGCTGGGCTTGGCTGTCCCGG - Intergenic
1106497722 13:30296344-30296366 CAAGCTGGGCTGCGAAGTGCTGG + Intronic
1107841137 13:44459039-44459061 GGGGCTGGGCTGCCAGTTCCGGG + Intronic
1113790106 13:113023776-113023798 GGGGCTGGGCTGGAAGGTCCTGG + Intronic
1113909065 13:113833358-113833380 GGGTCTGGGCTGCGACGTTCAGG - Intronic
1113945636 13:114042649-114042671 GGGGCTGGGCTGCGCTGTCCTGG - Intronic
1113973932 13:114212030-114212052 GGGGCAGGGCTGAGAAGTCCCGG + Intergenic
1119654566 14:76407948-76407970 AGGGCTGGGCTGCCAGGACCCGG - Intronic
1122232581 14:100314082-100314104 CGGGCAGAGCTGCGTCTTCCTGG + Intergenic
1122307128 14:100773275-100773297 CTGGCTGGGCTGCTGCCTCCAGG - Intergenic
1122938361 14:104970253-104970275 CGGGCTGGGCAGGGATGTCAGGG - Intronic
1123084424 14:105711030-105711052 TGGGCTGGGCTGGGACGAGCTGG - Intergenic
1123084432 14:105711055-105711077 TGGGCTGGGCTGGGACGGGCTGG - Intergenic
1123084495 14:105711245-105711267 TGGGCTGGGCTGGGACGAGCTGG - Intergenic
1127547469 15:60004419-60004441 CGAGCTCGGCTGCGGAGTCCCGG - Exonic
1129986360 15:79923100-79923122 GGGGCTGGGCGGGGACGCCCCGG - Intronic
1132588214 16:715319-715341 CGCGCTGTGCTGCGGCCTCCTGG + Exonic
1132934710 16:2474609-2474631 CGGGCTGGGCGTCCGCGTCCGGG + Intergenic
1133225213 16:4337624-4337646 CGGGCTGGGCTGGGGCTGCCCGG - Exonic
1135382906 16:22008657-22008679 TGGGCTGGGCTGGCAAGTCCCGG + Intronic
1136553604 16:30995185-30995207 CGGGCTGGTCTACGAACTCCTGG + Intronic
1139409964 16:66751378-66751400 CGGGCCGGGCTGGGATGGCCCGG + Intronic
1139591602 16:67936128-67936150 TGGGCAGGGCTGGGACGTGCGGG + Intronic
1139923900 16:70475263-70475285 CGCACTGGGCTGGGAAGTCCAGG + Intronic
1142644853 17:1305031-1305053 CCGGCTGTGCTGCCACCTCCGGG - Intergenic
1143527304 17:7479843-7479865 CGGGCCGGGCTGCAGCATCCCGG + Intronic
1144948295 17:18980981-18981003 CAGGCTGAGCTGTGACGTACTGG + Intronic
1146941287 17:36846043-36846065 TGGGCTGGGCTGTGAGGCCCTGG + Intergenic
1147382312 17:40063050-40063072 CGGGCTGGGCAGCGACGCGGGGG - Exonic
1151472340 17:74326145-74326167 GGGGCGGGGCGGCGCCGTCCGGG + Intergenic
1154266476 18:12883552-12883574 CGAGCCGGGCCGCGGCGTCCGGG - Intronic
1155054187 18:22170511-22170533 CGGGCTGGTCAGCGCAGTCCGGG + Intronic
1156470830 18:37376389-37376411 CTGGCTGGGCTGCAGTGTCCCGG - Intronic
1157322805 18:46647203-46647225 CTGGCAGGGCTGGGACCTCCTGG - Intronic
1158023441 18:52869764-52869786 CTGGCTGGGCTGTGACAGCCCGG + Intronic
1159948107 18:74458303-74458325 CGGGATGGGCTGGCACGTACTGG - Intergenic
1159952676 18:74496484-74496506 CGGGCTGGGCGGGGAGGACCCGG + Intronic
1160745521 19:709315-709337 CGGGCTGGGCCGCGCCTGCCGGG + Intronic
1160761533 19:787846-787868 CGGGCTTGGCTACGGTGTCCTGG + Intergenic
1160791356 19:925223-925245 CGGGCCGGGCAGGGTCGTCCTGG + Intergenic
1161071978 19:2267007-2267029 CAGGCTGGACTGCAGCGTCCTGG - Intronic
1161410373 19:4113622-4113644 CGGCCTGGGCTGTGGTGTCCTGG - Intronic
1162373991 19:10294468-10294490 CGCGCTGGCCTGCGCCGCCCGGG + Exonic
1162828608 19:13270012-13270034 CTGGCAGGGCTGCGAGATCCAGG - Intronic
1166702795 19:44891707-44891729 CCCGCTGGGCTGCGATGGCCTGG + Intronic
1168266616 19:55227110-55227132 TGGGCTGGGCTGGGAGGCCCAGG + Exonic
928171944 2:29009851-29009873 GGGGCGGGGCTGCCACGTGCAGG + Intronic
932398274 2:71462973-71462995 GGGGCTGGGCTGCCAGTTCCAGG - Intronic
932599356 2:73113057-73113079 CGGGCTGGTCTGCGGCTGCCGGG - Intronic
934754784 2:96817270-96817292 CGTGCTGGACTTCGGCGTCCTGG + Exonic
935904459 2:107827685-107827707 CTGGCTGGGCGGCGGCGGCCTGG + Intronic
936560183 2:113531256-113531278 CGGGCTGTGCAGGGACATCCTGG - Intergenic
937046110 2:118852867-118852889 CGGGCTGCGCGGGGATGTCCGGG + Intergenic
941951347 2:171160333-171160355 CGGGCTCGGCGGCGGCGGCCAGG - Exonic
942804010 2:179908694-179908716 AGGGCTGGGCTGGGTCTTCCTGG - Intergenic
943223978 2:185144920-185144942 GGGGCTGGGCTGCCAGTTCCAGG + Intergenic
946340047 2:219060796-219060818 CGGGCTGGGCTGGGCTGGCCGGG + Intergenic
948920926 2:241065611-241065633 GGGGCTGGGCAGGGACGGCCAGG - Intronic
1170533328 20:17315780-17315802 CCTGCAGGGCTGCGGCGTCCTGG + Intronic
1171346789 20:24471182-24471204 CGTGCTAGGCTGCGACCTCAAGG + Intronic
1171784400 20:29449107-29449129 CTGGCTGGGCTGGCACGGCCTGG + Intergenic
1173849794 20:46210536-46210558 CGGGCTGGGATTCGAAGTCCAGG + Exonic
1176062789 20:63179513-63179535 CCGGCTGGGCTGTGATGCCCCGG + Intergenic
1179481982 21:41684382-41684404 CGGGCTGGGGTGCTACGGGCAGG + Intergenic
1179605667 21:42513888-42513910 CGGGCTGGGCTGCGGAGCGCGGG + Intronic
1180919866 22:19516130-19516152 CGGGGTGGGCTGGGGCCTCCTGG + Intronic
1182081705 22:27533940-27533962 CAGGCTGGGCTCCGAGCTCCAGG + Intergenic
1183211584 22:36454849-36454871 CCCGGTGGGCTGCGCCGTCCTGG + Intergenic
1183742929 22:39678483-39678505 CGGGCTGGGCTGGGAAGGGCAGG + Intronic
1183954416 22:41370781-41370803 CGGGCTGGGCTGGGAGGCCCAGG - Intronic
1184228235 22:43143039-43143061 CGTGCTGGGCTACGACCTGCTGG - Exonic
1184358282 22:43997022-43997044 CTTGCTGGGCTGCGTCCTCCTGG + Intronic
1184934996 22:47714584-47714606 CGGCCTGGGCTGTGTCGTCTTGG + Intergenic
1185038100 22:48489996-48490018 CTGGCTGGGCTCCGACCGCCGGG - Intronic
1185315472 22:50177126-50177148 CGCGCTGGGCTGGGAGTTCCTGG + Exonic
962240332 3:133746461-133746483 CCTGCTGGTCTGCGCCGTCCTGG + Exonic
963906098 3:150774675-150774697 GGGGCTGGGCTGCCACTTCCAGG - Intergenic
964263431 3:154867245-154867267 CTGGCTGGGCAGGGACTTCCAGG + Intergenic
968426001 4:523716-523738 CGGGCCTGGCTGTGATGTCCTGG + Exonic
968902378 4:3437770-3437792 CTGGCTGGGCTGCTGCGTCGAGG + Intronic
969716800 4:8871767-8871789 CGGGCTGGGCTGGGCCGGGCCGG + Exonic
970319682 4:14862954-14862976 CTTGCTGGGCTGCGAGGTTCTGG - Intergenic
971451356 4:26804637-26804659 GGGCCTGCGCTGCGCCGTCCTGG - Intergenic
973246589 4:48016747-48016769 CGGGCGGGGCTGCGGGGTCTGGG - Intronic
983518163 4:168678659-168678681 CGGGCTGTGATGGGACTTCCCGG - Intronic
984763767 4:183384122-183384144 GGGGCTGGGCTGCCAGTTCCAGG + Intergenic
985187698 4:187335501-187335523 GAGGCAGGGCTGCGAGGTCCCGG - Intergenic
985660785 5:1155734-1155756 CGGGCGCGGCTGCGGGGTCCAGG + Intergenic
988781851 5:34529572-34529594 TGGGCTGGGCTGGGAGGTGCTGG - Intergenic
991039669 5:62162576-62162598 GGGGCTGGGCTGCCAGTTCCTGG - Intergenic
992962788 5:81972269-81972291 CGGGCTGGGCTGCGGGGTCAGGG + Exonic
1002490428 5:179572352-179572374 CAAGCTGGGCTGCGAAGTGCTGG + Intronic
1002678027 5:180935204-180935226 GGGGCTGGGCTGCCAGTTCCGGG - Intronic
1002896743 6:1384048-1384070 CGGGCTGGGTTGGGACCTCCAGG + Intergenic
1006926472 6:37658199-37658221 CGGGCTGGGCTGTCAGGGCCCGG + Intronic
1007451338 6:41941872-41941894 GGGGCGGGGCTGCGGCGCCCCGG + Intronic
1012522303 6:100136265-100136287 CAAGCTGGGCTGCGAAGTGCTGG + Intergenic
1014391894 6:120873665-120873687 GGGGCTGGGCTGCCAGTTCCGGG + Intergenic
1017073757 6:150599937-150599959 CGGGCTGCGCTGCGCCGGCTCGG - Exonic
1018920337 6:168168060-168168082 TGGGCTGGGCTGGGTCATCCTGG + Intergenic
1019518775 7:1451281-1451303 GGGGCTGGGCTGGGGCCTCCTGG - Intronic
1019602703 7:1893251-1893273 CCGGCTGGGATGGGAAGTCCTGG + Intronic
1019602709 7:1893270-1893292 CTGGCTGGGATGGGAAGTCCTGG + Intronic
1020278033 7:6636722-6636744 CGGGCAGGGAAGCGATGTCCAGG - Intergenic
1024505676 7:50159292-50159314 CGGGCTGGGCAGGGACGCGCAGG - Exonic
1033099835 7:138460589-138460611 CGGCCTCGGCTGCGGCCTCCGGG + Exonic
1034265141 7:149777110-149777132 AGGGCTGGGCTGAGAGCTCCAGG + Intergenic
1034275208 7:149821011-149821033 CGGGCAGGGCTGAGCCGTGCAGG - Intergenic
1036673702 8:10811566-10811588 AGGGCTGGGCTGGGCAGTCCTGG + Intronic
1036912301 8:12767462-12767484 GTGGCTGGGCTGAGACATCCAGG + Intergenic
1037881973 8:22578019-22578041 CGGGCTGGTCTCCGGCCTCCCGG - Intergenic
1049410809 8:142473237-142473259 GGGGCTGGGCTGGGACGGCGAGG + Intronic
1049562133 8:143317176-143317198 CGGGCTGCTCTGTGATGTCCGGG - Intronic
1050589696 9:7148943-7148965 GGGGCTGGGCTGCCAATTCCGGG - Intergenic
1054694494 9:68346385-68346407 CGGGCTGTGCAGGGACATCCTGG - Intronic
1055266031 9:74497276-74497298 CGGGCTTGGCCGCGACTTCCAGG - Intergenic
1055574669 9:77648763-77648785 CGAGCTGGGCCGGGGCGTCCGGG - Intergenic
1056737981 9:89225990-89226012 CTGGCTGGGCAGCCACGTGCAGG + Intergenic
1057160387 9:92884662-92884684 AGGGCTGGGATGCGACCTCAGGG + Intergenic
1057220911 9:93257274-93257296 GGGGCTGGGCTGGGGAGTCCGGG + Intronic
1057422174 9:94921318-94921340 CGGGCTGGGCTGTTGAGTCCAGG + Intronic
1061922778 9:133791274-133791296 CAGGCAGGGCTGCCACCTCCTGG - Intronic
1062272146 9:135714479-135714501 CGGGCTGCGCTGCGCGGGCCGGG + Intronic
1062419125 9:136470927-136470949 CGCGCTAGGCTGCGCCTTCCAGG - Intronic
1062423808 9:136496979-136497001 CGGGCTTGGCCGCCACGTTCAGG + Exonic
1062491534 9:136807422-136807444 TGGGCTGGGCTGAGTCCTCCCGG + Intronic
1192260821 X:69505037-69505059 CGGGCCGGGCGGCGGCGCCCGGG + Intergenic
1197407010 X:126065495-126065517 GGGGCTGGGCTGCCAGTTCCAGG + Intergenic
1198399021 X:136251554-136251576 CCGGCTGGGCAGCGACTACCTGG + Exonic
1201770369 Y:17612494-17612516 CTGTCTGGGCTGAGTCGTCCGGG - Intergenic
1201831185 Y:18293493-18293515 CTGTCTGGGCTGAGTCGTCCGGG + Intergenic