ID: 904256296

View in Genome Browser
Species Human (GRCh38)
Location 1:29257153-29257175
Sequence GAAAGAACAAAGTGTCAGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 432
Summary {0: 1, 1: 1, 2: 2, 3: 24, 4: 404}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
904256291_904256296 10 Left 904256291 1:29257120-29257142 CCGAGGAGGAGGCAGAGGGAGCA 0: 1
1: 2
2: 29
3: 142
4: 905
Right 904256296 1:29257153-29257175 GAAAGAACAAAGTGTCAGATTGG 0: 1
1: 1
2: 2
3: 24
4: 404

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904256296 Original CRISPR GAAAGAACAAAGTGTCAGAT TGG Intronic
902270649 1:15302024-15302046 GAAAGAAAAAAGTCTAAGACAGG + Intronic
903053660 1:20620119-20620141 GGCAGAACCAAGTGTCAGGTGGG + Intergenic
904140311 1:28347953-28347975 GGTACAACAAAGTGTCAGGTGGG - Intergenic
904256296 1:29257153-29257175 GAAAGAACAAAGTGTCAGATTGG + Intronic
904862938 1:33552987-33553009 GAAAGAAAAGATTGTCAGATAGG + Intronic
905236119 1:36550278-36550300 AAAAGTAAAAATTGTCAGATTGG - Intergenic
906242991 1:44253549-44253571 GAAAGAAGAACATGTGAGATGGG - Intronic
908417225 1:63924975-63924997 GAAAGAAAAAGGTGTCATCTGGG - Intronic
908504661 1:64784445-64784467 GAAAGAACACATAGGCAGATAGG - Intronic
909535025 1:76726743-76726765 GCAAGAACAAAGTGCCACCTGGG - Intergenic
911352556 1:96772526-96772548 CAAAGTACAAAGTTTCAGACAGG - Intronic
911781308 1:101882926-101882948 GAAAGATAAAATTGTCAAATGGG - Intronic
912124422 1:106516535-106516557 AAAAGAACAAAGTGACTGATGGG + Intergenic
915431087 1:155867706-155867728 GAAAGAACATAGAGTCAAGTGGG + Intronic
915460364 1:156066938-156066960 TCAAGAAAAAAGTGTCAGCTGGG + Intronic
916476142 1:165170733-165170755 AAAAGGACAAAGAGTAAGATAGG - Intergenic
916622317 1:166512722-166512744 GTAACAACAAAGTGTAATATTGG - Intergenic
916779163 1:168005676-168005698 GTAAGAATAAAGTGACAGCTTGG - Intronic
916960053 1:169880512-169880534 GAAAGAAAAAACTATCAGCTTGG + Intronic
918466949 1:184830322-184830344 GAAAAACAAAAGTGTCAGAAGGG - Intronic
918466958 1:184830440-184830462 GAAAGAAGCAAGTCTCAGGTTGG + Intronic
918505692 1:185251743-185251765 CAAAAAACAAATTGTCTGATTGG - Intronic
919279317 1:195466710-195466732 GGAAGACCAAAGAGTCAGCTTGG - Intergenic
919504373 1:198379683-198379705 GGAAGAAAAAAGTGCCACATTGG + Intergenic
921938636 1:220817377-220817399 GAAAGAACAAAGCTTCGGAAGGG + Exonic
921956398 1:220988407-220988429 TAAAGAATTAAGTGTAAGATTGG - Intergenic
922121320 1:222672030-222672052 GAAAGAACAAAATGTGAAACAGG + Intronic
923325467 1:232876504-232876526 GAAAGAGCAAAGGGAAAGATGGG - Intergenic
923719744 1:236456687-236456709 GAAAGAAAAGAGGGTCAGAGAGG - Intronic
924669403 1:246107993-246108015 GAAAGAGCAAAATCTAAGATAGG + Intronic
1063107899 10:3009531-3009553 GAATAAACTAAGTGTCAGACTGG + Intergenic
1063661441 10:8037124-8037146 GAATGAATAAAGTGGCAGAGGGG - Intergenic
1064292528 10:14048940-14048962 GTAACAACAAAGTGTCTTATTGG + Intronic
1067006046 10:42664290-42664312 GAAAGAATAAAGTATTGGATTGG - Intergenic
1067275101 10:44827070-44827092 CCAAGAACAAAGTGTCAGCAGGG - Intergenic
1068202760 10:53804521-53804543 GAAAGAAAAAAATGTGAGAAAGG + Intronic
1069101507 10:64327276-64327298 AAAAGAACATTCTGTCAGATTGG + Intergenic
1069618388 10:69820759-69820781 GAGGGAACACAGTGACAGATGGG - Intronic
1069734896 10:70647640-70647662 GAGAGAAGAAAGCTTCAGATGGG - Intergenic
1069761560 10:70815208-70815230 GAAAAAACTAAGTCTCACATAGG - Intergenic
1069761583 10:70815353-70815375 GAAAAAACTAAGTCTCAGCTGGG - Intergenic
1070493190 10:76996464-76996486 GTAAAAACAGAGTGGCAGATCGG - Intronic
1070712569 10:78693480-78693502 GAATGAACAATGTGTCAGCAGGG + Intergenic
1070916464 10:80158265-80158287 GAAAGGACCAAGAGTCAGAGGGG + Intronic
1071178281 10:82953316-82953338 TAAAGAAGAAAATGACAGATAGG + Intronic
1072027765 10:91479002-91479024 TAAAGAAGAAAGTGTCAGTCTGG + Intronic
1072049001 10:91684836-91684858 TAAAGAACAAAGAGCCAGATTGG - Intergenic
1072615219 10:97044738-97044760 GAAAACACAAAGTGTCATTTTGG - Intronic
1074163511 10:110854840-110854862 TAAAGAAAAAAGTGTCAGGAGGG + Intergenic
1074430790 10:113392620-113392642 GAAAGAAAAAAGTGTGAGCCAGG + Intergenic
1076191609 10:128487281-128487303 GAGAGAACAAGCTGTCAGGTTGG - Intergenic
1077807780 11:5606850-5606872 GAAAGAACAATGTCTGTGATGGG - Intronic
1078464133 11:11538204-11538226 GAAAGGTCAAGGTGTCAGATTGG - Intronic
1079487871 11:20954299-20954321 GAAAGAACAAGGAGTAAGTTTGG - Intronic
1079589718 11:22167478-22167500 AACAGAAGAAAGAGTCAGATGGG - Intergenic
1081013461 11:37845389-37845411 GAAAGAAAAAAGAGTCATACTGG + Intergenic
1083566990 11:63727472-63727494 GAAACAAAAAAGAGTCAGGTGGG + Intronic
1084579373 11:70013475-70013497 GCCATAACAAAGTGTCAGCTGGG + Intergenic
1085430950 11:76447134-76447156 GAAACAACAATGAGTAAGATGGG - Intronic
1085716044 11:78874220-78874242 GAAAAAACTAAGAGTCAGGTTGG - Intronic
1086208982 11:84295419-84295441 GAAAGAAAAAAGTGGCAGCCTGG - Intronic
1086845547 11:91745413-91745435 GAAAGAGCAAATTGGTAGATTGG - Intergenic
1087217020 11:95505401-95505423 GAATGAACAAATGGCCAGATAGG - Intergenic
1087237875 11:95740295-95740317 CAATGACCAAACTGTCAGATAGG + Intergenic
1088564811 11:111158687-111158709 AAAAGCAAAAATTGTCAGATTGG - Intergenic
1089703066 11:120257336-120257358 GAAAGAACAAAATAGCAGAAAGG - Intronic
1090104725 11:123840602-123840624 GAGAAAACAAATGGTCAGATAGG + Intergenic
1090256890 11:125290870-125290892 GACAGAGCAGAGTGTCATATGGG + Intronic
1090470976 11:126980932-126980954 GAAAGAACCAAGATTCAGTTAGG + Intronic
1090518329 11:127452081-127452103 GAAACAACACGGTGCCAGATGGG - Intergenic
1091157515 11:133387207-133387229 GAGAGTACAAAATGTGAGATAGG - Intronic
1091308031 11:134552598-134552620 GAAAGAACAAACTGACAAGTTGG + Intergenic
1094208131 12:27862144-27862166 GAAAGAACAGGTTTTCAGATAGG + Intergenic
1094652485 12:32391302-32391324 GAAAAAAGATTGTGTCAGATTGG + Intergenic
1094736394 12:33239623-33239645 AAGAGGACAAAGTTTCAGATTGG - Intergenic
1095971979 12:47908337-47908359 GGAAAAACAAACAGTCAGATGGG - Intronic
1096538927 12:52292813-52292835 GGAAGCATAAAATGTCAGATTGG + Intronic
1097126386 12:56779076-56779098 AAAAAAAAAAATTGTCAGATTGG - Intronic
1098825296 12:75288912-75288934 GAAAGGACCAAGGATCAGATGGG + Intronic
1099234117 12:80061989-80062011 CAAAGAATAAAATTTCAGATAGG - Intergenic
1100668473 12:96782747-96782769 GAAAGAACAAAAGGCAAGATTGG + Intronic
1102746929 12:115257383-115257405 CAAGGAACAAAGTGGCAGAGAGG + Intergenic
1105534241 13:21248884-21248906 GAAATAACAAATTTTAAGATAGG - Intergenic
1106275841 13:28205540-28205562 GAAAGAATAAAGTGTGGGCTGGG + Intronic
1106536813 13:30651963-30651985 GAAAAAAAAAAAGGTCAGATAGG + Intronic
1108833979 13:54517307-54517329 GAAAGAAGAAAGTTTTAGTTTGG + Intergenic
1109109678 13:58300877-58300899 GAAAGAACAAACTGTAAGAGAGG + Intergenic
1109738211 13:66515112-66515134 TAAAGAACAAAGGCTCAGAAAGG + Intronic
1111728761 13:92045710-92045732 GAAAGAATAAAGTTTCAGGAGGG + Intronic
1111907641 13:94273487-94273509 GAAAGAAAAAACTCTGAGATAGG + Intronic
1112044339 13:95580710-95580732 GAATGAACAAAGTGGCACATGGG + Exonic
1112567682 13:100565288-100565310 GAAAGATCAGAGTGTCAAAAGGG + Intronic
1112997920 13:105597023-105597045 GAAAGAAGAGAGTTTCATATAGG + Intergenic
1113172963 13:107527131-107527153 GAAAAAAATAAATGTCAGATAGG + Intronic
1114932310 14:27488355-27488377 GTAAGAAGAAAGTATCAGAAAGG + Intergenic
1115703054 14:35974419-35974441 GTAAGAAGAAAATGTGAGATGGG - Intergenic
1115757848 14:36547540-36547562 GAAAGAAAAAAATGGGAGATGGG - Intergenic
1116017318 14:39422775-39422797 AAAGGAACAAAATGTCAAATTGG + Intronic
1116974360 14:51099291-51099313 TAAAGAAAAAAGAATCAGATTGG + Intergenic
1117155086 14:52931266-52931288 AAAAGAACAAAATGTCACAGAGG + Intronic
1117601468 14:57380202-57380224 CAAATAATAAAGTGTCAGAAGGG - Intergenic
1117839220 14:59841375-59841397 AAAAGAAGAAATTGTCAGACTGG + Intronic
1118441811 14:65819441-65819463 GAAAGAACAAAGTTACAATTTGG + Intergenic
1118481375 14:66170426-66170448 GAAAGAACACAGTTTCTTATCGG + Intergenic
1118977366 14:70689193-70689215 AAAAGAACAAAGAGCAAGATGGG + Intergenic
1121494097 14:94380112-94380134 GAAAGAACAAAGAGGCTGAGAGG - Intronic
1122994526 14:105255712-105255734 GACTGAACAAAGTGACAGAGTGG - Intronic
1124343004 15:28901968-28901990 GGAAGAATAAAGGGCCAGATGGG + Intronic
1124795373 15:32773089-32773111 TAAAGACAAAAGTGTCAGAGAGG + Exonic
1124796236 15:32783378-32783400 GAAAGACACAAGTGTAAGATGGG + Intronic
1125133586 15:36313704-36313726 GAAAGACCAATGTGTCATTTTGG - Intergenic
1127405223 15:58637328-58637350 GAATGAACATAGTCTCAGTTCGG - Intronic
1128128194 15:65208348-65208370 GAAAGAACATGGGGTCAGCTGGG - Intronic
1128568986 15:68719641-68719663 GAAAGAAAAATGTCTCAGAATGG - Intronic
1128917060 15:71572785-71572807 CAAAGAACAAAGTGACACACAGG + Intronic
1130265480 15:82398214-82398236 GAAAGAACTAAGAATCAGATAGG - Intergenic
1130506530 15:84548671-84548693 GAAAGAACTAAGAATCAGATAGG + Intergenic
1131352751 15:91716719-91716741 GAAAGCACAAAAGGTCAGTTTGG - Intergenic
1133425263 16:5682987-5683009 GAATGAACAAAGGTTCAGAGAGG - Intergenic
1133821526 16:9241377-9241399 GACAGAACAGAGTGTCAGGCAGG - Intergenic
1135182895 16:20290868-20290890 AAAGGAACAAAGTCTCAGAGAGG - Intergenic
1135250218 16:20894848-20894870 GAAAGAAGAGAATGGCAGATAGG - Intronic
1135796491 16:25448409-25448431 GAAAGAACAAAGAGTTAGAAAGG + Intergenic
1136072319 16:27795167-27795189 GAAAAAAAAAAGAGTCAGTTTGG - Intronic
1136072799 16:27798425-27798447 GAAAGAACAGGGTGTGAAATAGG + Intronic
1136619095 16:31416165-31416187 GAAAGACTAAGATGTCAGATGGG + Intronic
1136679276 16:31946124-31946146 AAAAGATCAAAGTGTGAGAAGGG + Intergenic
1138128108 16:54455381-54455403 GAAAAAACAATGTTTCAGATGGG + Intergenic
1138806667 16:60098223-60098245 GAAACAACAAAATGTCAAAAAGG - Intergenic
1140150297 16:72356485-72356507 AAAAGAATAAACTGTCGGATGGG + Intergenic
1140306360 16:73806663-73806685 CAAAGGACAAAGTGTCAGTGGGG - Intergenic
1141747179 16:85933594-85933616 AAAAAAAAAGAGTGTCAGATGGG + Intergenic
1141975528 16:87513485-87513507 GAGCTAACAAACTGTCAGATGGG - Intergenic
1142786988 17:2232101-2232123 GAAAAAAAAAAGGGCCAGATTGG + Intronic
1142803686 17:2360672-2360694 GACAGAACAAAGTCTGAGCTTGG - Intronic
1143060214 17:4194263-4194285 GAAAAAACAAATTATCAGCTGGG - Intronic
1143473923 17:7192431-7192453 GAAGGAACAAGGAGACAGATGGG + Intronic
1143871986 17:9963724-9963746 GAAAGAAAAAAGAGAGAGATGGG - Intronic
1144611001 17:16715330-16715352 GAAAGAAAAAGGTTTCACATGGG + Intronic
1145060015 17:19727344-19727366 AAAAGAACTCAGTGTCAGAATGG + Intergenic
1146766098 17:35523186-35523208 GAGAGAGCAAAGTCTCAGAGAGG - Intronic
1146834589 17:36100085-36100107 GAAGAAACAAAGTGTCAGGAAGG - Intergenic
1148458588 17:47824461-47824483 GGAAGAACACAGGGTCAGTTAGG + Intronic
1149100397 17:52899305-52899327 AAAAGAACAAAGAGATAGATAGG - Intronic
1150659914 17:67066182-67066204 ATATGAACAAAGTGTCAAATAGG - Intergenic
1151525377 17:74662386-74662408 GATAGAACACTGTGTCAGAGAGG + Intergenic
1153024645 18:661522-661544 GAAACATAAAACTGTCAGATCGG + Intronic
1153453219 18:5252636-5252658 GAAAGAACAGAGAGGCACATAGG + Intergenic
1153513699 18:5884350-5884372 AAATGAAGAAAATGTCAGATAGG - Exonic
1153981631 18:10315378-10315400 AAAAGAGCAGAGTGTCAGACTGG - Intergenic
1153994932 18:10432519-10432541 GGAAGAATAAAGGTTCAGATGGG - Intergenic
1154151620 18:11910602-11910624 TAGAGAACAAAGTGAGAGATAGG + Intergenic
1155071246 18:22318276-22318298 GAAAGAGGCCAGTGTCAGATGGG + Intergenic
1155354865 18:24942341-24942363 GAAAGAACACAGGGTTGGATGGG - Intergenic
1156136464 18:34045516-34045538 GAAAGAAAAGAATGTCAGACTGG - Intronic
1156472724 18:37387761-37387783 GAAGGAGCAAAGGGTCAGACTGG - Intronic
1158294030 18:55974189-55974211 GAAAACATAAAGTTTCAGATGGG - Intergenic
1158842586 18:61404055-61404077 GGAAGAACACACTGTCAGAGTGG + Intronic
1158945603 18:62444609-62444631 GAAAGGAAAAAGCCTCAGATGGG + Intergenic
1160545087 18:79647976-79647998 GAAAGAACAAAGTTGGAGAATGG + Intergenic
1162968535 19:14166966-14166988 GGTAGAACAAAGTGTGAGTTAGG + Intronic
1163953276 19:20611274-20611296 GAAAAAACAAAGAGAAAGATAGG + Intronic
1164612276 19:29640653-29640675 GAAAGAAAAAAGAGTCAGCACGG - Intergenic
1164685361 19:30163004-30163026 GAATGGACAAATTGACAGATGGG - Intergenic
1165587827 19:36935907-36935929 AAAAGGACAGATTGTCAGATTGG - Intronic
1165787147 19:38468459-38468481 GAAAGAACAAAGTGTAAGTAGGG - Intronic
1166208702 19:41291181-41291203 GACAGAACACAAGGTCAGATTGG - Intronic
1168099698 19:54134397-54134419 GAAAGAGCAAAATCTCAGACAGG - Intergenic
925282922 2:2697308-2697330 AAGGGAACAAAGTTTCAGATGGG - Intergenic
926278008 2:11420244-11420266 GAAAGAACAAAGTATTAAAAAGG + Intergenic
926545015 2:14228988-14229010 TAATGAACATAGTATCAGATAGG + Intergenic
926724883 2:15989960-15989982 GAAGAAACAAAGGGTCAGAGAGG + Intergenic
926845396 2:17131720-17131742 GAAAAAAAAAAGTGTAGGATTGG - Intergenic
927051616 2:19335849-19335871 GCAAAATCAAAGTGTCAGCTGGG - Intergenic
927326775 2:21813961-21813983 GAAAGAACTAAGGTTCAGTTAGG + Intergenic
927441972 2:23125318-23125340 GAAAATAGAAAGCGTCAGATGGG + Intergenic
927791654 2:26014861-26014883 GGAAAAAAAAAGTGTCAGAGGGG - Intergenic
928134369 2:28677175-28677197 GAAAAAACAAAGACTCAGAGAGG - Intergenic
929319107 2:40519392-40519414 GAAGGCACAGAGTGTCAGATTGG - Intronic
929743634 2:44631651-44631673 AAAAGAAAAACTTGTCAGATGGG - Intronic
930648370 2:53937150-53937172 GAAAGAAAAAATTGTCAGAAGGG - Intronic
931859896 2:66344144-66344166 CAAAGAACAAATTGAGAGATTGG - Intergenic
932672338 2:73749130-73749152 GAAAGAGCAAGGTGTCAGCAGGG - Intergenic
933421893 2:82058892-82058914 AAAAGCACAGATTGTCAGATGGG - Intergenic
934462380 2:94224469-94224491 GAAAGAAAAGAGTGTAATATCGG - Intergenic
935306009 2:101737144-101737166 AAAAGCACTAAGTGTCAGAATGG - Intronic
936675728 2:114711644-114711666 GTAAAAACAAAGGGTCAGGTTGG - Intronic
936843126 2:116798103-116798125 GACAGAATAAAGTGTGAAATGGG + Intergenic
936894402 2:117410152-117410174 TAAAGTACAAAGTGGCATATTGG + Intergenic
937015818 2:118604422-118604444 GAGAGAACAATGTGTGAGACAGG + Intergenic
937516445 2:122661101-122661123 GAACAAAGAAAGTGTCAGAGGGG + Intergenic
937527185 2:122786009-122786031 GAAAGAAAGAACTGTCTGATTGG - Intergenic
939504110 2:143024610-143024632 TAAAGAAAGAAATGTCAGATTGG - Intronic
940282537 2:152002607-152002629 GATAGAACCAAGTCTCAGAGAGG - Intronic
940391180 2:153134379-153134401 GAAATGACAAAGGGTAAGATTGG - Intergenic
940524101 2:154790354-154790376 AAAACAACAGAGTGTCAGAGAGG - Intronic
941158289 2:162005006-162005028 GAATGATCAAAGTGCCAGAAGGG + Intronic
941627173 2:167842926-167842948 GAAAGAAATAAATGTCAGAAAGG - Intergenic
943249263 2:185496043-185496065 AAAGGAAGAAAGTCTCAGATGGG - Intergenic
943857574 2:192817602-192817624 GAAAACACAAAGCGTCAGAAAGG + Intergenic
944023155 2:195130218-195130240 GAAAGAAAAAAGTGATAGAATGG - Intergenic
944205093 2:197150230-197150252 TAAAGAAAAAAGTTTCAGGTTGG - Intronic
944212581 2:197221830-197221852 GAAAGCACAAAAAGTCAGAGAGG + Intronic
945151743 2:206798933-206798955 GAAATAACAAAAAGTCACATAGG + Intergenic
946324041 2:218974158-218974180 GAGAAAACTAAGTGTCAGAATGG + Intergenic
946493031 2:220168328-220168350 CAAAGAACGAAGTCTCAGAAAGG - Intergenic
946829053 2:223708951-223708973 GAAAGAACAGAGACTCAGAATGG + Intergenic
947392397 2:229652634-229652656 GACAGAAGAAAGTGTCAGGCAGG + Intronic
948311753 2:236992388-236992410 CAGAGAAGAAAGTGCCAGATAGG - Intergenic
948745798 2:240092846-240092868 AAAAGAAAAAAGTGACAAATGGG - Intergenic
948982263 2:241500411-241500433 AACAGAACTAAGTTTCAGATGGG + Intronic
1170163216 20:13336975-13336997 GAAATAAAACAGTTTCAGATAGG + Intergenic
1170544646 20:17425247-17425269 GAAACCCCAAAGTGTCAGACAGG + Intronic
1171078894 20:22157249-22157271 GAGAGAACAAAGTTTGAGAAAGG + Intergenic
1171800978 20:29616897-29616919 GAAAGAACAGAGTGACTGAGAGG - Intergenic
1172982321 20:38953116-38953138 TAAAGAGAAAAGTGTCAGAGGGG - Intergenic
1173403633 20:42746297-42746319 GAAAGAGAAAAATGACAGATGGG - Intronic
1174768632 20:53276890-53276912 CAAAGGACAGAGTGTCAGACAGG - Intronic
1175043866 20:56083491-56083513 GAAAGAAAAAACTTCCAGATTGG - Intergenic
1178471381 21:32896143-32896165 AAAAAAAAAAAGTGTAAGATTGG - Intergenic
1179169684 21:38963154-38963176 ACAAGACCAAAGTGTCAGCTGGG - Intergenic
1179707664 21:43191626-43191648 GAAGGAACAGGGTGTCAGGTGGG + Intergenic
1179940486 21:44636604-44636626 GGATGAGAAAAGTGTCAGATGGG - Intronic
1179962923 21:44780874-44780896 GAAAGTAAAAAGTGTTAGAAAGG - Intronic
1180733557 22:18000148-18000170 TATGGAGCAAAGTGTCAGATGGG + Intronic
1181020283 22:20097480-20097502 GAAATAAAAAAGGGTCATATGGG - Intronic
1181682367 22:24504276-24504298 GAAGGAACATATTTTCAGATGGG - Intronic
1182199003 22:28550311-28550333 GAAAGCACAAAATGTCAGTAAGG + Intronic
1184218618 22:43084447-43084469 GAAGGAAAAAGGTGTCAGCTGGG - Intronic
1184307130 22:43612283-43612305 GAAAGAAAAAATTGACAAATGGG + Intronic
949621401 3:5816238-5816260 AAAAGAACAAACTGACAAATCGG - Intergenic
949664648 3:6323242-6323264 GAAAAAACAAAGGCTCAGATAGG + Intergenic
949950686 3:9226318-9226340 GAAAGCAGAAAATCTCAGATTGG + Intronic
950150581 3:10683964-10683986 GAAAGAGCACAGTGTCAGAAGGG - Intronic
950181012 3:10913283-10913305 AAAAGAACTAAGTGGCAGATTGG + Intronic
950533089 3:13564429-13564451 ATAAGAACAAAGTCTCAGGTTGG - Intronic
951164500 3:19468471-19468493 GAAAGAACAAATTGAAAGAACGG + Intronic
952597150 3:35031899-35031921 AAAAGAACTAAGGGCCAGATAGG - Intergenic
952849857 3:37719056-37719078 GCAAAAACAAAGTGTCATATTGG + Intronic
954868956 3:53752378-53752400 TAAAAAACAAAGTGTCTGAGGGG - Intronic
957991139 3:87628614-87628636 GAAAGAACTCAGATTCAGATAGG - Intergenic
959199757 3:103231974-103231996 GAAAGAAGAAAGTGCCTGAGTGG + Intergenic
959607103 3:108253147-108253169 GAAAAAAAAAAGTTTCAAATTGG - Intergenic
959731706 3:109611561-109611583 GAAATAAAAAAGTGTAGGATAGG + Intergenic
959833484 3:110891847-110891869 GAAAAAAGAAAGTGGCAGAGTGG + Intronic
960205640 3:114894199-114894221 GAGAAAACAAAATGTCAGAGAGG - Intronic
960530577 3:118759569-118759591 GCAAGAGCAAAGTGACAGAAAGG - Intergenic
960595129 3:119401462-119401484 GAAAAAATAAAGAGACAGATGGG - Intronic
962904663 3:139790765-139790787 GTAAAAATAAAGGGTCAGATAGG + Intergenic
963710482 3:148741559-148741581 GAAAGCACAAACTGTAATATTGG - Exonic
965059342 3:163763869-163763891 GAAAGACTAAAGTGTTAGAATGG + Intergenic
965134628 3:164746553-164746575 GAAAGAACAAATTGATAAATTGG - Intergenic
965531192 3:169772608-169772630 GAAAGATCAAAGTGTAAAAGTGG + Intergenic
965634171 3:170764256-170764278 AAAAGAACAAAGGCTCAGAGAGG - Intronic
965992987 3:174843686-174843708 CAAAGACAAAAGTGTCAGACAGG - Intronic
966162583 3:176983835-176983857 AAAGGAAAAAAGTCTCAGATGGG + Intergenic
966357111 3:179092530-179092552 TAAAGAACATAGTCTCAGCTGGG - Intergenic
966462471 3:180192316-180192338 CAAAGAAAAAACTGTCAGTTGGG - Intergenic
967330240 3:188282809-188282831 GAAAGTACAAACTGTGTGATGGG - Intronic
967995651 3:195164465-195164487 GAAGGAACAAAGTGTGAGGCAGG - Intronic
968453452 4:685922-685944 GGATGCACAAAGTGTCAGCTCGG + Intronic
969560361 4:7942824-7942846 GAAAGAAGAAAGTGTGTGATGGG - Intergenic
970840347 4:20461454-20461476 GAAAGCTCAAAGTGTCATAAAGG - Intronic
971112013 4:23596805-23596827 GAAAAAACTAAGTTTCAGAGAGG - Intergenic
971495260 4:27257778-27257800 GGAAGAACAAAGTTGCTGATGGG - Intergenic
971546664 4:27894972-27894994 AAAAAAACAAAGAATCAGATGGG - Intergenic
971860389 4:32094387-32094409 GGAAAAAGAAAGTCTCAGATGGG - Intergenic
972027794 4:34408637-34408659 GAAAGAACAAAGAGTAAAATTGG + Intergenic
972995827 4:44878624-44878646 GAAGGAAGAAAGCTTCAGATGGG - Intergenic
974193408 4:58537889-58537911 GGAAGAAAAATGTGTCAGAAAGG - Intergenic
974635215 4:64555256-64555278 GAAAGAACCAGGGGTCATATCGG + Intergenic
974934508 4:68396798-68396820 GAATGAACAAAGTATCTCATTGG + Intergenic
974974691 4:68875820-68875842 AAAATAACAAAGTGTAAGAAAGG - Intergenic
975886194 4:78968364-78968386 GAAAGAACAAACTGACAAATTGG - Intergenic
977354539 4:95928385-95928407 TCAAGAACAAAGTCTAAGATAGG + Intergenic
978733552 4:112059533-112059555 GCAAGAACGATGTCTCAGATCGG - Intergenic
979433228 4:120657744-120657766 GAAAGAAGAAAGTGAGAGAGAGG + Intergenic
980320939 4:131274129-131274151 AAAAGAACAAATTGACATATGGG + Intergenic
980346217 4:131623782-131623804 GAAAGAAAAAAGAGGCAAATGGG - Intergenic
981361499 4:143850926-143850948 TAAGGTATAAAGTGTCAGATAGG - Intergenic
981372244 4:143971920-143971942 TAAGGTATAAAGTGTCAGATAGG - Intergenic
981381321 4:144075119-144075141 TAAGGTATAAAGTGTCAGATAGG - Intergenic
981478620 4:145213160-145213182 GAAAGAACAGGGGGTCAGAGAGG - Intergenic
981775295 4:148360301-148360323 GAAAGCACATAGTGTCATGTAGG - Intronic
984281785 4:177679161-177679183 GAAAGATCAAATTTTCAGTTCGG + Intergenic
986281641 5:6327940-6327962 GAAAGGAGAAAGGGTCAGAAAGG - Intergenic
986741929 5:10712227-10712249 GAAAGACCAAGGTGTCAGCAGGG - Intronic
987022252 5:13886695-13886717 GAAACAACAGACTGTCAGTTAGG + Intronic
991156101 5:63437871-63437893 GTATCAACAGAGTGTCAGATAGG - Intergenic
991558930 5:67928474-67928496 AAAAGAACAAATTGTTAAATTGG - Intergenic
993701533 5:91124640-91124662 GATAGAAAAAAATGACAGATGGG + Intronic
994289924 5:98016923-98016945 GAAATAACAAAGTGTGAGTAAGG - Intergenic
994675110 5:102811270-102811292 GAAACATCAAGGTGTCAGAAGGG + Intronic
995130804 5:108628510-108628532 AAAAGAACACAGAGTCAGCTAGG + Intergenic
995274802 5:110265908-110265930 GAAAGGACAACCTGTCAGAATGG + Intergenic
995298967 5:110555934-110555956 AAAAGTACAAAGTGGCAGGTTGG - Intronic
995995599 5:118294674-118294696 CAAAGAGCAAAGTGTTAGAGAGG + Intergenic
996555096 5:124770147-124770169 GAAAGAATAAAGTATCTGAAGGG + Intergenic
997150649 5:131491421-131491443 GAAAGAACAAAATTTTAAATGGG + Intronic
998949159 5:147374401-147374423 GAAAGTACAAAGTGAGAGAAAGG + Intronic
999086112 5:148891823-148891845 GAGAGAAAAAAATGGCAGATAGG + Intergenic
999216490 5:149939991-149940013 GAAAAAAAAAAGTGGCAGACTGG - Intronic
999259113 5:150227248-150227270 GAAATTACAAAGTGGCAGAGAGG + Intronic
999987598 5:157019154-157019176 GAAAGAAAAAAGTGACAAGTTGG + Intergenic
1000011401 5:157236675-157236697 GTAGGAACAGAGTGTTAGATAGG + Intronic
1000435718 5:161205659-161205681 GAAAGAAAAAGCTTTCAGATTGG + Intergenic
1000871363 5:166581317-166581339 GCAGGAACAAAGGGACAGATTGG + Intergenic
1001977522 5:176012351-176012373 CAAAGAACAAAGTGATAAATTGG + Intronic
1002367939 5:178728162-178728184 GAAAAAACAAAGTCACAGAGAGG - Intronic
1003485135 6:6569059-6569081 GAAAGACCAGTGTGTCAGGTGGG + Intergenic
1004456121 6:15792924-15792946 CAAAGATCAAGGTGTCAGCTGGG + Intergenic
1004808807 6:19236325-19236347 GAAGAAACAAATTGTCAGACTGG + Intergenic
1005269633 6:24149320-24149342 AAAAGAACATATTGTCATATTGG - Intronic
1005380529 6:25229699-25229721 GAAACCACAGAGTGACAGATTGG + Intergenic
1005637912 6:27768704-27768726 GAAAGAACAAAGTGACAGATTGG - Intergenic
1006049144 6:31327145-31327167 GAAAGCAAAAATTGTCAAATGGG + Intronic
1007130754 6:39471290-39471312 GAAAGGTCAAAGAGTCAGAGAGG - Intronic
1008750734 6:54731082-54731104 AAAAGAAAAAATTGACAGATTGG + Intergenic
1009730756 6:67602543-67602565 CAAAGAAAAAAGTGTCAGCAAGG - Intergenic
1010094263 6:72021579-72021601 GAAAGAACACAGTGTCAGTTGGG + Intronic
1010339251 6:74728753-74728775 GAAAGAACTCAATGTCAGACAGG + Intergenic
1010968583 6:82240277-82240299 GAAAGAAAGGAGTGTTAGATTGG - Exonic
1012280435 6:97321723-97321745 GAGGGAAATAAGTGTCAGATAGG - Intergenic
1012790532 6:103688373-103688395 GGAAGAAAATAGTGTCAAATAGG + Intergenic
1014019034 6:116566704-116566726 GTAAGAACAAAGTATAAGGTGGG - Intergenic
1015652241 6:135476907-135476929 AAAAGTAGAAAGTGTCAGATTGG - Intronic
1015752677 6:136576266-136576288 GAAATAAGAAAGTGTCAAAAAGG - Intronic
1016075605 6:139792380-139792402 GAAAGACAAATGTGTAAGATTGG - Intergenic
1016606154 6:145930347-145930369 AAAAGAAAAAAGTTTCATATCGG - Intronic
1016646289 6:146412250-146412272 GAAAGAACGATATGTCAGCTAGG - Intronic
1017382546 6:153847079-153847101 GAAAGATCAAAGTGGTAGCTAGG - Intergenic
1017547276 6:155466154-155466176 GAAAGAAAAAAGGATGAGATTGG + Intergenic
1018680394 6:166259464-166259486 TAAAGAACCAAGTTTCAGGTTGG - Intergenic
1020224048 7:6265726-6265748 GAAAGAGCAAACTTTCAGAGAGG + Intronic
1020603136 7:10302105-10302127 GTAAGGACAAAATGTCAGTTTGG - Intergenic
1020644670 7:10800288-10800310 GAAAAAAAAAAGTATCTGATTGG + Intergenic
1020759428 7:12249929-12249951 GCCAGAATGAAGTGTCAGATGGG + Intergenic
1021503489 7:21355450-21355472 GAAAGAGCAAAATGTCAGATTGG + Intergenic
1021972356 7:25977975-25977997 GAGAGAAGCCAGTGTCAGATGGG + Intergenic
1022168990 7:27804675-27804697 GAAAAAATAATGTGGCAGATGGG + Intronic
1022407393 7:30103864-30103886 TAAAGAAAAAAGTGACAAATTGG + Intronic
1022583178 7:31577827-31577849 GAAACACGAAAGTTTCAGATTGG - Intronic
1023012413 7:35936076-35936098 GAATGAACAAAGTTGCAGAGGGG + Intergenic
1023339278 7:39202284-39202306 GAAAGAAAAAAGAGACAGAAGGG + Intronic
1024078714 7:45837751-45837773 GAATGAACAAAGTTGCAGAGGGG - Intergenic
1024759562 7:52579239-52579261 GAAAGAACATACTTTCAGCTAGG - Intergenic
1026385165 7:69839643-69839665 CAAAGAACAAAGTGTTTAATTGG - Intronic
1027418891 7:78000723-78000745 GAAAAAAAAAAGTCACAGATTGG - Intergenic
1029915567 7:104206430-104206452 GAAAGAGCAAATTGGCAAATAGG - Intronic
1030619986 7:111778759-111778781 TAAAGAAAAAAGTCTCAGCTGGG + Intronic
1030758476 7:113320252-113320274 GAAAGAACAAAAAGACAGTTTGG - Intergenic
1031741320 7:125435168-125435190 GAAAAATCCAAGTGTCAGACAGG + Intergenic
1031970446 7:128061269-128061291 GAAAGAACAATCTGTAGGATGGG - Intronic
1032579608 7:133092090-133092112 GAAAGAACCAAGACTCAGAGAGG + Intergenic
1032750219 7:134832123-134832145 GAAGGAAGAAAGCCTCAGATGGG - Intronic
1033970815 7:147036983-147037005 GAAAGAAGAATTTGTCAGCTAGG - Intronic
1035181880 7:157095383-157095405 CAAAGAACAAAAAATCAGATTGG - Intergenic
1035672007 8:1425458-1425480 GAAAGAAAGAAGTGTCTGATGGG + Intergenic
1035709557 8:1701729-1701751 GAAATAACAAAATGTAAGCTGGG - Exonic
1035908909 8:3543964-3543986 GAAAGCAGAAAGAGTCAGATAGG + Intronic
1036055623 8:5250608-5250630 GTAAGAGCAAAGTGAGAGATGGG - Intergenic
1036734115 8:11293565-11293587 AAAAGAACAAACTGACAAATTGG - Intronic
1037227075 8:16605192-16605214 AAAAGATCAATGTATCAGATTGG - Intergenic
1037270954 8:17129972-17129994 GAAAGAAAAAAGTGTTAAACTGG + Intergenic
1037297962 8:17421172-17421194 GAAGGAACAAAATTTGAGATTGG + Intergenic
1038666786 8:29544310-29544332 GAAAAAAGAAAAGGTCAGATGGG - Intergenic
1040984670 8:53280685-53280707 GACAAAACAAAGTGTGTGATTGG + Intergenic
1041794901 8:61737035-61737057 GAAAACACAAGCTGTCAGATGGG + Intergenic
1042227209 8:66523193-66523215 GGAAGAACAAAGCAGCAGATGGG - Intergenic
1043274086 8:78371704-78371726 CAAAGAACAAAATGTGAAATTGG - Intergenic
1043679474 8:83004078-83004100 GTAAGATCAAGGTGTCAGCTGGG - Intergenic
1043871174 8:85434772-85434794 GAAAGAATAAAGTGTGCTATGGG + Intronic
1043966580 8:86484420-86484442 GAAATAACAAACTGTCGGCTGGG + Intronic
1044340206 8:91038275-91038297 GAAAGAGAAAGGGGTCAGATTGG + Intronic
1044589635 8:93901357-93901379 CAAAGAGCAAAATGTTAGATAGG + Intronic
1044640751 8:94378926-94378948 GAAAGAACCAAGTGTAGCATGGG + Intronic
1045640500 8:104245100-104245122 GAAAGCACATAGAGTGAGATAGG - Intronic
1045809525 8:106205185-106205207 GAAAAAACAACTTGTCACATTGG - Intergenic
1045933985 8:107657826-107657848 AAAGGAACAAAGCCTCAGATGGG + Intergenic
1046302173 8:112309889-112309911 TAAAAAACAAAATGTAAGATAGG - Intronic
1046920864 8:119727108-119727130 AAAAAAAAAAAGTGTCAGAAAGG - Intergenic
1047071421 8:121347972-121347994 CACAAAACAAAGTGTCTGATTGG + Intergenic
1047271422 8:123363046-123363068 GAAAAAACAAAGAGTCTGGTTGG + Intronic
1047989978 8:130276011-130276033 GAAAGAACCAAGTTTCAAAAAGG + Intronic
1049736380 8:144208706-144208728 GAAAAAAAAAAGTGTGATATTGG - Intronic
1049787650 8:144458746-144458768 GAGAGAACAAAGTCTCAAAGTGG + Intronic
1050311128 9:4354241-4354263 GAAAGTACTCAGTTTCAGATGGG - Intergenic
1050658565 9:7857083-7857105 GAAAAAAAAAAGTCTCAGACTGG - Intronic
1050722269 9:8604242-8604264 GAAAGAGCAAAGTGCCACAGTGG + Intronic
1050816881 9:9825155-9825177 GAAGAAACAAAATGGCAGATAGG - Intronic
1051843443 9:21424632-21424654 GAAAGCAAAAATTGACAGATGGG - Intronic
1052180523 9:25520525-25520547 GGAAGAATAAAGTATCAGAATGG + Intergenic
1052524346 9:29594737-29594759 GAAAGAACAAATTGATAAATTGG + Intergenic
1054936042 9:70688686-70688708 GAATGAACAAAAAGGCAGATAGG - Intronic
1055848979 9:80602423-80602445 GAAAGAACACAGTGTTGGAGAGG + Intergenic
1056167451 9:83952966-83952988 AAAAAAAAAAAGTATCAGATTGG + Intronic
1056368914 9:85934785-85934807 TAAAGAACTGAGGGTCAGATTGG + Intergenic
1056895822 9:90548445-90548467 GAAACAGGAAACTGTCAGATAGG + Intergenic
1057876914 9:98764127-98764149 GAAAGAAAAAACTGTCACGTTGG - Intronic
1058054988 9:100440346-100440368 GAGAGAAGAAAGGGTCAGAAAGG - Intronic
1058526147 9:105859845-105859867 GAAAGAACAAAGAGAAAGAAAGG + Intergenic
1059130692 9:111745656-111745678 GAAAGAACCAAGTGTCAGCCGGG - Intronic
1059194909 9:112361889-112361911 GAAAGTAACAAGTGTCGGATGGG - Intergenic
1059662233 9:116413355-116413377 TAAAGAACAAAGTTTAAGCTAGG + Intergenic
1186586720 X:10882743-10882765 GAAAAAACTATGTGTCAGTTTGG - Intergenic
1187133281 X:16523370-16523392 GAAAGAAAAAAGATTGAGATTGG + Intergenic
1187223329 X:17352108-17352130 GATAGAAAAAAGTAACAGATGGG - Intergenic
1187844203 X:23519889-23519911 GAAAAAACAAAATGACGGATGGG - Intergenic
1187885437 X:23884668-23884690 AAAAGTACAAAGTTTCAGTTAGG + Intronic
1188713229 X:33428355-33428377 GTAAGAACAATGTGTCATTTAGG - Intergenic
1189423548 X:40878393-40878415 TAAAGGACTAAGTGTAAGATGGG - Intergenic
1189438816 X:41016468-41016490 GAAAAAAAAAAGAGTCATATAGG - Intergenic
1189452718 X:41153773-41153795 GAAACAACAAAGTATCAGTGGGG - Intronic
1190221288 X:48514069-48514091 GAAAGAAAAGAGAGTCAGAGAGG - Intronic
1191921923 X:66266185-66266207 GAAAGAGCTAAGACTCAGATTGG - Intronic
1192219424 X:69187185-69187207 GAGAAAACAAAGTCTCAGAGTGG + Intergenic
1193500669 X:82270459-82270481 GAAAGCAAAAATTGTCAAATGGG - Intergenic
1193623277 X:83783706-83783728 GAAAGTACAAAGGCTCAAATGGG + Intergenic
1194531383 X:95053820-95053842 AAAATTACAAAGTTTCAGATAGG + Intergenic
1195393996 X:104391576-104391598 GAAAGAACAATGTGCAAGAGAGG - Intergenic
1195617560 X:106924809-106924831 GAAAGAAGAAAGAGAGAGATGGG - Intronic
1195645965 X:107230824-107230846 CAAGGAAGAAAGTGTCACATTGG - Intronic
1196502959 X:116407185-116407207 GAGAGTACAAAGTTTCAGTTAGG - Intergenic
1197526377 X:127569401-127569423 GAAAGTATAAAGCTTCAGATGGG - Intergenic
1197569092 X:128127479-128127501 GAGAATACAAACTGTCAGATGGG - Intergenic
1197939690 X:131776906-131776928 AAAAGAAAAAAGCCTCAGATGGG + Intergenic
1198026960 X:132716336-132716358 GAAAGACTAAATTGTCAAATAGG - Intronic
1198363454 X:135917775-135917797 GAAAGAACCAATTGACAGAGCGG + Intergenic
1199109976 X:143920470-143920492 GGAAAAACACAGTGACAGATTGG + Intergenic
1199718776 X:150526904-150526926 CAAGGAACAAGGTATCAGATGGG + Intergenic
1200016984 X:153172823-153172845 GAAAGAAAAAATTGCCAAATTGG + Intergenic
1200863688 Y:8019890-8019912 GAATGAAAACAGTGTCAGCTGGG + Intergenic