ID: 904253164

View in Genome Browser
Species Human (GRCh38)
Location 1:29238543-29238565
Sequence CGCTGGAGCCACAGGAGTTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 182}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904253164_904253174 25 Left 904253164 1:29238543-29238565 CCGGAACTCCTGTGGCTCCAGCG 0: 1
1: 0
2: 1
3: 16
4: 182
Right 904253174 1:29238591-29238613 TGGGCCTCGCCCTGCAGCTCCGG 0: 1
1: 0
2: 1
3: 38
4: 392
904253164_904253169 5 Left 904253164 1:29238543-29238565 CCGGAACTCCTGTGGCTCCAGCG 0: 1
1: 0
2: 1
3: 16
4: 182
Right 904253169 1:29238571-29238593 GCCGGCCACTGGCCAGCGCTTGG 0: 1
1: 0
2: 0
3: 10
4: 130
904253164_904253175 26 Left 904253164 1:29238543-29238565 CCGGAACTCCTGTGGCTCCAGCG 0: 1
1: 0
2: 1
3: 16
4: 182
Right 904253175 1:29238592-29238614 GGGCCTCGCCCTGCAGCTCCGGG 0: 1
1: 1
2: 3
3: 50
4: 401
904253164_904253171 6 Left 904253164 1:29238543-29238565 CCGGAACTCCTGTGGCTCCAGCG 0: 1
1: 0
2: 1
3: 16
4: 182
Right 904253171 1:29238572-29238594 CCGGCCACTGGCCAGCGCTTGGG 0: 1
1: 0
2: 2
3: 7
4: 91
904253164_904253168 -6 Left 904253164 1:29238543-29238565 CCGGAACTCCTGTGGCTCCAGCG 0: 1
1: 0
2: 1
3: 16
4: 182
Right 904253168 1:29238560-29238582 CCAGCGTTCGCGCCGGCCACTGG 0: 1
1: 0
2: 0
3: 3
4: 36
904253164_904253176 27 Left 904253164 1:29238543-29238565 CCGGAACTCCTGTGGCTCCAGCG 0: 1
1: 0
2: 1
3: 16
4: 182
Right 904253176 1:29238593-29238615 GGCCTCGCCCTGCAGCTCCGGGG 0: 1
1: 0
2: 2
3: 27
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904253164 Original CRISPR CGCTGGAGCCACAGGAGTTC CGG (reversed) Intronic
900174356 1:1285264-1285286 CGCTGGAGGCTCTGGAGTCCTGG - Intronic
900294022 1:1939612-1939634 CGCTCCTGCCCCAGGAGTTCGGG - Exonic
901887456 1:12232726-12232748 GGCTGGAGCCAGAGGATTTCTGG + Intronic
903533691 1:24052307-24052329 GGCTGGAGCCAGAGGAGCTAAGG - Intergenic
904253164 1:29238543-29238565 CGCTGGAGCCACAGGAGTTCCGG - Intronic
904297679 1:29532103-29532125 CTCTGGAGACAGAGGAGATCTGG + Intergenic
905394936 1:37660986-37661008 CTCTGGACTCACAGGAGGTCAGG + Intergenic
906154607 1:43606643-43606665 CCCTGGAGCCACATTAGGTCTGG - Intronic
906528884 1:46512061-46512083 CCCTGGGGCCACAGGAGTGATGG - Exonic
907347760 1:53797711-53797733 CGCTGGAGCCCCAGAAGTTGAGG - Intronic
907830304 1:58058608-58058630 CGCTGGAACTACAGGAGTGCAGG + Intronic
908401398 1:63775004-63775026 CGCCGGAGCCCCAGGAGGACAGG - Intronic
908997920 1:70180358-70180380 CGCTTGAGCCTAGGGAGTTCTGG - Intronic
912352237 1:109025345-109025367 CACTGGAGCCCCAGAAGTTGAGG + Intronic
912977824 1:114346163-114346185 CGCTGGAGCCAGCGGAGCGCAGG - Intergenic
913960647 1:143336104-143336126 GGATGGAGCCACAGCAGGTCTGG + Intergenic
914055001 1:144161676-144161698 GGATGGAGCCACAGCAGGTCTGG + Intergenic
914124145 1:144804685-144804707 GGATGGAGCCACAGCAGGTCTGG - Intergenic
914875030 1:151507024-151507046 CGCTTGAGCCCAAGGAGTTGAGG + Intergenic
915192205 1:154160992-154161014 TGCTTGAGCCCTAGGAGTTCAGG - Intronic
915439050 1:155933010-155933032 CCCTGAAGTCAGAGGAGTTCAGG - Intronic
918050347 1:180967931-180967953 CACTGGAGCCAAAGGAGTTTTGG - Intergenic
919240880 1:194914553-194914575 CCCTGGGGCCTCAGGAGTTGTGG + Intergenic
921207175 1:212858623-212858645 CGCTGCCGCCTCGGGAGTTCTGG + Exonic
923630859 1:235649119-235649141 CGCTGGAGCCACCGCAGCTGAGG - Intronic
1064949885 10:20836620-20836642 GGGTGGAGCCACAGAAGTTCCGG + Intronic
1065419236 10:25523229-25523251 CCCTGGATCCACAGGACTTCAGG - Intronic
1065844642 10:29735261-29735283 CGCGGGAGCCACCGCAGCTCCGG + Intronic
1067029080 10:42868358-42868380 GGATGGAGCCACAGCAGGTCTGG + Intergenic
1067208957 10:44242638-44242660 CGCTGGAGCCACAGCAAGTGGGG - Intergenic
1067698686 10:48553355-48553377 TGCTTGAGACAAAGGAGTTCAGG + Intronic
1069786639 10:70992545-70992567 CTCTGGAGTCACAGGGGTTGCGG + Intergenic
1070336076 10:75456133-75456155 CCCTGGAGTGACAGGAGTTGCGG + Intronic
1070336268 10:75457479-75457501 CCCTGGAGTGACAGGAGTTGCGG + Intronic
1072307573 10:94122076-94122098 GCCTGGAGCCACAGGATGTCAGG + Intronic
1076149909 10:128153501-128153523 GGCAGGAGCCACAGGAGGTGGGG - Intergenic
1077109394 11:855434-855456 TGCTGGAGGCACAGGAATCCAGG - Intronic
1080048104 11:27830503-27830525 TGCTGGAGCCACATGTGTCCAGG + Intergenic
1081905791 11:46668841-46668863 CGCTGGAGCCATCTGAGTGCAGG - Exonic
1081994269 11:47353435-47353457 CGCTTGAGTCCAAGGAGTTCCGG + Intergenic
1083723714 11:64617672-64617694 CACTGGAGCCAAGGGAGTCCTGG + Intronic
1087872162 11:103309412-103309434 TGCTTGAGCCTAAGGAGTTCAGG - Intronic
1089610186 11:119664600-119664622 CCCTGGCCCCCCAGGAGTTCGGG + Exonic
1089771658 11:120807469-120807491 CACTGGAGCCACAGGAGGCCCGG - Intronic
1090636809 11:128694640-128694662 CGCTGGGGCCACGGGAGCCCCGG - Intronic
1094537432 12:31334585-31334607 TGCTTGAGCCCCAGGATTTCAGG - Intergenic
1096182480 12:49558365-49558387 AGCTGGAGACACAGGAGTGAAGG + Intronic
1096634194 12:52948358-52948380 TCCTGGAGCCCCAGGAGTCCCGG - Intronic
1100579281 12:95923196-95923218 CGCTGGAGACCCAGGAGAGCTGG - Intronic
1103025311 12:117569119-117569141 CGCTGCAGCCACAGGTGATGAGG - Intronic
1103343169 12:120231977-120231999 GGCTACAGACACAGGAGTTCAGG + Intronic
1103724498 12:122991005-122991027 CCCTGGAGCCACTGGGGTGCTGG - Intronic
1105257210 13:18751698-18751720 AGCTGGAGCCACAGGGATGCAGG + Intergenic
1106808616 13:33336670-33336692 GGCTTGAGCCACAGAAGTTGAGG + Intronic
1107779105 13:43879516-43879538 CGCTGCTGCCTCAGCAGTTCCGG - Exonic
1109190479 13:59316918-59316940 CCATAGAGCCACAGAAGTTCAGG - Intergenic
1109370450 13:61414747-61414769 CGCTTTAGCTACAGGGGTTCGGG - Intronic
1111118090 13:83807931-83807953 TTCTGGAGCCTCAGGATTTCTGG - Intergenic
1114625849 14:24129780-24129802 CTGAGGAGCCACAGGAGTTCGGG - Intronic
1115804797 14:37038837-37038859 GGCTGGGGCCACAGGACGTCAGG - Intronic
1117490452 14:56241537-56241559 CACTAGAGGCACAGGAGTTGGGG + Intronic
1119831573 14:77707686-77707708 CTCTGCAGCCAAAGGAGGTCAGG + Intronic
1120571933 14:86129578-86129600 AGGTGGAGCCACAGAAGTCCGGG + Intergenic
1121050289 14:90815855-90815877 CACTGGGACCACAGGAGGTCAGG - Intronic
1124937650 15:34187439-34187461 CACTGCAGCCACAGAGGTTCTGG + Intronic
1125890927 15:43266806-43266828 CCCTGTGGCCACTGGAGTTCAGG - Intronic
1127921666 15:63499352-63499374 GGCTGGAGCCACTGGAGACCTGG + Intergenic
1129227222 15:74177000-74177022 CTGTGGAGGCACAGGAGTGCTGG + Intergenic
1129481155 15:75827572-75827594 CAATGGGGCCACAGGATTTCTGG + Intergenic
1132590683 16:725101-725123 CGCTGGAGCATCAGGAGGCCCGG - Exonic
1135527751 16:23227056-23227078 CGCTTGAGCCCAAGGAGTTGGGG - Intergenic
1135584480 16:23658062-23658084 AGGTGGACCCACTGGAGTTCTGG - Intronic
1138641645 16:58392540-58392562 CGGAGGAGCCTCAGGAGTTAGGG - Exonic
1139205418 16:65023957-65023979 GGCTGCATCCCCAGGAGTTCAGG - Intronic
1139921579 16:70463840-70463862 CGATGGAGCCAGAGGAGCTGGGG - Intronic
1142395024 16:89827488-89827510 CGCTGGTCTCCCAGGAGTTCTGG - Intronic
1142827816 17:2525257-2525279 CTCAGGAGACACAGGAGATCCGG - Intergenic
1144726289 17:17504238-17504260 GGCTGGGGCAAGAGGAGTTCAGG + Intergenic
1144776788 17:17788816-17788838 CTCAGGAGCCACAGCAGCTCTGG + Intronic
1146385340 17:32366937-32366959 CTTTAGAACCACAGGAGTTCGGG - Intronic
1147429870 17:40364495-40364517 GGCTGGAGGCACAGGAGGCCAGG - Exonic
1148041230 17:44708973-44708995 GGAAGGAGCCACAGGAGTTGAGG + Intronic
1150002959 17:61452622-61452644 GGCTGGGGCCACAGGGGCTCAGG + Intronic
1150492763 17:65585704-65585726 CTCTGGAGACTCAGGAGGTCAGG + Intronic
1150622724 17:66820554-66820576 CTCTGGAGCCAAGGCAGTTCTGG + Intergenic
1152446843 17:80349848-80349870 TGCTGCAGCCACAGGAGTGTGGG - Exonic
1153273849 18:3349307-3349329 CGCTTGAGCCCCAGGAGCTCGGG + Intergenic
1154047131 18:10916469-10916491 CGCTGGCGGCCCAGGAGTGCTGG + Intronic
1156499043 18:37545352-37545374 CGCTGGAGCCAGAGGTGGGCTGG + Intronic
1156587135 18:38443893-38443915 GGCTGGAGTCACATGAGGTCAGG + Intergenic
1159284394 18:66330019-66330041 TTCTGGAGGCTCAGGAGTTCAGG - Intergenic
1161594067 19:5142339-5142361 CGCTGTGGCCACAGGAGGTCGGG - Intronic
1163125791 19:15243518-15243540 GGCTGGGGCCACAGGTGCTCAGG - Intronic
1165016649 19:32886096-32886118 AGCTGGAGAGACAGGACTTCAGG - Intronic
1165420560 19:35720102-35720124 CACTGGAACCACAGGAGGTGGGG - Exonic
1166660138 19:44641655-44641677 CCCTGGAGCCACAGGAGCTTGGG + Intergenic
1202694483 1_KI270712v1_random:114351-114373 GGATGGAGCCACAGCAGGTCTGG + Intergenic
929220856 2:39463692-39463714 CGCTTGAGCCCCAGAGGTTCTGG - Intergenic
931440613 2:62287699-62287721 CGCTTGAGCCCCAGAAGTTGAGG - Intergenic
934706865 2:96487545-96487567 TGCTTGAGCCCAAGGAGTTCAGG + Intergenic
934934006 2:98451531-98451553 CGCTGCAGCAACCGGAGGTCAGG - Intronic
935554676 2:104496257-104496279 CTCTGGAGCCACAGGAACTGTGG + Intergenic
936981862 2:118272172-118272194 GGCTGCAGCCCCAGGAGCTCAGG - Intergenic
949077742 2:242071852-242071874 TGCTGGAGTCACTGGAGTGCTGG - Intergenic
1168854519 20:999404-999426 CAAGGCAGCCACAGGAGTTCTGG - Intronic
1168992170 20:2103851-2103873 CGAGGAAGCCACAGGAGTTTGGG - Intronic
1172174522 20:32964139-32964161 CGCTGGAGCCTGGGGAGTTGAGG - Intergenic
1175458720 20:59134759-59134781 CCCTGGAGCCACATGGGTTGGGG + Intergenic
1178081670 21:29072981-29073003 CGTTGTAGCCAAATGAGTTCCGG - Intronic
1178342705 21:31799924-31799946 AGCTGCTGCCACAGGAGTTGGGG + Intergenic
1179158535 21:38873069-38873091 CACTGGAGCCCCAGGATTACAGG - Intergenic
1179171039 21:38972915-38972937 CACGTGAGCCCCAGGAGTTCAGG + Intergenic
1179990190 21:44944077-44944099 CGCTGAAGCCACAGGAACTTGGG + Intronic
1180136871 21:45867658-45867680 CGCTGTAGCTGCAGGAGCTCTGG + Intronic
1181411600 22:22725879-22725901 TGCTGGAGCCAGAGAAGTTGAGG + Intergenic
1183651602 22:39157956-39157978 AGCTGGTGCCATAGGACTTCAGG - Intergenic
1184281536 22:43440345-43440367 AGCTGGGGCCACAGGTGCTCTGG + Intronic
1184494338 22:44828793-44828815 GGCTGGAGACACAGGGCTTCAGG - Intronic
1185383132 22:50519286-50519308 CTCTGGAGCCCAAGGAGTCCAGG + Exonic
949599120 3:5579388-5579410 GGCTGGAGAATCAGGAGTTCTGG - Intergenic
953200255 3:40771963-40771985 CACTGGAGACACAGGATTCCTGG + Intergenic
953265209 3:41380561-41380583 TGCTGGAGCCTGAAGAGTTCTGG - Intronic
954081939 3:48217580-48217602 CACTGGAGGCACAGGAGTGCTGG + Intergenic
954461522 3:50629613-50629635 AGCTGCAGCCACAGGGGTCCAGG - Intronic
955671903 3:61411015-61411037 CGCTTGAGCCCCAGAAGTTAAGG + Intergenic
961367951 3:126413312-126413334 CTCTGGTGTCACAGAAGTTCTGG - Intronic
961384796 3:126517459-126517481 GGCTGGAGCCCCTGGAGTCCAGG + Intronic
961705929 3:128785206-128785228 CACTTGAGCCACAGGAGTTCTGG + Intronic
968090972 3:195897972-195897994 GTCTGGAGCCACAGGAATTCAGG - Intronic
968647730 4:1748784-1748806 GGCAGAAGCCCCAGGAGTTCGGG - Intergenic
968679272 4:1905487-1905509 CGCTGCCCCCACAGGAGCTCAGG - Intronic
969044589 4:4327693-4327715 CGCTGTAGCCCTGGGAGTTCAGG - Intergenic
971213809 4:24645068-24645090 TGGGGGAGCCACAGGAGTTTGGG - Intergenic
971409536 4:26355550-26355572 CCCTTGAGCCCCAGGAGTTCAGG + Intronic
972629036 4:40827682-40827704 CAGTGGAGACACAGGAGATCAGG - Intronic
976041997 4:80898045-80898067 CTCTGGAGCTTCAGGGGTTCTGG - Intronic
982116314 4:152101127-152101149 GTCTGGAGCCACAGGAGTCAAGG + Intergenic
982367502 4:154595878-154595900 CCCTTGAGCCCAAGGAGTTCAGG - Intergenic
985512064 5:318628-318650 CGCTGGAGACACAGCAGTCATGG + Intronic
988064619 5:26218605-26218627 CCCTGGAGCCACTGGACTTGGGG + Intergenic
990286421 5:54304545-54304567 GACTGGAGCCACAGAAGTTTGGG + Intronic
992849917 5:80796882-80796904 CTCTGCAGCCACAGGGCTTCTGG + Intronic
999305329 5:150515805-150515827 CTCTTGAGCCACGGGAGTTCTGG + Intronic
999698476 5:154206890-154206912 CGCAGGAGCCACAGGAGGCAGGG + Intronic
1000313056 5:160063298-160063320 TGCTTGAGCCCAAGGAGTTCAGG - Intronic
1001160120 5:169305426-169305448 GGCTGGATCCAAGGGAGTTCAGG - Intergenic
1001486086 5:172120479-172120501 GGCTGGAGACACAGAGGTTCAGG - Intronic
1001686890 5:173600006-173600028 CCCTGGAGCAACAGCAGATCTGG + Intergenic
1001833129 5:174806303-174806325 CACTTGAGCCCCAGGAGTTTGGG - Intergenic
1002827430 6:786010-786032 TGCAGGAGCCCCAGGACTTCAGG + Intergenic
1003946145 6:11077852-11077874 GGCTGAACCCACAGGAGCTCTGG + Intergenic
1004668497 6:17772323-17772345 CGCTTGAGCCCCAGGGGTTGAGG + Intronic
1005464229 6:26096043-26096065 CCATGGAGCCACTGGGGTTCCGG + Exonic
1006458354 6:34144482-34144504 CCCTGCAGCCCCAGGACTTCAGG - Intronic
1006630549 6:35427188-35427210 AGCTGGCTCCACGGGAGTTCAGG + Exonic
1006635924 6:35461129-35461151 GGCTGAGGCCACAGGAGTTCTGG - Intronic
1007114809 6:39335909-39335931 CCCTGGAGACACAGCTGTTCAGG + Exonic
1008938897 6:57023687-57023709 CGCTGGAGCCCAAGAAGTTGAGG - Intronic
1014303181 6:119709211-119709233 TGCAGCATCCACAGGAGTTCTGG - Intergenic
1018535959 6:164819038-164819060 TGCTGGAACCACAGCACTTCTGG + Intergenic
1019053412 6:169201913-169201935 CGCTGGAGGCAGAGCAGTGCAGG - Intergenic
1019072185 6:169356090-169356112 TGCTGGAGGCCCAGCAGTTCTGG + Intergenic
1019271291 7:150450-150472 TGCTGGGGGCACAGGAGCTCGGG - Intergenic
1019287914 7:232826-232848 CGCTGAAGCCACAGTTGTTAAGG + Intronic
1019655005 7:2187598-2187620 AGCTGGAACTACAGGAGTACTGG + Intronic
1023088306 7:36594352-36594374 CTCTGGTGCTACAGGATTTCTGG - Exonic
1023921108 7:44630769-44630791 CCCTGGTGCCAAAGGAGTTGGGG - Intronic
1025251615 7:57354911-57354933 CGCTGGAATCAAAGGAGGTCAGG + Intergenic
1028328069 7:89551155-89551177 TACTGAAGCCACAAGAGTTCTGG - Intergenic
1028754448 7:94419530-94419552 TGCTGGAGCCACAGGTGACCGGG + Exonic
1031990030 7:128191514-128191536 CACTGGAACCACATGAGTTTGGG - Intergenic
1032106316 7:129034300-129034322 TGCTTGAGCCCTAGGAGTTCAGG + Intronic
1033543546 7:142379582-142379604 CTCTTGAACCACAGGAGTCCTGG + Intergenic
1035536278 8:393648-393670 TGCTGGAGTCACTGGAGTGCAGG - Intergenic
1035545024 8:473654-473676 TGCTGGTGCCACAGGGGTCCTGG + Intergenic
1036800143 8:11784950-11784972 CGCTTGAGCCACAGAGGTTGAGG - Intronic
1036808408 8:11850868-11850890 AGCAGGAGCCACAGGAGCCCTGG + Exonic
1038245522 8:25851207-25851229 CCCTGGAGCCTTAGGAGTTATGG - Intronic
1043987878 8:86715398-86715420 CAGTGGAGCTACAGGACTTCAGG - Intronic
1044668609 8:94655971-94655993 CGCTTGAATCCCAGGAGTTCTGG + Intronic
1045814963 8:106269250-106269272 TGCTGGATGCACAGGAGATCTGG + Intergenic
1046951699 8:120025736-120025758 AGCTAGAGCCACAGTAGTACTGG - Intronic
1048981035 8:139703500-139703522 AGCTGGACCCACAGGGGTACCGG - Intergenic
1049573531 8:143380340-143380362 CGCAGGGGCCCCAGGAGTGCTGG + Intronic
1055470549 9:76606336-76606358 CGCTTGAGGCGCAGGAGGTCAGG - Intergenic
1056812699 9:89776681-89776703 TGCTGGTGCCACATAAGTTCTGG - Intergenic
1057216981 9:93234581-93234603 ACCTGGAACCACAGGAGTCCAGG - Intronic
1060547306 9:124469035-124469057 CATTGGAGCCACAGTAGTTTGGG - Intronic
1061020507 9:128011299-128011321 GGCTGCAGCCACAGGAGCCCTGG - Intergenic
1061311483 9:129766095-129766117 CGCTGGAGACCCAGGAGAGCTGG + Intergenic
1061776191 9:132966273-132966295 CACTTGAGCCCCAGGAGTTGAGG + Intronic
1062263440 9:135675186-135675208 TCCTGGAGCCACAGGTGTGCAGG - Intergenic
1187263555 X:17709747-17709769 TGCTGGTGCCTCAGGAGCTCTGG + Intronic
1189641397 X:43075785-43075807 GGCTGGAGCCACAGTGTTTCAGG + Intergenic
1189665964 X:43355081-43355103 CCCTGCAGCTACAGGAGATCAGG + Intergenic
1192435988 X:71144230-71144252 CTGAGGAGCCACAGGAGTACAGG + Intergenic
1196175320 X:112633705-112633727 GGGTGGGACCACAGGAGTTCAGG - Intronic
1198302140 X:135343583-135343605 GGCGGGAGCAGCAGGAGTTCTGG + Exonic
1201788312 Y:17809103-17809125 GGCTGAAGCCGCAGGAGTGCAGG - Intergenic
1201813241 Y:18096885-18096907 GGCTGAAGCCGCAGGAGTGCAGG + Intergenic