ID: 904253090

View in Genome Browser
Species Human (GRCh38)
Location 1:29238289-29238311
Sequence TAGGATCCCAGGCCTCAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 397
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 367}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904253090_904253106 19 Left 904253090 1:29238289-29238311 CCACCCTGAGGCCTGGGATCCTA 0: 1
1: 0
2: 1
3: 28
4: 367
Right 904253106 1:29238331-29238353 GGAGTTTCGGGGCCCTGCTCCGG 0: 1
1: 0
2: 0
3: 10
4: 132
904253090_904253101 8 Left 904253090 1:29238289-29238311 CCACCCTGAGGCCTGGGATCCTA 0: 1
1: 0
2: 1
3: 28
4: 367
Right 904253101 1:29238320-29238342 CCCCTTCCCGCGGAGTTTCGGGG 0: 1
1: 0
2: 0
3: 7
4: 49
904253090_904253099 7 Left 904253090 1:29238289-29238311 CCACCCTGAGGCCTGGGATCCTA 0: 1
1: 0
2: 1
3: 28
4: 367
Right 904253099 1:29238319-29238341 GCCCCTTCCCGCGGAGTTTCGGG 0: 1
1: 0
2: 4
3: 5
4: 91
904253090_904253096 -2 Left 904253090 1:29238289-29238311 CCACCCTGAGGCCTGGGATCCTA 0: 1
1: 0
2: 1
3: 28
4: 367
Right 904253096 1:29238310-29238332 TAGACCGCGGCCCCTTCCCGCGG 0: 1
1: 0
2: 0
3: 4
4: 50
904253090_904253107 20 Left 904253090 1:29238289-29238311 CCACCCTGAGGCCTGGGATCCTA 0: 1
1: 0
2: 1
3: 28
4: 367
Right 904253107 1:29238332-29238354 GAGTTTCGGGGCCCTGCTCCGGG 0: 1
1: 0
2: 0
3: 9
4: 131
904253090_904253098 6 Left 904253090 1:29238289-29238311 CCACCCTGAGGCCTGGGATCCTA 0: 1
1: 0
2: 1
3: 28
4: 367
Right 904253098 1:29238318-29238340 GGCCCCTTCCCGCGGAGTTTCGG 0: 1
1: 0
2: 0
3: 3
4: 44

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904253090 Original CRISPR TAGGATCCCAGGCCTCAGGG TGG (reversed) Intronic
900552530 1:3263966-3263988 GAGGGTTCCAGGGCTCAGGGAGG + Intronic
900591211 1:3460838-3460860 GAGCCTCCCAGGCCCCAGGGAGG - Intronic
902387650 1:16084873-16084895 TATAATCCCAGCCCTCTGGGAGG + Intergenic
902622522 1:17658841-17658863 CAGGATCCCCCTCCTCAGGGAGG - Intronic
903640496 1:24856692-24856714 TATAATCCCAGCCCTCTGGGAGG - Intergenic
903859141 1:26354606-26354628 CAGGCTCTCAGGCCCCAGGGAGG + Intergenic
903878380 1:26491806-26491828 GAGGAAGCCAGGCCTCAGAGAGG - Intergenic
903968586 1:27104643-27104665 TATGATCCCAGGACTTTGGGAGG - Intronic
904253090 1:29238289-29238311 TAGGATCCCAGGCCTCAGGGTGG - Intronic
904437481 1:30508116-30508138 GAGGCTCCCAGTCCCCAGGGGGG + Intergenic
904542446 1:31242184-31242206 TATAATCCCAGGACTCTGGGAGG + Intergenic
905301703 1:36990191-36990213 CAGGATCCCAAGCCTAAGGGAGG - Intronic
906141313 1:43535373-43535395 TAGAAGCCCAGGGCCCAGGGAGG - Intronic
906951022 1:50334574-50334596 GAGGATCCCAGGTCAGAGGGTGG + Intergenic
907188077 1:52626708-52626730 TGTAATCCCAGGCCTCTGGGAGG + Intergenic
907276201 1:53317849-53317871 AAGGAACCTGGGCCTCAGGGTGG + Intronic
907531546 1:55103415-55103437 TAGGATCCCAGCCCTCAAGAAGG - Intronic
907739739 1:57153280-57153302 TATAATCCCAGCACTCAGGGAGG - Intronic
907885869 1:58591877-58591899 TAGCAGCCCAGTTCTCAGGGGGG + Intergenic
907999524 1:59666750-59666772 TGAGATCCAAGGCTTCAGGGTGG - Intronic
908422455 1:63972291-63972313 GAGGAACCCAGGGCTCAGAGAGG + Intronic
911912667 1:103654932-103654954 TTGGATCCCATCCCTCAGGCTGG + Intergenic
911915788 1:103697016-103697038 TTGGATCCCATCCCTCAGGCTGG - Intronic
911920079 1:103749070-103749092 TTGGATCCCATCCCTCAGGCTGG + Intronic
915177294 1:154026602-154026624 TGTAATCCCAGGCCTCTGGGAGG - Intronic
915285027 1:154847043-154847065 GAGGAGCCCAGGGCTCAGGGAGG - Intronic
916026653 1:160838888-160838910 CAGGATCCAAGGCCTCAGGCAGG + Intronic
916172745 1:162013005-162013027 TAGGCTGCCAGGCCTAAAGGTGG - Intronic
917087627 1:171319465-171319487 TAGGTTTCCAGGCTTGAGGGTGG + Intronic
917454380 1:175173556-175173578 TAGGATCTCTGGACTCAGAGAGG - Intronic
918047960 1:180952747-180952769 GAGGCTCCCAGGCCTCTGGACGG + Intergenic
918229220 1:182513076-182513098 TAGGTTTCCAGGCCTAGGGGTGG + Intronic
918518779 1:185391606-185391628 TAGGCTCCAAGGCCTCACTGTGG + Intergenic
920400088 1:205670856-205670878 GAGAATCCCAGGCCCTAGGGGGG + Intronic
920549428 1:206846163-206846185 GAGGAGCCCAGGCCTCAGCTGGG - Intergenic
920609060 1:207419644-207419666 TATAATCCCAGGCCTTTGGGAGG - Intergenic
920689270 1:208133341-208133363 TAGAATCCCTGCCCTCAAGGTGG - Intronic
920695249 1:208176866-208176888 GAGGATCCCAGGACTCAAGGAGG - Intronic
920699992 1:208210549-208210571 TAGGACACCAGGCCTCAGAGAGG + Intronic
920934351 1:210417489-210417511 TAGAATCCCAGGACTTTGGGAGG - Intronic
921520876 1:216152781-216152803 TGGGTTTCCAGGCTTCAGGGTGG - Intronic
921632835 1:217455719-217455741 TAGGTTTCCAGGCTTGAGGGTGG - Intronic
922074957 1:222234597-222234619 TTGGAGACCAGGCCTGAGGGTGG - Intergenic
924087092 1:240463744-240463766 TATAATCCCAGGACTCTGGGAGG + Intronic
924090257 1:240493784-240493806 TATGATCCCAGGGCTTTGGGAGG - Intronic
1063051266 10:2451613-2451635 TCGGATCCCAGCACTTAGGGAGG + Intergenic
1063383248 10:5600000-5600022 TCGGACCCCAGGTCTCAGGGCGG - Intergenic
1064709272 10:18107043-18107065 TGTGATCCCAGGCCTTTGGGAGG - Intergenic
1065001286 10:21339806-21339828 TATAATCCCAGGACTCTGGGAGG - Intergenic
1065261414 10:23927161-23927183 TAGGATCCCAGCACTTTGGGAGG - Intronic
1065365110 10:24927834-24927856 TAGGATCCCAGCACTTTGGGAGG - Intronic
1066059825 10:31713092-31713114 TGGAATCCCAGCCCTCTGGGAGG + Intergenic
1067556817 10:47278489-47278511 TAGGATACCTGGCATCATGGAGG + Intergenic
1067765256 10:49081108-49081130 CAGGATCCCAGGGCACAGGATGG + Intronic
1068968065 10:62933663-62933685 CAGGATGCCAGCCCTCAAGGAGG + Intergenic
1069959316 10:72070287-72070309 GAGGAGCCCAGGCCCCAGGTAGG - Intronic
1072107515 10:92288987-92289009 TATGATCCCAGCCCTATGGGAGG + Intronic
1074769712 10:116725318-116725340 TAGGGTCCCAGGCCTCACGCTGG + Intronic
1075003549 10:118814940-118814962 TAGGATGTCAGGCCTTTGGGAGG - Intergenic
1075265023 10:120992823-120992845 TTGGATTACTGGCCTCAGGGTGG - Intergenic
1075505873 10:123021694-123021716 TTGGATTACTGGCCTCAGGGTGG + Intronic
1075734330 10:124654746-124654768 GAAGGTCCCAGGCCTCAGGAAGG - Intronic
1075833125 10:125428130-125428152 CAGGATCCCAGGCTGCATGGTGG - Intergenic
1077313856 11:1906981-1907003 TGGGTTTCCAGGCCTCAGTGCGG - Intergenic
1077508625 11:2943700-2943722 CAGGCTCCCCAGCCTCAGGGTGG - Intergenic
1078235217 11:9478080-9478102 TATAATCCCAGGACTCTGGGAGG - Intronic
1078508682 11:11969580-11969602 CAGAATACCAGGCCTCAGGAGGG - Intronic
1081732053 11:45378556-45378578 CATAATCCCAGGCCTCGGGGAGG + Intergenic
1082572877 11:54764009-54764031 TATCATACAAGGCCTCAGGGGGG - Intergenic
1083397446 11:62401520-62401542 GTGTTTCCCAGGCCTCAGGGTGG - Intergenic
1083541682 11:63515878-63515900 TGGGATCCCTGGCATCAGAGTGG - Intronic
1083779516 11:64910664-64910686 TGGGCTCCCAGGCCTCAGCTCGG - Exonic
1083957790 11:65995537-65995559 TGGAATCCCAGCCCTCTGGGAGG + Intergenic
1086322497 11:85664935-85664957 AAGGATCCCAGGCCCCAGGGCGG + Exonic
1086904721 11:92405275-92405297 GAGGATCACAGGCATCATGGAGG + Intronic
1089631151 11:119785215-119785237 TAGGAAACCAGGGCTCAGTGAGG + Intergenic
1089679435 11:120111080-120111102 CAGGAACCTGGGCCTCAGGGAGG - Intergenic
1089757679 11:120698424-120698446 GAGGAGCCCAGGGCTCAGAGAGG - Intronic
1090365941 11:126205653-126205675 CAGCAACCCATGCCTCAGGGAGG + Intronic
1090792635 11:130105154-130105176 TAGGATCCCAGTCCTTTGGGAGG + Intronic
1091229899 11:133981481-133981503 TAAGCTCCCTGTCCTCAGGGAGG - Intergenic
1091543488 12:1483948-1483970 TATAATCCCAGCACTCAGGGAGG - Intronic
1091727727 12:2857290-2857312 CTGGCTCCCAGGCCTCAGGGTGG + Intronic
1091737976 12:2938968-2938990 TAGGATCCCAGCACTTTGGGAGG + Intronic
1091993054 12:4972455-4972477 CAGGGTCCCAGTCCTCATGGAGG + Intergenic
1092916598 12:13194859-13194881 GAGCATCCCAACCCTCAGGGAGG - Intergenic
1095122244 12:38433418-38433440 TAGAATCCCAGGACTTTGGGAGG + Intergenic
1095369474 12:41449503-41449525 TGGGATCCCTGCCCTCAAGGGGG + Intronic
1096129194 12:49144007-49144029 TATAATCCCAGGCCTTTGGGAGG - Intergenic
1096601714 12:52734465-52734487 GAGGGGCCCAGGCCTCAGTGTGG - Intergenic
1096606737 12:52772063-52772085 CAGGATCCAAGGACACAGGGAGG + Intronic
1097977855 12:65707622-65707644 TATAATCCCAGCTCTCAGGGAGG + Intergenic
1098758378 12:74391953-74391975 TAGGTTTCCAGGCTTGAGGGTGG + Intergenic
1101164991 12:102020208-102020230 TATGTTCCCAGGCTTCAGAGAGG + Intronic
1103725405 12:122995251-122995273 TGGGATTCCAGGTCTCAGGCTGG + Intronic
1103829841 12:123769982-123770004 TATAATCCCAGGACTTAGGGAGG + Intronic
1104069144 12:125329518-125329540 TAGGACCCCAGACCCAAGGGTGG - Intronic
1104575976 12:129966224-129966246 TTGCATCTCGGGCCTCAGGGAGG + Intergenic
1104848044 12:131856914-131856936 GAGGAGCCCAGGCCCCATGGAGG - Intergenic
1105558289 13:21466231-21466253 TAGGAAGCCAGGTCTGAGGGAGG - Intergenic
1105960428 13:25330082-25330104 TATAATCCCAGCCCTTAGGGAGG - Intronic
1108126659 13:47252145-47252167 TAGAATGCCAGGCATCATGGAGG - Intergenic
1108725831 13:53180160-53180182 AGGGATCCCAGTCCTTAGGGAGG - Intergenic
1109304595 13:60624768-60624790 TATGATCCCAGCACTCTGGGAGG + Intergenic
1109335572 13:60990230-60990252 TAAGAGCCCTGGCCTCAAGGGGG - Intergenic
1112029539 13:95444443-95444465 TAGGCTCTGAGGACTCAGGGAGG + Intronic
1113650756 13:112032623-112032645 TCGGATTCCAGGCCACAGGAGGG - Intergenic
1113791467 13:113030750-113030772 TAGGAGCCAAGGTCTCAGAGAGG + Intronic
1113937463 13:114001956-114001978 GAGGATGCAAGGCCTCAGCGAGG + Intronic
1117296768 14:54387381-54387403 TAGGATCCCATGCGGTAGGGTGG - Intergenic
1117467267 14:56005943-56005965 TTGCATCACGGGCCTCAGGGTGG + Intergenic
1118198393 14:63649332-63649354 TATGATCCCAGCACTCTGGGAGG + Intergenic
1119068268 14:71552650-71552672 CAGGATCCCAGCACTCTGGGAGG - Intronic
1119305486 14:73604801-73604823 TTGGATTACTGGCCTCAGGGTGG + Intergenic
1121069143 14:91000538-91000560 TATAATCCCAGCCCTCTGGGAGG + Intronic
1121076968 14:91076986-91077008 TGTAATCCCAGGCCTCTGGGAGG + Intronic
1121320543 14:92989269-92989291 TGGGATCCCAGGCCTCCCTGGGG - Intronic
1121336666 14:93081948-93081970 CTGGATCAGAGGCCTCAGGGTGG - Intronic
1121503636 14:94459714-94459736 TAGGATCCCAGTTCTGAGTGTGG - Intergenic
1121864081 14:97346348-97346370 TAGAATAACAGGACTCAGGGGGG - Intergenic
1122496093 14:102156628-102156650 TATAATCCCAGGACTCTGGGAGG - Intronic
1122593727 14:102874001-102874023 TGGGATCCCAGGACTTTGGGAGG + Intronic
1122941740 14:104984631-104984653 CAGGGCCCCAGGCCCCAGGGTGG + Intergenic
1122944660 14:105001682-105001704 TGTGATCCCAGGACTCTGGGAGG + Intronic
1124393242 15:29278514-29278536 TTGGAGCCCAGGCCTCACAGGGG - Intronic
1124631659 15:31341202-31341224 GAGGAGCCCTGGCCTCAGAGTGG + Intronic
1125259145 15:37802311-37802333 TAAGATCCTGGGCCCCAGGGTGG + Intergenic
1125527781 15:40389038-40389060 GAGGAAACAAGGCCTCAGGGAGG + Intronic
1125533825 15:40431238-40431260 TGTAATCCCAGGTCTCAGGGAGG - Intronic
1125657996 15:41373931-41373953 TAGGATCCCAGCACTTTGGGAGG + Intronic
1128301667 15:66570012-66570034 TGGGAGCCCAGGCCTCAGACAGG - Intergenic
1129295680 15:74598799-74598821 GTGGATACCCGGCCTCAGGGAGG + Intronic
1129389909 15:75215295-75215317 TGGGAGCCCAGGCCTCACTGAGG - Intergenic
1129660690 15:77551246-77551268 GAGGATCCCAAGGCCCAGGGAGG + Intergenic
1129808907 15:78490154-78490176 TATAATCCCAACCCTCAGGGAGG + Intronic
1129827503 15:78643891-78643913 TATAATCCCAGGCCTTTGGGAGG + Intronic
1130883889 15:88077589-88077611 TAGACTCCAAGGCCTCAGGCAGG + Intronic
1131030629 15:89183608-89183630 CAGGGACCCAGGGCTCAGGGAGG - Intronic
1131177939 15:90221498-90221520 CAGGATCCCTGCCCTCTGGGTGG - Intronic
1131914557 15:97250888-97250910 TTGGATCACTGGCTTCAGGGTGG + Intergenic
1131915247 15:97258055-97258077 TAGGATCCTCGGCCTCTGAGGGG - Intergenic
1132056644 15:98655947-98655969 TGTGATCCCAGCCCTCCGGGAGG - Intronic
1132721725 16:1319872-1319894 TGGGAACACAGGCCCCAGGGTGG - Intronic
1132734225 16:1377647-1377669 GAGGCTGCCAGCCCTCAGGGAGG - Intronic
1132802160 16:1759751-1759773 CAGGCTCCCAGGCCTTGGGGTGG - Intronic
1132893622 16:2216861-2216883 TATGATCCCAGCCCTTTGGGAGG + Intergenic
1133026403 16:2990699-2990721 CAGGCTCCCAGGCCTCAGAGAGG + Intergenic
1133215361 16:4288832-4288854 TGGGATCCCAGCCCTCTGGGAGG + Intergenic
1133999688 16:10773097-10773119 TATAATCCCAGGCCTTTGGGAGG - Intronic
1134132664 16:11660026-11660048 TATGATCCCAGGACTTTGGGAGG - Intergenic
1134877542 16:17715430-17715452 TATAATCCCAGCCCTCTGGGAGG - Intergenic
1136180486 16:28548539-28548561 GAGGATCCCAGGGCTCAGTCAGG + Intergenic
1136377673 16:29875231-29875253 TTGGAGCCCAGGGCTCAGGGCGG + Intronic
1137647112 16:50085367-50085389 TATAATCCCAGGACTCTGGGAGG + Intronic
1137794758 16:51206413-51206435 TGTGATCCCAGCTCTCAGGGAGG + Intergenic
1138376130 16:56565174-56565196 AAGGTTCCCAGACCCCAGGGAGG - Intronic
1138517650 16:57545428-57545450 TATGATCCCAGCCCTTTGGGAGG + Intronic
1138617617 16:58183101-58183123 TATAATCCCAGCCCTCTGGGAGG + Intronic
1139107680 16:63847805-63847827 TAGCATCTCAGGGCTCAGGTGGG - Intergenic
1139639351 16:68279793-68279815 TATGATCCCAGCACTCTGGGAGG - Intronic
1139684216 16:68590303-68590325 TGGGATCCCAGGACTTTGGGAGG + Intergenic
1139728836 16:68924918-68924940 TGGGATCCCTGGCCTCGGGCTGG - Intronic
1141632041 16:85293287-85293309 TATAATCCCAGCCCTCTGGGAGG + Intergenic
1142287938 16:89179043-89179065 TAGGGTTCCAGGCCTCTGGCTGG - Intronic
1142587142 17:980432-980454 TAGGGTGCCAGGTCTCAGTGTGG + Intergenic
1142826412 17:2514595-2514617 TATAATCCCAGCCCTCTGGGAGG - Intergenic
1143017589 17:3899150-3899172 CAGGATCCCAGGCCTCATTCTGG + Intronic
1143038628 17:4016138-4016160 CAGAATCCCTGGCCTCAGGGAGG + Intronic
1143103938 17:4519220-4519242 CAGGCTCCAAGGCCACAGGGCGG + Intronic
1143149438 17:4798414-4798436 TAGAATCCCAGGATTCAGGCGGG - Exonic
1143379547 17:6487501-6487523 GAGCATGCCAGGGCTCAGGGAGG - Intronic
1145228092 17:21147957-21147979 TGTAATCCCAGGACTCAGGGAGG + Intronic
1145277164 17:21439035-21439057 TGGGATCCCGGCCCTCAGGGTGG - Intergenic
1145315001 17:21724929-21724951 TGGGATCCCGGCCCTCAGGGTGG - Intergenic
1145713437 17:26996867-26996889 TGGGATCCCGGCCCTCAGGGTGG - Intergenic
1145840391 17:27989446-27989468 TGGGATGCCAAGCCTCTGGGTGG - Intergenic
1146008600 17:29177768-29177790 TGGGGTCCCAGGCCTGAGTGTGG - Intronic
1146652785 17:34616740-34616762 TCAGACCCCAGACCTCAGGGAGG + Intronic
1146823986 17:36007891-36007913 TGGGTTCCCAGGCTTGAGGGTGG - Intergenic
1147234837 17:39049812-39049834 TATGATCCCAGCCCTTTGGGAGG + Intergenic
1147774594 17:42891762-42891784 TAGGTCCCCAGGCCTGGGGGTGG - Intergenic
1149444798 17:56705273-56705295 TGGGATCCCAAGCCCCAGAGAGG + Intergenic
1149972919 17:61236976-61236998 TAGGATGCCAGGCCTGAGAGTGG + Intronic
1150040505 17:61855319-61855341 TATAATCCCAGGACTCTGGGAGG + Intronic
1151091414 17:71444285-71444307 TGGGATCCCAGGCCTGGGTGTGG - Intergenic
1151225286 17:72643259-72643281 TATGATCCCAGCACTTAGGGAGG - Intergenic
1151807183 17:76413083-76413105 TGGGATCCTAGGCCTCAGCAAGG - Intronic
1152241632 17:79164158-79164180 AGAGATCCCAGGCCTCTGGGAGG + Intronic
1153055983 18:946705-946727 TATAATCCCAGCACTCAGGGAGG - Intergenic
1154348542 18:13564425-13564447 CAGGTGGCCAGGCCTCAGGGTGG + Intronic
1156493626 18:37511457-37511479 TAGGATTCAAGTCCTGAGGGAGG - Intronic
1157619458 18:49007939-49007961 CAGGATCCCAGGCCCCAAGCTGG + Intergenic
1157776378 18:50399794-50399816 TAGGAGCCCGGCCCTCAGTGTGG - Intergenic
1157802017 18:50628376-50628398 AGGGAACCCAGGCCCCAGGGAGG - Intronic
1158173052 18:54620683-54620705 GATGATCCCAGGCCTTTGGGAGG - Intergenic
1160787377 19:907354-907376 TAGGCCCCGGGGCCTCAGGGGGG - Intronic
1160787787 19:909320-909342 CAGGAAGCCAGGGCTCAGGGCGG + Intronic
1160822607 19:1065488-1065510 TAGGAGCCCTGGACTCAGGCTGG + Exonic
1160936013 19:1595143-1595165 TATAATCCCAGGACTCTGGGAGG - Intergenic
1162293494 19:9796533-9796555 TAGGATATGAGGCCTTAGGGAGG + Intergenic
1162659743 19:12159769-12159791 TACAATCCCAGGACTCGGGGAGG - Intergenic
1162721194 19:12663969-12663991 TATGATCCCAGCCTTCTGGGAGG + Intronic
1163138521 19:15331565-15331587 TCTGAGGCCAGGCCTCAGGGCGG - Intronic
1163268212 19:16234064-16234086 GATGAGCACAGGCCTCAGGGGGG - Intronic
1163641446 19:18464706-18464728 TAGGGTGCCGGGCTTCAGGGAGG - Intronic
1163970839 19:20792944-20792966 TATAATCCCAGGACTCAGGAGGG + Intronic
1164587378 19:29484448-29484470 TGAGCTCCCAGGCCCCAGGGAGG - Intergenic
1165148953 19:33749978-33750000 TGGGGCGCCAGGCCTCAGGGAGG - Intronic
1165608934 19:37133823-37133845 TGGGATCCTAGGCATCATGGAGG - Intronic
1165609934 19:37142635-37142657 TATAATCCCAGCCCTCTGGGAGG - Intronic
1166718705 19:44985431-44985453 GAGGAGCCCAGTGCTCAGGGAGG - Intronic
1166882969 19:45940275-45940297 AAGGACCCCAGGGCTCCGGGAGG + Exonic
1167147542 19:47692080-47692102 TAGGTTCCAAGGGCTCAGGGAGG - Intronic
1167639005 19:50670061-50670083 TAGGGGCCCAGAGCTCAGGGCGG - Intronic
1167735485 19:51292125-51292147 GAGCAAACCAGGCCTCAGGGAGG + Intergenic
1168024726 19:53635635-53635657 TATAATCCCAGGACTCTGGGAGG - Intronic
1168692882 19:58387346-58387368 TAGGATCCCCGGCCCCGCGGCGG - Exonic
925821589 2:7804616-7804638 TAGGGTCCCAGGCCTGAGTTGGG + Intergenic
925933249 2:8728084-8728106 TATAATCCCAGGCCTTTGGGAGG + Intronic
925997334 2:9304107-9304129 CAGGGACCCAGGGCTCAGGGCGG - Intronic
926095547 2:10079254-10079276 AAGCCTCCCGGGCCTCAGGGAGG + Intronic
927652218 2:24919825-24919847 TCGGATCCCGGGCCTGACGGCGG - Exonic
927837885 2:26415673-26415695 TATGATCCCAGGACTTTGGGAGG + Intronic
927943002 2:27117682-27117704 TCAGATCCCAGGGCTCAGAGAGG - Intronic
929005436 2:37388861-37388883 TAGAATCCCAGCACTCTGGGAGG - Intergenic
929155823 2:38787781-38787803 TAGAATCCCAGCACTTAGGGAGG + Intergenic
929388577 2:41441933-41441955 AAGGTCCCCAGGCCTCAGGTAGG + Intergenic
929414864 2:41737030-41737052 GAGGCTCCCTGGCCCCAGGGAGG + Intergenic
929934741 2:46286462-46286484 AAGGGTCCCAGGCCCCAGGAAGG - Intergenic
930635360 2:53798514-53798536 TACGATCCCAGGACTTTGGGAGG - Intronic
931376867 2:61715719-61715741 TTGGATTCCAGGCCTCTGGGAGG + Intergenic
931621818 2:64218124-64218146 TATGATCCCAGAACTCTGGGAGG + Intergenic
932639078 2:73424032-73424054 TATGATCCCAGCACTCTGGGAGG - Intronic
933779422 2:85791162-85791184 CAGGATGCCTGGCTTCAGGGAGG - Intergenic
934914631 2:98291206-98291228 GCGGTGCCCAGGCCTCAGGGTGG + Intronic
938779066 2:134568266-134568288 TATGATCCCAGCACTTAGGGAGG + Intronic
939172909 2:138716287-138716309 TAGGAGACCGGGCCTCGGGGAGG + Intronic
939800501 2:146700981-146701003 GAGGTCCCCAGGCCTCAGGTGGG - Intergenic
940323211 2:152399138-152399160 TGGGATCCCAGACCTGAGGTCGG + Intronic
943849311 2:192696532-192696554 TAAAATCCCAGACCTCAAGGAGG - Intergenic
944473394 2:200079593-200079615 TAGGATCCAAGGACTAAGGATGG + Intergenic
944650194 2:201821935-201821957 TGTGATCCCAGCACTCAGGGAGG - Intronic
947739505 2:232478703-232478725 GAGGACCCCAGGCCCCATGGAGG - Intergenic
1169226269 20:3859044-3859066 TATGATCCCAGCACTCTGGGAGG - Intronic
1169877794 20:10316739-10316761 AAGGACCCCAGGCCTAAGGAGGG - Intergenic
1171992269 20:31705730-31705752 TAGTATCCCAAGCCCCAGTGAGG - Intronic
1172047883 20:32093708-32093730 GAGGGCCCCAGGGCTCAGGGTGG - Intronic
1172451000 20:35022762-35022784 TATGATCCCAGGACTTTGGGAGG + Intronic
1172694523 20:36812956-36812978 CAGGGTCCCAGCCCTCAGGTGGG - Intronic
1172764553 20:37344638-37344660 CAGCTTCCCAGGGCTCAGGGCGG - Intergenic
1173217967 20:41104484-41104506 AAGGATCTCAGCCCTCAGAGAGG - Intronic
1174132768 20:48357738-48357760 TAGAATCCTAGGCCTCTTGGTGG - Intergenic
1174783653 20:53412882-53412904 TCCGATCCCAGTCCTCAGGTTGG + Intronic
1175108344 20:56629681-56629703 TAGGAGCCCTGGCCTCTCGGTGG + Intronic
1175196208 20:57244926-57244948 ATGGAACCCAGGCCTCAGGAAGG - Intronic
1175317330 20:58058153-58058175 TAGGACCACAGGCCACAGGTGGG - Intergenic
1175889600 20:62310384-62310406 TGGCATCCCAGGCCTCAGCAGGG - Intronic
1175987265 20:62770347-62770369 TTGGGTCCCAGTCCTCAGGCTGG - Intergenic
1176067958 20:63209511-63209533 TATAATCCCAGCCCTCTGGGAGG + Intronic
1176372796 21:6072613-6072635 GAGGACCACAGGCCCCAGGGAGG - Intergenic
1178847307 21:36184438-36184460 TATGATCCCAGCACTCTGGGAGG - Intronic
1179560595 21:42213658-42213680 TAGGCCCCCAGGGCTCTGGGTGG - Intronic
1179750681 21:43465630-43465652 GAGGACCACAGGCCCCAGGGAGG + Intergenic
1180936107 22:19626190-19626212 TAGGATAGCAGACCCCAGGGAGG - Intergenic
1181006183 22:20014774-20014796 CAGGATCCCCGGTCTCTGGGTGG - Intronic
1181390408 22:22576501-22576523 GAGGAGCCCAAGCCCCAGGGAGG - Intergenic
1182401266 22:30079934-30079956 TGGGATCCCAGCACTCTGGGAGG - Intergenic
1182862101 22:33569040-33569062 TAAGATCCGAGGACTCAGTGAGG + Intronic
1183059363 22:35326788-35326810 TGGGATCCCAGTCCTCTAGGAGG + Intronic
1183459451 22:37941107-37941129 TAGGGTCCCAGGGTCCAGGGAGG + Exonic
1183604531 22:38860747-38860769 CAGGACCCCAGGCTGCAGGGCGG + Intergenic
949890536 3:8730614-8730636 AAGGACCCCAGGCCTCAGAGAGG + Intronic
951402254 3:22247857-22247879 TATGATCCCAGGACTTTGGGAGG - Intronic
952239957 3:31521271-31521293 TAGGATTACAGGCGTGAGGGTGG + Intergenic
952617474 3:35292212-35292234 ATGGAACCCAGGGCTCAGGGAGG + Intergenic
952891715 3:38046784-38046806 CAGGATCCTGGGCCTGAGGGGGG - Intronic
953906034 3:46868668-46868690 TAGGGACCCAAGCCTCATGGGGG + Intronic
954240499 3:49289847-49289869 TATGATCCCAGCACTCTGGGAGG + Intronic
954269800 3:49498964-49498986 TAGAATCCCAGTACTCTGGGAGG - Intronic
955781120 3:62485873-62485895 TAGGATACTGAGCCTCAGGGAGG + Intronic
956613915 3:71152282-71152304 GGGGATCCCAAGCCTCAGGTGGG + Intronic
958700965 3:97589045-97589067 GAGGCTCCCAGGCCACAGGTTGG - Intronic
966790614 3:183666135-183666157 TATAATCCCAGCCCTCTGGGAGG - Intronic
968945281 4:3660337-3660359 CAGGATTCCTGTCCTCAGGGAGG - Intergenic
969260756 4:6031798-6031820 AAGGACACCAAGCCTCAGGGAGG - Intronic
969956773 4:10898584-10898606 TATAATCCCAGCACTCAGGGAGG + Intergenic
970485095 4:16517148-16517170 GAGGGTCTCAGACCTCAGGGAGG - Intronic
974502533 4:62726035-62726057 TAGGAACCCAGGCCACAGATGGG - Intergenic
974872720 4:67662717-67662739 TATGATCCCAGGACTTTGGGAGG - Intronic
976152360 4:82104941-82104963 TATAATCCCAGGCCTTTGGGAGG + Intergenic
976504693 4:85832976-85832998 CAGGCTCCCAGGCTTCAGAGAGG + Intronic
976662644 4:87555614-87555636 TATAATCCCAGGCCTTTGGGAGG - Intergenic
977571207 4:98631609-98631631 TAGGAAGCCAGGCCTGAGAGGGG + Intronic
979552615 4:122008156-122008178 CAAGATCCAATGCCTCAGGGAGG - Intergenic
980123961 4:128755533-128755555 TGTGATCCCAGCTCTCAGGGAGG + Intergenic
982182546 4:152763111-152763133 TATAATCCCAGGACTTAGGGAGG - Intronic
984957968 4:185064681-185064703 TATAATCCCAGCCCTCTGGGAGG - Intergenic
985647702 5:1092902-1092924 CAGGGCCTCAGGCCTCAGGGTGG + Intronic
985863493 5:2493139-2493161 TAGGATCCCAGCCGGCATGGTGG - Intergenic
986547661 5:8916519-8916541 TAGGATCCCAGGCATTGTGGAGG + Intergenic
991087402 5:62660764-62660786 CAGGTTTCCAGGCCTGAGGGTGG - Intergenic
991318302 5:65338029-65338051 TAGGATCACAGGCCTAAGTTTGG - Intronic
993003999 5:82411608-82411630 TATGATCCCAGCACTCTGGGAGG - Intergenic
994376812 5:99024470-99024492 TATGATCCCAGTGCTCAGGGAGG - Intergenic
995230220 5:109752828-109752850 TAGCATCCCAGGCATCATGGAGG + Intronic
996415099 5:123202292-123202314 TATGATCCCAGCACTCTGGGAGG - Intergenic
997343408 5:133165373-133165395 TATGATCCCAGCACTCTGGGAGG - Intergenic
997530853 5:134580323-134580345 TGGGATCCCGGGGCCCAGGGCGG + Exonic
998084908 5:139312352-139312374 TACGATCCCAGCACTCTGGGAGG - Intronic
998860878 5:146442800-146442822 TAGGATGCGAGGCCTTTGGGAGG - Intergenic
999254536 5:150202709-150202731 CAGGCTGCCAGGCCTCAGTGGGG + Intronic
999378221 5:151101622-151101644 TAGGATCCCATGCCACATGTAGG + Intronic
999382363 5:151130509-151130531 TATGATCCCAGCACTCTGGGAGG - Intronic
999395609 5:151225102-151225124 TGGGATCCCAGGACTTTGGGAGG - Intronic
1001100987 5:168814137-168814159 TAGAATCCCAGGGCTTTGGGAGG + Intronic
1002335312 5:178473568-178473590 TATAATCCCAGCACTCAGGGAGG - Intronic
1002340964 5:178516317-178516339 TAGGAGGCCAGGCCTCAGTGGGG - Intronic
1002840371 6:900128-900150 TGTTATCCCAGGACTCAGGGAGG - Intergenic
1003202321 6:3973315-3973337 TATGATCCCAGCCCTGTGGGAGG + Intergenic
1005235723 6:23760173-23760195 TAGAATCCCAGGACTTTGGGAGG + Intergenic
1007754295 6:44088948-44088970 TAAGAGCACAGGTCTCAGGGTGG + Intergenic
1009263629 6:61527132-61527154 TAGGATCCAAGTCCTCAAGAAGG - Intergenic
1010104042 6:72147353-72147375 TTGGATTACTGGCCTCAGGGTGG + Intronic
1011654937 6:89543566-89543588 TAGGATCACAGGCCACAGGCGGG - Intronic
1013082168 6:106822327-106822349 TATAATCCCAGCTCTCAGGGAGG + Intergenic
1013579229 6:111516198-111516220 TATAATCCCAGGACTCTGGGAGG - Intergenic
1016448445 6:144156318-144156340 TATAATCCCAGCACTCAGGGAGG - Intronic
1016635207 6:146280883-146280905 TATGATCCCAGCACTCTGGGAGG - Intronic
1017566437 6:155692320-155692342 CAGGATCACAAGGCTCAGGGAGG + Intergenic
1017880148 6:158557116-158557138 TAGGATCCCAGCACTTTGGGAGG + Intronic
1018063396 6:160108126-160108148 AAGAATCCCATGGCTCAGGGAGG + Intronic
1018622413 6:165743150-165743172 TACTATCCTAGGCCTTAGGGAGG + Intronic
1019386978 7:762868-762890 TATGATCCCAGCCCTTTGGGAGG - Intronic
1019409606 7:900785-900807 TAGCAGCCCCGGCCTCAGCGTGG - Intronic
1020059432 7:5141227-5141249 TATAATCCCAGCACTCAGGGAGG + Intergenic
1022280213 7:28900557-28900579 TGGGATCCCAGGCCAGGGGGAGG + Intergenic
1023360923 7:39414490-39414512 GAGGGTCCCAGGCCTCAGGACGG - Intronic
1023788451 7:43731860-43731882 AAGGATCCCAGCACTCTGGGAGG - Intergenic
1023814358 7:43938312-43938334 GAGGCTCCTAGGCCTCAGGAGGG - Intronic
1024250220 7:47500821-47500843 TAGAATCCCAGCACTCTGGGAGG + Intronic
1026227787 7:68457836-68457858 GGGGATCCCAGGCCTTAGGATGG + Intergenic
1026733796 7:72935429-72935451 TACAATCCCAGCACTCAGGGAGG - Intronic
1026836438 7:73642750-73642772 TATAATCCCAGGACTCTGGGAGG - Intergenic
1028092521 7:86721259-86721281 TAGCATCCCAGCCCTCACGCTGG + Intronic
1029203617 7:98855375-98855397 GAGGCTCCCAGGGCACAGGGTGG + Intronic
1029495254 7:100893024-100893046 TGGGATCTGAGCCCTCAGGGAGG + Intronic
1030084237 7:105803389-105803411 TAGGATCCTGGACATCAGGGTGG - Intronic
1031013570 7:116548755-116548777 TAGGAGACCGAGCCTCAGGGAGG - Intronic
1031543377 7:123023411-123023433 TGGAATCCCAGCCCTCTGGGAGG + Intergenic
1031544173 7:123032038-123032060 TTGGATCCCAGACCTCTGGTGGG - Intergenic
1033102151 7:138483190-138483212 TAGGATCCCAGCACTTTGGGAGG - Intronic
1033279339 7:139994821-139994843 TAGATTCCCAGGCGTGAGGGAGG + Intronic
1034102299 7:148460114-148460136 CTGGATGCCAGGCCTCAGGCAGG + Intergenic
1034324659 7:150219974-150219996 TAGGATCTCCAGCCCCAGGGTGG + Intergenic
1034768533 7:153749257-153749279 TAGGATCTCCAGCCCCAGGGTGG - Intergenic
1035026750 7:155831330-155831352 GAGGACACCAAGCCTCAGGGAGG + Intergenic
1035407206 7:158606968-158606990 TGGGTTCCCAGGCCCCAGGTGGG + Intergenic
1035741495 8:1931180-1931202 TAGGAACACAGGCAGCAGGGAGG - Intronic
1037986960 8:23296089-23296111 TGGGTCTCCAGGCCTCAGGGCGG - Exonic
1038615605 8:29090972-29090994 TATAACCCCAGCCCTCAGGGAGG - Intronic
1043783463 8:84366518-84366540 TATGATCCCAGCCCTTTGGGAGG + Intronic
1048349671 8:133605982-133606004 TATGATCCCAGCACTTAGGGGGG - Intergenic
1049267356 8:141675773-141675795 TAGGTTCCTATGGCTCAGGGTGG + Intergenic
1049454470 8:142680120-142680142 TAGGAGCACAGGGCCCAGGGAGG + Intronic
1049760381 8:144329469-144329491 GCTCATCCCAGGCCTCAGGGAGG + Intergenic
1050115580 9:2259866-2259888 GAGGAGCCCAGGAATCAGGGTGG + Intergenic
1052929213 9:34042529-34042551 TATAATCCCAGGACTCTGGGAGG + Intronic
1053168526 9:35861681-35861703 TAGCATCCCAGTCTTCAAGGAGG - Intergenic
1055085829 9:72313529-72313551 TATAATCCCAGCCCTCTGGGAGG - Intergenic
1056450540 9:86712512-86712534 TATAATCCCAGTGCTCAGGGAGG - Intergenic
1058002776 9:99883209-99883231 TAAGATCCCAGCCCTTTGGGAGG - Intergenic
1058642416 9:107100436-107100458 GAGGATCTCAGCCGTCAGGGAGG - Intergenic
1059081560 9:111255643-111255665 TAGGAAACCAGGCCTTTGGGAGG + Intergenic
1059551861 9:115237143-115237165 CTGGAACTCAGGCCTCAGGGAGG + Intronic
1059712546 9:116882703-116882725 TATGATCCCAGCACTCTGGGAGG + Intronic
1060911945 9:127358184-127358206 CAGGCTGCCAGGCCTCAGGGTGG - Intronic
1061137522 9:128743674-128743696 TAGAATCCCAGAACTCTGGGAGG - Intronic
1061309194 9:129751381-129751403 TAAGAACCCAGGCCTCAGCCAGG + Intronic
1061411132 9:130422352-130422374 GAGGAACCCTGGGCTCAGGGCGG - Intronic
1061606599 9:131715607-131715629 TAGGATCCCAGCACTTTGGGAGG + Intronic
1061762869 9:132862583-132862605 TATGATCCCAGCCCTTTGGGAGG - Intronic
1061960093 9:133983479-133983501 TCGGGGCCCTGGCCTCAGGGCGG - Intronic
1062007836 9:134250379-134250401 TAAGACCCCAGACCTAAGGGCGG + Intergenic
1062381998 9:136291053-136291075 GGGGCTCCCAGGCCTCTGGGAGG + Exonic
1062495630 9:136830292-136830314 CAGCAGCCCAGGCCTGAGGGCGG + Intronic
1185535457 X:858065-858087 TAGGCTCCCAAGAATCAGGGTGG + Intergenic
1185614959 X:1415195-1415217 TGGAATCCCAGCCCTCTGGGAGG - Intronic
1188619535 X:32203083-32203105 TGGGATCCCAGGCCTCCAGATGG - Intronic
1190594606 X:52040698-52040720 TGGGATTGCAGGCATCAGGGAGG + Intergenic
1191070463 X:56395130-56395152 TTGGATTACTGGCCTCAGGGTGG + Intergenic
1192207494 X:69106096-69106118 TCCGAACCCAGTCCTCAGGGAGG + Intergenic
1193121696 X:77830064-77830086 TATAATCCCAGCCCTCTGGGAGG + Intronic
1197220121 X:123904191-123904213 TATAATCCCAGCTCTCAGGGAGG - Intronic
1198019597 X:132644961-132644983 TGGGATTTCAGGCCTCAGTGGGG - Intronic
1199754670 X:150853065-150853087 TTGACTCCCAGTCCTCAGGGAGG + Intronic
1200143332 X:153912995-153913017 CAGGGCCCCAGCCCTCAGGGAGG + Intronic
1200835796 Y:7729917-7729939 TAGTTTCGCAGGCCTCAGGGAGG - Intergenic