ID: 904253050

View in Genome Browser
Species Human (GRCh38)
Location 1:29237995-29238017
Sequence CTCCCGGGACACTCCCTTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 96}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904253036_904253050 13 Left 904253036 1:29237959-29237981 CCCTTGGCGCGCAGGACGCGCGG 0: 1
1: 0
2: 0
3: 0
4: 25
Right 904253050 1:29237995-29238017 CTCCCGGGACACTCCCTTGGTGG 0: 1
1: 0
2: 1
3: 8
4: 96
904253033_904253050 18 Left 904253033 1:29237954-29237976 CCCCTCCCTTGGCGCGCAGGACG 0: 1
1: 0
2: 0
3: 4
4: 67
Right 904253050 1:29237995-29238017 CTCCCGGGACACTCCCTTGGTGG 0: 1
1: 0
2: 1
3: 8
4: 96
904253034_904253050 17 Left 904253034 1:29237955-29237977 CCCTCCCTTGGCGCGCAGGACGC 0: 1
1: 0
2: 0
3: 4
4: 64
Right 904253050 1:29237995-29238017 CTCCCGGGACACTCCCTTGGTGG 0: 1
1: 0
2: 1
3: 8
4: 96
904253032_904253050 19 Left 904253032 1:29237953-29237975 CCCCCTCCCTTGGCGCGCAGGAC 0: 1
1: 0
2: 0
3: 12
4: 110
Right 904253050 1:29237995-29238017 CTCCCGGGACACTCCCTTGGTGG 0: 1
1: 0
2: 1
3: 8
4: 96
904253038_904253050 12 Left 904253038 1:29237960-29237982 CCTTGGCGCGCAGGACGCGCGGG 0: 1
1: 0
2: 1
3: 5
4: 113
Right 904253050 1:29237995-29238017 CTCCCGGGACACTCCCTTGGTGG 0: 1
1: 0
2: 1
3: 8
4: 96
904253035_904253050 16 Left 904253035 1:29237956-29237978 CCTCCCTTGGCGCGCAGGACGCG 0: 1
1: 0
2: 0
3: 1
4: 33
Right 904253050 1:29237995-29238017 CTCCCGGGACACTCCCTTGGTGG 0: 1
1: 0
2: 1
3: 8
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904253050 Original CRISPR CTCCCGGGACACTCCCTTGG TGG Intronic
900325720 1:2107843-2107865 CTCCCTCGACACTGCCCTGGGGG - Intronic
901334507 1:8437527-8437549 ATCTTGGGACCCTCCCTTGGGGG - Intronic
903384708 1:22918777-22918799 CTCCGGGCACACCCCCTCGGAGG + Intergenic
904253050 1:29237995-29238017 CTCCCGGGACACTCCCTTGGTGG + Intronic
907920415 1:58906221-58906243 CTCCTGAGACCCTCCCTTGGTGG - Intergenic
914246930 1:145893202-145893224 CTCCCAGGACACTGCCTATGAGG + Exonic
921924307 1:220698836-220698858 CTCCCAGGACAACCCCTAGGAGG - Exonic
923853012 1:237817655-237817677 CTTTTAGGACACTCCCTTGGGGG - Intronic
1063424989 10:5943789-5943811 CTCCCGTGACACTGCCCTGCAGG - Intronic
1071554426 10:86591587-86591609 CTCCCGGGGCATTCCCTAAGCGG - Intergenic
1074745685 10:116529634-116529656 CTCACGGCACACACGCTTGGGGG - Intergenic
1074886364 10:117696798-117696820 ATCCCCAGAGACTCCCTTGGAGG - Intergenic
1077050946 11:566556-566578 CTGCTGGGACACCCTCTTGGTGG - Intergenic
1077514348 11:2992581-2992603 CTCCCGGGACCTTCCCCGGGTGG + Intergenic
1083272617 11:61580048-61580070 CTCCCAGGCCACTCCCCTGGCGG + Intronic
1084859238 11:72007339-72007361 CTCCAGGGATTCTACCTTGGGGG + Exonic
1087292826 11:96339173-96339195 CTCCTGAGACATTCCCTTAGAGG - Intronic
1087606505 11:100384236-100384258 CTCCCTGGACACTCCCTCCCAGG - Intergenic
1089215163 11:116830548-116830570 CTCACAGGACACTTCCTTGCAGG + Exonic
1091694117 12:2616602-2616624 CTCACGGGACACGCCCTATGGGG - Intronic
1092756207 12:11765907-11765929 GTCCTGGGACAGTCCCGTGGTGG + Intronic
1095400805 12:41813339-41813361 CTACAGTCACACTCCCTTGGTGG - Intergenic
1096494181 12:52029817-52029839 CTCCAGGCACTCTCCCTTGAGGG + Intronic
1101443239 12:104719116-104719138 CCCCCAGGACTCTGCCTTGGTGG + Intronic
1102028624 12:109727396-109727418 CTCCCTGGCCAGTCCCCTGGAGG - Intronic
1102510742 12:113413753-113413775 CCCCCGGGACACTTCCCTGGAGG - Intronic
1103989050 12:124786115-124786137 GGCCTGGGACCCTCCCTTGGAGG - Intronic
1108715223 13:53072078-53072100 CTGGCGGGTCATTCCCTTGGAGG + Intergenic
1113775874 13:112944248-112944270 CACCCGGGACCCTCCCTTCATGG - Intronic
1114652797 14:24296865-24296887 CTCCAGGCACAATCCCTCGGGGG - Exonic
1119750638 14:77075135-77075157 CTCCTGGCACAGTCCCATGGGGG - Intergenic
1124414908 15:29466670-29466692 CTCCCCGGGCCCTCCCCTGGGGG - Intronic
1124415034 15:29466975-29466997 CTCCCCGGGCCCTCCCCTGGGGG - Intronic
1125542618 15:40478976-40478998 GTCCCTGGACACTCTCTTTGAGG - Intergenic
1132247856 15:100311201-100311223 CTCCCGGCTCTCTCCCTTGGAGG + Intronic
1132861469 16:2073777-2073799 TTCCCGGGACACTGCCTGGCAGG + Intronic
1134619559 16:15677252-15677274 CTCCCACCACACTCCCTGGGTGG - Intronic
1140481531 16:75265317-75265339 CTCCCGGGACTCCCCCGGGGTGG - Intronic
1140731519 16:77860835-77860857 TTGCTGGCACACTCCCTTGGAGG - Intronic
1141636904 16:85318788-85318810 CTCCTGCGACACTACCTTTGGGG - Intergenic
1142292284 16:89198670-89198692 CCCCGGGGACAGTTCCTTGGAGG - Exonic
1142413983 16:89931429-89931451 CTCCTGGGACACACGCTGGGAGG - Intronic
1143558380 17:7676588-7676610 CTTCCGGGTCACTGCCATGGAGG - Exonic
1147142442 17:38466994-38467016 CTTCCGGGACTCACCCTTTGGGG + Exonic
1147720327 17:42536122-42536144 GTACCAGGATACTCCCTTGGGGG - Intergenic
1148768069 17:50051038-50051060 CTCCCTAGACACTCCACTGGGGG - Intergenic
1148776253 17:50097089-50097111 CTCCCAGCACACTCACTTTGAGG - Intronic
1152641539 17:81451463-81451485 CTGGGGAGACACTCCCTTGGTGG - Intronic
1162312389 19:9914671-9914693 CTCCCGGCCCGCTCCCTCGGGGG + Intronic
1165047607 19:33117998-33118020 CTCCCAAGACACTGACTTGGGGG + Exonic
1166652690 19:44586378-44586400 CTCCCTGGACCCTCCCTGTGGGG + Intergenic
1166801627 19:45461210-45461232 CCCCAGGGACACCCCCTGGGAGG - Intronic
1168146918 19:54424735-54424757 CTCCAGCAAGACTCCCTTGGAGG - Intronic
926812756 2:16771039-16771061 CTCCAGGGAGTCTCCCCTGGGGG + Intergenic
934619257 2:95794057-95794079 CTCCTGGGACCCTCCCTGAGAGG - Intergenic
934641635 2:96030500-96030522 CTCCTGGGACCCTCCCTGAGAGG + Exonic
934927539 2:98392006-98392028 CTCCCGGAACACTCCCGTGGGGG - Intronic
938099866 2:128491346-128491368 CACATGGGACAGTCCCTTGGAGG - Intergenic
948355433 2:237373707-237373729 CTCCCGGGTCACTCGGGTGGGGG - Intronic
948931084 2:241132858-241132880 CTCCAGGGTAAGTCCCTTGGTGG - Exonic
1168859303 20:1034473-1034495 CTCCTGGGACACTCACTCCGGGG + Intergenic
1173843541 20:46174387-46174409 CTCCCCCAACCCTCCCTTGGCGG - Exonic
1179106446 21:38404732-38404754 TTCCCGGGACAAGCCCTTAGGGG + Intronic
1184128232 22:42502223-42502245 CACCCAGGACACTAGCTTGGGGG - Intergenic
1184137022 22:42555536-42555558 CACCCAGGACACTAGCTTGGGGG - Intronic
1185164538 22:49253154-49253176 CTCCAGGGCCACTGCCATGGAGG - Intergenic
954540885 3:51392280-51392302 CTCCCGGGACAGTCCCACGGCGG - Exonic
957847244 3:85753998-85754020 CTCCCTGGACTCTTCCTTTGAGG + Intronic
966993920 3:185261935-185261957 CCCCCGGGGCACCCCCTTTGGGG + Intronic
970402545 4:15731591-15731613 CTCCCGTGACACCCCGTAGGAGG - Intronic
972256266 4:37358976-37358998 TTCCCAGGACACTCCCATAGTGG - Intronic
976203928 4:82606727-82606749 CTCCCGAGGCACTGCCCTGGAGG - Intergenic
978576303 4:110193781-110193803 CTCCCCACTCACTCCCTTGGTGG - Intronic
981013024 4:139945104-139945126 CTTCCTGGAAACTGCCTTGGAGG - Intronic
981112827 4:140955745-140955767 CTGCCTGAACTCTCCCTTGGTGG + Intronic
981495332 4:145385571-145385593 CTCCTGTGACACTCCACTGGTGG + Intergenic
983533390 4:168832982-168833004 CTCACGGGACCCTCCCTTGTTGG - Intronic
991086148 5:62649887-62649909 CTGCAGGGACACCCCCTTGAGGG - Intergenic
991433259 5:66569791-66569813 CTCCAGAGATGCTCCCTTGGTGG - Intergenic
997377590 5:133408457-133408479 CTCCTGGGAAAGTCCCCTGGTGG + Intronic
1003367080 6:5485000-5485022 CTCCCTGGGCACTCAGTTGGTGG + Intronic
1006297044 6:33174299-33174321 CTCCCTGGCCACTGCCTTTGTGG - Intronic
1015749753 6:136548868-136548890 CTCCCGGGGCCCTCACTTGGGGG + Intronic
1016390343 6:143568220-143568242 CTCAGGGGACAATCCTTTGGTGG - Intronic
1016897281 6:149065969-149065991 CTCCCTGGTTACTCCCTGGGTGG - Intronic
1021315819 7:19145640-19145662 CACCCGGGACAGTTCCTTGTTGG + Intergenic
1027131845 7:75596821-75596843 CTGCCGGGAGGCTCCCTGGGAGG - Intronic
1036824192 8:11963685-11963707 CTCCCTGGACACTCAGCTGGGGG + Intergenic
1039503342 8:38033662-38033684 CTCCAGGGACAATCACTTGAGGG - Intronic
1041691581 8:60693179-60693201 CCTCCGCGACACCCCCTTGGCGG + Intronic
1043507383 8:80915846-80915868 CTCCAAGGAGACTCCTTTGGTGG + Intergenic
1047088278 8:121543936-121543958 CTCCTGTGACAGTCCATTGGTGG - Intergenic
1048461212 8:134623298-134623320 ATCCCTGGACACTCCCCTGTGGG + Intronic
1048774563 8:137931720-137931742 CTGCCAGGACACTCCAGTGGAGG - Intergenic
1049989881 9:980876-980898 GTCCGAGGACACTCCCCTGGAGG - Intronic
1061113370 9:128591560-128591582 CTCCCGGGAGAATCTCCTGGAGG + Exonic
1061144860 9:128791650-128791672 CTCCCTGGACACACCCATGTTGG - Exonic
1061243011 9:129385172-129385194 TTCCCAGGACACTCCCTTTTGGG - Intergenic
1062200762 9:135301522-135301544 CTCCCGGGGCAGTCCCATGTGGG - Intergenic
1062529596 9:136994093-136994115 CTCCCTGGAGACTTCCTTGCTGG + Intergenic
1185479793 X:437844-437866 CTCCCAGGACGCACCCTTGATGG - Intergenic
1185570551 X:1131593-1131615 CTCCAGGGATAGTCCCTTGGTGG + Intergenic
1192924478 X:75741124-75741146 CTCCCAGGGCCCACCCTTGGCGG - Intergenic
1197262716 X:124334426-124334448 GCCCCAGGACACTCCCCTGGGGG + Intronic
1197262765 X:124334612-124334634 GCCCCAGGACACTCCCCTGGGGG + Intronic
1198653858 X:138892646-138892668 ATCCCTGGTCACTCCTTTGGAGG - Intronic