ID: 904257842

View in Genome Browser
Species Human (GRCh38)
Location 1:29267704-29267726
Sequence CGTTGTACACAGAGAGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 82}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
904257842 Original CRISPR CGTTGTACACAGAGAGAGCT GGG Intronic
903579973 1:24363471-24363493 CTTTGCACTCAGACAGAGCTGGG + Intronic
904257842 1:29267704-29267726 CGTTGTACACAGAGAGAGCTGGG + Intronic
912545746 1:110450219-110450241 CGTATGACACAGAGAGGGCTGGG + Intergenic
918016468 1:180638255-180638277 CATTGTACACAGATACAGATGGG + Intronic
921379866 1:214513557-214513579 CGTAGCACACAGAGAGTGGTGGG - Intronic
1069769688 10:70889843-70889865 TGTTGTACACATAGAAATCTTGG + Intergenic
1069963074 10:72089868-72089890 CGCTGTACAGTGAGAGAGCACGG + Intergenic
1071208350 10:83310273-83310295 CATTCTAGGCAGAGAGAGCTGGG - Intergenic
1073224669 10:101907717-101907739 AGTGGTACACAGAAATAGCTGGG + Intronic
1075547322 10:123364786-123364808 GGTTGTACAGACAGAGAACTGGG + Intergenic
1079249928 11:18779961-18779983 GGCTGTACATAGGGAGAGCTTGG + Intronic
1082069042 11:47923864-47923886 CAGTGTCCACAGAGAGAGCAGGG - Intergenic
1086283565 11:85219411-85219433 CCTTGAAGACAGAGAGAACTAGG + Intronic
1088813598 11:113407290-113407312 AGTGGCACACAGAGAGGGCTGGG + Intergenic
1089642755 11:119858580-119858602 CGAAGCACACAGAGGGAGCTGGG + Intergenic
1095633075 12:44400569-44400591 CGTTGATCAAAGAGAGAACTGGG + Intergenic
1109955707 13:69562919-69562941 CGTTGAACCTAGAGAGAGCAGGG + Intergenic
1124191379 15:27580142-27580164 AGTGGGACACAAAGAGAGCTGGG - Intergenic
1126872295 15:53002567-53002589 CATTCTAGACAGAGGGAGCTGGG - Intergenic
1128353266 15:66906184-66906206 CTTTGGAATCAGAGAGAGCTGGG + Intergenic
1135030382 16:19033429-19033451 CCTTGTACTCAGAAAGTGCTAGG - Intronic
1138223223 16:55270713-55270735 CCTTGTACACAGTCAGTGCTAGG + Intergenic
1140558892 16:75954424-75954446 CGGTGCACACAGAGGGAGCCTGG + Intergenic
1143153108 17:4819122-4819144 CTTCGTACACACGGAGAGCTGGG + Exonic
1154245967 18:12698979-12699001 TGAAGTACACAGAGAAAGCTTGG - Exonic
1154331240 18:13430524-13430546 CGTTGTACACAGTGAGATCCCGG + Intronic
1159136953 18:64347786-64347808 CTTTGCCCACAGAGAGAGATAGG + Intergenic
1161495486 19:4583937-4583959 CGTTCTAGGCAGAGAGACCTCGG + Intergenic
1164766752 19:30778160-30778182 ACTGGTCCACAGAGAGAGCTCGG - Intergenic
1164973308 19:32550847-32550869 CGTTGTCCACAGAGGGTGCCAGG - Intergenic
1165305815 19:35002061-35002083 AGCTGTACACAGAGAGGCCTAGG - Intronic
1167343887 19:48933289-48933311 GGTTGTTCACAGAGAGAGAGAGG - Intergenic
933663695 2:84947529-84947551 TGTTGTACAATGAGAGAGCTTGG - Intergenic
935755290 2:106271800-106271822 TGTTGTACCCAGAGAGGGCCTGG - Intergenic
937074430 2:119090724-119090746 GGATGTACAGAGAGAAAGCTGGG - Intergenic
937466890 2:122140843-122140865 CGCTGTACACATAGAGAGTTTGG + Intergenic
939651286 2:144765669-144765691 CTTTATAGACAGATAGAGCTTGG - Intergenic
940333126 2:152497050-152497072 CGTTCTCAACAGATAGAGCTAGG + Intronic
940373648 2:152930840-152930862 CTCTGTTCACAGAGAGAGATAGG + Intergenic
942501979 2:176600905-176600927 CGTTTTACAAAGAGAGAAGTAGG + Intergenic
945612172 2:212017554-212017576 CATTGTATACTGAGAGAGCATGG - Intronic
1170205954 20:13798861-13798883 CCTTATACTCAGAGAGTGCTAGG + Intronic
1170345033 20:15376313-15376335 GGTTGGATACAGAGAGAACTTGG + Intronic
1170927745 20:20741328-20741350 TGGTGTGCACAGATAGAGCTGGG - Intergenic
1173647782 20:44644343-44644365 CATTGAACACAGAGAGCACTAGG - Intronic
1174630626 20:51953876-51953898 CTTTGTACAAAGAGAGAGGGAGG - Intergenic
1174783718 20:53413171-53413193 CATAGTCCTCAGAGAGAGCTGGG + Intronic
1177120446 21:17131941-17131963 GGTTGAAGACAGAGAAAGCTGGG + Intergenic
1178040802 21:28638893-28638915 CGTTGTCCACATTGTGAGCTTGG - Intergenic
1179800899 21:43811121-43811143 CGTGGTACACAGGTAGAGGTGGG - Intergenic
1185032149 22:48449767-48449789 CGTGGCACACAGGGAGAGGTGGG + Intergenic
950626673 3:14252591-14252613 AGGTAGACACAGAGAGAGCTAGG + Intergenic
950893731 3:16428694-16428716 CGTTGTACACACATGGAGCTAGG - Intronic
953134106 3:40167900-40167922 TGATGTTCACAGAGAGAGCATGG - Intronic
953753224 3:45625257-45625279 TGTTGTGCACAGAGAAAGTTAGG + Intronic
955930410 3:64050702-64050724 AATTGTATATAGAGAGAGCTGGG + Intergenic
956905685 3:73762826-73762848 GGATGTACACAGAGAGGGCATGG - Intergenic
959790422 3:110354763-110354785 GGTTGAACACAGAAAAAGCTAGG + Intergenic
962773922 3:138640814-138640836 TGTTGTACACAGTGAGAATTAGG + Intergenic
962968655 3:140378682-140378704 CCTTGTACTCAGAAAGAGCATGG + Intronic
965012390 3:163111077-163111099 CTTTATACACAAAGAGAGATCGG - Intergenic
968287380 3:197517001-197517023 CTTTGTCCTCAGAGAGATCTGGG - Intronic
969301203 4:6298434-6298456 TGTTGACCCCAGAGAGAGCTAGG + Intronic
975591655 4:76006515-76006537 CTTTGGACTCAGAGAGATCTGGG - Intronic
985704226 5:1391361-1391383 CGTTGGTCACAGAGACAGCTGGG - Intergenic
985975102 5:3413098-3413120 AGACATACACAGAGAGAGCTGGG - Intergenic
1002463040 5:179386118-179386140 CGGTGAACGCAGAGAGTGCTGGG - Intergenic
1002612315 5:180428926-180428948 AGTTGTGCAGAGAGAGAACTGGG - Intergenic
1008428761 6:51390149-51390171 CTTTGTATAAAGAAAGAGCTAGG + Intergenic
1010438489 6:75863959-75863981 CCTTGTACCCAGAAAGAGCCTGG + Intronic
1014491011 6:122061781-122061803 CCTTGAGTACAGAGAGAGCTGGG + Intergenic
1018487040 6:164251291-164251313 GGCTTTACACAGAGACAGCTCGG - Intergenic
1022441753 7:30438833-30438855 AGTTGTACAAAGAGAGAGAAGGG + Intronic
1028422007 7:90643616-90643638 GGTTCGACACAGAAAGAGCTTGG - Intronic
1029876879 7:103763766-103763788 CGTTGGAGAGAGAGAGAGGTGGG + Intronic
1030622109 7:111801344-111801366 CCTTGTACAGAGACAGAGGTGGG - Intronic
1033814800 7:145058675-145058697 GTTTGTACACACAGAGAGCTTGG + Intergenic
1034197819 7:149261904-149261926 CGTGGGACGCAGAGAGAGGTTGG + Intergenic
1035457929 7:159021338-159021360 CCTTGTACACAGTGACAGCCAGG + Intergenic
1039517146 8:38143727-38143749 CTTTTTCCACAGAGAAAGCTTGG + Exonic
1040035938 8:42869939-42869961 CTTTGTACACATAGAGGTCTTGG + Intronic
1043525158 8:81088572-81088594 TGGTGTAATCAGAGAGAGCTGGG + Intronic
1043648990 8:82563315-82563337 CATTGCACACAGATAGATCTTGG + Intergenic
1044561191 8:93613809-93613831 AGTTGTACAGTGAGTGAGCTGGG - Intergenic
1048813433 8:138309196-138309218 TGATGTCCACAGAGAGAGCAGGG - Intronic
1049004176 8:139844454-139844476 CGTTGTTCACAGAAAGAGCAGGG - Intronic
1055950960 9:81729244-81729266 CATTGTATATAGAGAGAGCTTGG + Intergenic
1060723451 9:125992930-125992952 CATTATCCACAGAGAGAGCCAGG - Intergenic
1194492629 X:94570129-94570151 CGTCCTACACAGAGAAAACTGGG + Intergenic
1196760960 X:119200482-119200504 GGTTGTTCAGAGAGAGACCTTGG + Intergenic
1200425836 Y:3019563-3019585 CCTTGTAGAGAGAGAGAGGTAGG + Intergenic